ID: 1083776371

View in Genome Browser
Species Human (GRCh38)
Location 11:64896075-64896097
Sequence CAGAAGGACCCCAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083776371_1083776376 -5 Left 1083776371 11:64896075-64896097 CCAGCTTCCCTGGGGTCCTTCTG 0: 1
1: 0
2: 5
3: 37
4: 344
Right 1083776376 11:64896093-64896115 TTCTGGCCTAGCGAAGCGTATGG 0: 1
1: 0
2: 0
3: 1
4: 23
1083776371_1083776379 11 Left 1083776371 11:64896075-64896097 CCAGCTTCCCTGGGGTCCTTCTG 0: 1
1: 0
2: 5
3: 37
4: 344
Right 1083776379 11:64896109-64896131 CGTATGGCCTGAATGAACCAGGG 0: 1
1: 0
2: 0
3: 2
4: 64
1083776371_1083776378 10 Left 1083776371 11:64896075-64896097 CCAGCTTCCCTGGGGTCCTTCTG 0: 1
1: 0
2: 5
3: 37
4: 344
Right 1083776378 11:64896108-64896130 GCGTATGGCCTGAATGAACCAGG 0: 1
1: 0
2: 0
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083776371 Original CRISPR CAGAAGGACCCCAGGGAAGC TGG (reversed) Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900190119 1:1349624-1349646 CGGAGGGACCCCGGGGACGCCGG + Intergenic
900605769 1:3522914-3522936 CAGAAGCCCCGCAGGGCAGCGGG + Intronic
900961238 1:5922149-5922171 AAGAAGGAGCCAAGGGACGCAGG + Intronic
900967556 1:5969408-5969430 CTGCAGGATGCCAGGGAAGCAGG + Intronic
901439621 1:9269790-9269812 CAGCAGGAACCCTGGGCAGCGGG + Exonic
901442905 1:9290415-9290437 CAGAAGAACCCCTGGGGAGTGGG - Intergenic
902220453 1:14961193-14961215 CCGAAGGACCCCAAGGGTGCTGG - Intronic
902642295 1:17774659-17774681 CAGAAGGGAGCCAGGGAGGCTGG + Intronic
903174624 1:21573593-21573615 TAGGAGGACTCCAAGGAAGCTGG - Intronic
903218039 1:21853995-21854017 CATAGGGAGCCCAGGTAAGCTGG + Intronic
903299629 1:22369558-22369580 TAGAAGGACAACAGGGAACCAGG - Intergenic
903541284 1:24097750-24097772 GTGAAGGCCCCCAGGGAAGCGGG + Intronic
903667880 1:25018848-25018870 CAGATGGACCCCAGGGGTTCAGG - Intergenic
903975300 1:27145873-27145895 CAGCATGATCCCAGGGAAGGCGG + Intronic
904120893 1:28197077-28197099 CACTGGGGCCCCAGGGAAGCGGG + Intergenic
904212980 1:28897918-28897940 CAGAGTGAGCCCAGGGGAGCAGG + Intronic
904882985 1:33714660-33714682 CAGACGGTACCCGGGGAAGCAGG + Exonic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905840579 1:41174293-41174315 CACAAGGAGCCCAGAGTAGCTGG - Intronic
906544610 1:46612281-46612303 CAGAGGGAACCCCGGGAGGCTGG + Intronic
906928189 1:50141606-50141628 GAGATGGTCCCCAGGGAAGGAGG - Intronic
908767531 1:67567932-67567954 GAGAATGACCCCAGGTAAGCTGG - Intergenic
910338074 1:86155931-86155953 GAGAAGCACCTCGGGGAAGCAGG + Intronic
911002580 1:93180912-93180934 CAGAACTCCCCCAGGTAAGCCGG - Intronic
911456561 1:98131525-98131547 TGGAAGCACCCCAGAGAAGCAGG + Intergenic
911733095 1:101309967-101309989 ATGAGGGACTCCAGGGAAGCTGG - Intergenic
912696913 1:111848828-111848850 TAGAAGGATGCCAGGGACGCGGG + Intronic
913530670 1:119732275-119732297 AAGCAGGACTCCAGGGCAGCTGG - Intronic
914829026 1:151157215-151157237 CAGAAAGCCCCAAGGCAAGCTGG + Intronic
915726107 1:158018734-158018756 CAGATGGCCTCCAGGGAAGGAGG - Intronic
916387795 1:164296215-164296237 CAAAAGGATCCCAGTCAAGCAGG - Intergenic
918147084 1:181766403-181766425 CAGAACAACCCCAGGGAATAGGG + Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918521557 1:185420542-185420564 GAAAAGGACTGCAGGGAAGCCGG + Intergenic
919241449 1:194921853-194921875 TGGAAGGACCCCAGTAAAGCTGG + Intergenic
920339963 1:205269535-205269557 CTGAAGGACCCCCTGGAAGATGG + Exonic
921905016 1:220487034-220487056 CAGAAGGGGCTCAGGGAAGCTGG + Intergenic
923459718 1:234197642-234197664 CACAAGAACCCCAGGGTAGAGGG + Intronic
923480329 1:234377640-234377662 CAGAAGGATCAGAGTGAAGCTGG - Intronic
923790577 1:237107859-237107881 CAGGGGAACCCCAGGGAAGGAGG - Intronic
923862794 1:237908423-237908445 GAGAAGGATGCCAGGGAAGTTGG + Intergenic
1062788215 10:282903-282925 CAGATGGACCCCGTGGGAGCAGG + Intronic
1063084207 10:2800376-2800398 CAGAATGACGTCAGGGAAGAAGG + Intergenic
1066517964 10:36184943-36184965 CAGAAGGACCACTGGGGGGCTGG + Intergenic
1067753524 10:48986873-48986895 CAGCAGGCACCCAGGAAAGCAGG + Intergenic
1069619494 10:69827910-69827932 AAGAAGGACCACAAAGAAGCGGG - Intronic
1071032806 10:81205145-81205167 TGGAAGGACCCCAATGAAGCTGG + Intergenic
1071600937 10:86958431-86958453 CAGCAGGAGCCCAGGGAGCCTGG + Intronic
1072125418 10:92441434-92441456 CAGAAGGAGCCCAGTCAGGCCGG - Intergenic
1072690832 10:97571364-97571386 CATGAGGACACCAGGGGAGCTGG - Intergenic
1073183684 10:101602332-101602354 CACGAGGCCCACAGGGAAGCAGG + Intronic
1074080667 10:110165911-110165933 CAGATGGAGGCCTGGGAAGCAGG - Intergenic
1076254715 10:129012812-129012834 CAGAAGGACCCCAGTGAAGAGGG + Intergenic
1076477507 10:130762735-130762757 CCCAAGAGCCCCAGGGAAGCAGG - Intergenic
1077102266 11:827533-827555 CAGCAGGGCCCCAGGGAGGTGGG - Intronic
1077293989 11:1815475-1815497 GAGAAGGGCCCCATGGGAGCAGG + Intergenic
1077480019 11:2809664-2809686 CAGGAGGATAGCAGGGAAGCAGG - Intronic
1077660718 11:4066172-4066194 CAGAGCTAACCCAGGGAAGCTGG - Intronic
1079725064 11:23870344-23870366 CACAAGCAGCCCAGGGAAGCTGG + Intergenic
1079786538 11:24680276-24680298 CAGAAGCAGCACAGGGAAGCTGG - Intronic
1079956053 11:26866087-26866109 CGGAAGGACCAAAGAGAAGCAGG + Intergenic
1080600619 11:33818375-33818397 CATAACGACCCCATGGAAGCGGG - Intergenic
1081584797 11:44376894-44376916 CAGCAGAATCCCAGGGAAGGGGG - Intergenic
1081677508 11:44979564-44979586 CAAAGGGACCCCAGGAGAGCAGG + Intergenic
1083244009 11:61411678-61411700 CAAATGGAGCCCAGGGAATCTGG - Intronic
1083776371 11:64896075-64896097 CAGAAGGACCCCAGGGAAGCTGG - Intronic
1084150420 11:67285593-67285615 CAGCAGGAGCCGAGGCAAGCGGG - Exonic
1084421294 11:69061892-69061914 CAGAAGGAAGGCAGGGAAGATGG + Intronic
1086331756 11:85761443-85761465 CAGAATGCCCCCAGGAGAGCAGG + Intronic
1087137927 11:94739427-94739449 CTTAGGGAGCCCAGGGAAGCAGG - Intronic
1089180994 11:116582778-116582800 CAGGCGGATCCCAGGGAGGCAGG + Intergenic
1089388073 11:118080767-118080789 CAGAAACGCCCCAGGGCAGCAGG + Intronic
1090771101 11:129920570-129920592 CAAGAGGAAGCCAGGGAAGCGGG - Intronic
1091567780 12:1661498-1661520 CAGAAGGGCCCCAGGGTGGGCGG - Intergenic
1091702103 12:2670289-2670311 CAGAAGGAGCCCCGGGCAGGTGG + Intronic
1091715531 12:2773677-2773699 CAGGAGGAGGTCAGGGAAGCCGG - Intergenic
1091838550 12:3602905-3602927 CAGAAGGAAATCAGGGAAGCAGG - Intergenic
1091845570 12:3653764-3653786 AAGAGGGACCAGAGGGAAGCAGG - Intronic
1092136079 12:6148168-6148190 CTGAAGGACCCCAGGGTCTCTGG + Intergenic
1095461401 12:42448061-42448083 AGGAAAAACCCCAGGGAAGCGGG - Intronic
1096362699 12:51001906-51001928 CAAAAGGACTCAAGGGAAGATGG + Intronic
1096685095 12:53283032-53283054 CAGAAGGAAGCATGGGAAGCAGG + Intronic
1098308265 12:69123025-69123047 CAGAAGGGTCCCAGCGCAGCAGG - Intergenic
1101919758 12:108922870-108922892 CTGAATCACCCCAGGGAAGGAGG - Intronic
1104021401 12:124994432-124994454 CAGAAGGTCCCAGGGGAAGTGGG - Intronic
1104108954 12:125688223-125688245 CAGAAGGGCCCCAGGAAGCCTGG - Intergenic
1104906105 12:132214280-132214302 CAGCAGGAGCCCAGGGATGAAGG + Intronic
1105771899 13:23619918-23619940 GACAAGGACCACGGGGAAGCAGG - Intronic
1106017695 13:25884843-25884865 CAGAAGGGCCCCAGGGATCTGGG - Intronic
1107424199 13:40276408-40276430 CAGAAGGAGCCCGGTGAAGGAGG + Intergenic
1108582511 13:51839171-51839193 CAGCAGGTCCACAGGGGAGCCGG - Intergenic
1108590065 13:51905448-51905470 CAGAGCAACCCAAGGGAAGCCGG + Intergenic
1109912927 13:68940366-68940388 GAGAAGGACCTAGGGGAAGCAGG - Intergenic
1110381124 13:74852268-74852290 CACCAGGACCCTTGGGAAGCAGG - Intergenic
1112299508 13:98217391-98217413 CAGAAGCCCCCCAGGAGAGCAGG + Intronic
1113207161 13:107930377-107930399 TAGAAGGACCCCAGAGAAGCAGG - Intergenic
1113507986 13:110830435-110830457 CAGAGGGACACCAGGGAAGAGGG + Intergenic
1113569030 13:111339999-111340021 CCGAAGGAGCCCAGGCAGGCAGG - Intronic
1113835085 13:113323472-113323494 GAGAAGGACGTCAGGGAAACGGG + Exonic
1114424774 14:22612308-22612330 GAAAAGGAGCCCAGGGCAGCTGG - Exonic
1114526968 14:23372475-23372497 CAGAGGGACACCTGGGAAGAGGG + Intergenic
1114670771 14:24409844-24409866 CAGAAGGTGCCCACGGATGCAGG + Exonic
1115470425 14:33763164-33763186 CAGAAAGACCTCAAGCAAGCTGG - Intronic
1115640512 14:35332810-35332832 AAGAGGGAACCCAGGGAAGAAGG + Intergenic
1118911285 14:70064094-70064116 CAGGAGGAGCCCAGTGAGGCTGG - Intronic
1120423219 14:84314605-84314627 CAAAAGTACCCCAGGAAATCTGG - Intergenic
1122319436 14:100845039-100845061 CTGGAGGAGACCAGGGAAGCGGG - Intergenic
1122461401 14:101898584-101898606 CGGAAGGACCCAACTGAAGCCGG - Intronic
1122597278 14:102902387-102902409 CAGAACGACCCCAGGGTCCCAGG - Intronic
1122882428 14:104696151-104696173 CAGAAGGGCCCCCTGGGAGCAGG - Intronic
1122947616 14:105020497-105020519 CCGGAGGAGCCCAGGGAAGACGG + Intronic
1124097447 15:26661754-26661776 CAGAAAGAGCCCAGCTAAGCAGG + Intronic
1124516305 15:30369860-30369882 CAGAGAGACACCAGGGATGCAGG + Intronic
1124614699 15:31233142-31233164 AAGAAGGCCTCCAGGGAAGGCGG + Intergenic
1124726613 15:32160871-32160893 CAGAGAGACACCAGGGATGCAGG - Intronic
1126795341 15:52256197-52256219 CAGGAGGCTCTCAGGGAAGCTGG + Intronic
1127554822 15:60077684-60077706 CAGCAGCAACCCAGGGATGCAGG - Intergenic
1128674752 15:69600305-69600327 CAGAGGGGCCTCAGGGAACCAGG - Intergenic
1129718014 15:77863033-77863055 AAGAAGGCCCACAGGGAGGCAGG - Intergenic
1130311969 15:82764120-82764142 CAGCATGACCCCTGTGAAGCAGG + Intronic
1130957848 15:88639654-88639676 CAGATGGGCACCAGGGAAGAGGG - Intronic
1131642481 15:94307418-94307440 CATAAAGGCCCCAGGGTAGCAGG + Intronic
1132152327 15:99471258-99471280 CCCAAGGATCCCAGAGAAGCTGG + Intergenic
1132304730 15:100802789-100802811 TGGAAGGAGCCCAGGGCAGCGGG - Intergenic
1132744394 16:1430670-1430692 CAGGAGGACCCTGGGGAAGGGGG - Intergenic
1133212326 16:4270644-4270666 CAGCAGTCCCCCAGGGTAGCTGG - Intronic
1133382032 16:5339250-5339272 CAGACAGACCTCAGGGAAACTGG - Intergenic
1133915608 16:10106833-10106855 GAGAAGGAAGGCAGGGAAGCTGG + Intronic
1134006606 16:10822339-10822361 CAGAACAACCCCAGGGAAGGAGG + Intergenic
1134444632 16:14321549-14321571 CAGAAGGCCCTGAGGGAGGCAGG + Intergenic
1135056752 16:19238425-19238447 CAGGAGAACCCCAGGGTAACAGG - Intronic
1136005562 16:27326725-27326747 CAGCAGGCCCACAGGGAGGCTGG + Intronic
1138147912 16:54628653-54628675 CAGAAGGAAAGAAGGGAAGCAGG + Intergenic
1138536747 16:57664195-57664217 GAGGAGAACCCCAGGGAAGATGG - Exonic
1138550305 16:57744140-57744162 CAGAAGCACAGCAGGGAAGAGGG + Intronic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1139516335 16:67454458-67454480 CAGAAGGGCCCGGGGGAAGCAGG + Intronic
1140981042 16:80109584-80109606 CAGAAGGACACATGGGAAGGTGG + Intergenic
1141041517 16:80676502-80676524 CAGAAGAGGCCCAGGGAAACTGG - Intronic
1141903491 16:87007706-87007728 CAGTTGGGCCCCAGGGAAGCAGG - Intergenic
1142590257 17:1001724-1001746 GAGAAAGCTCCCAGGGAAGCGGG + Exonic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1143102685 17:4513062-4513084 CAGGAGGTCCCCGGGGAGGCAGG + Intronic
1143141838 17:4745466-4745488 CAGGAGGGCCCCAGGACAGCAGG - Intronic
1143315730 17:6032057-6032079 CACAAGGACTCCAGAGAACCCGG + Intronic
1143336757 17:6177259-6177281 CAGAAAGACTCAAGGGAAGAAGG + Intergenic
1143407434 17:6686704-6686726 GAGGAGGTCCACAGGGAAGCTGG - Intronic
1144765225 17:17728897-17728919 CTGCAGGACCCCTGGGAGGCTGG + Intronic
1144855906 17:18267671-18267693 CTGCAGGACCCAAGGGAAGCAGG + Intergenic
1144956108 17:19019701-19019723 CAGAAGGCCCCCTGGGGAGGAGG - Exonic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1146911919 17:36653789-36653811 GAGAGGGAGCCCAAGGAAGCTGG + Intergenic
1147201737 17:38806828-38806850 AAGAAGAGCACCAGGGAAGCAGG - Exonic
1147381059 17:40056554-40056576 CAGAATGACAGCAGGGGAGCAGG - Intronic
1148428573 17:47622624-47622646 AAGAAGGACACCAGGGAATGGGG - Exonic
1148581458 17:48747022-48747044 CAGAAGGAGCCCCGGGAAGGGGG - Intergenic
1149380797 17:56092106-56092128 CACAAGTGCCCCAGGGCAGCTGG + Intergenic
1150266974 17:63838169-63838191 CAGCAGCACCCCAGGTGAGCAGG + Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151757987 17:76085588-76085610 GAGAAGGAGCCCAGGGGGGCAGG + Intronic
1151977020 17:77488895-77488917 CAGAGGGAACCCAGGGCACCCGG - Intronic
1152124644 17:78439003-78439025 CAGAAGGCCCGGAAGGAAGCAGG - Intronic
1152244483 17:79177952-79177974 GAGACGGCCCCCAGGGAAGTTGG + Intronic
1152648263 17:81480273-81480295 CAGGAGGACCCCCAGGAAGAGGG + Intergenic
1152908765 17:82984967-82984989 CAGAAGGGCCCAAGGCAACCTGG + Intronic
1153606714 18:6841096-6841118 GAGAAGGACCCCAGAGACACAGG - Intronic
1156983129 18:43316115-43316137 CAGAAGAACCCTTGGGAAGCTGG - Intergenic
1157663284 18:49464421-49464443 CAGAAGGACCCTCTGCAAGCAGG + Intergenic
1157788482 18:50508022-50508044 CAGAAGGACAAGAGTGAAGCTGG - Intergenic
1158318510 18:56237979-56238001 CAGACAGGCCCCAGGGAAGAAGG + Intergenic
1158851010 18:61495941-61495963 GAGAACAGCCCCAGGGAAGCAGG - Intronic
1159936172 18:74369326-74369348 CAGAAGGTCCCCAGGAAATGTGG + Intergenic
1160225573 18:77008637-77008659 CAGAAGGGCCCTGGGGGAGCCGG - Intronic
1160583872 18:79902232-79902254 CAAAAGGACCCCCGGGCTGCCGG + Intergenic
1161457726 19:4377941-4377963 CAGAAGGGGCCCTGGGAAGCAGG - Intronic
1161614179 19:5260877-5260899 CCGGGGGGCCCCAGGGAAGCTGG + Intronic
1162495687 19:11022135-11022157 CACAAGGGCCCCAGGGGAGCAGG + Intronic
1162827063 19:13259515-13259537 CAGGAGGAGCCCTGGGGAGCAGG - Intronic
1163111137 19:15161417-15161439 CAGGAGGCCCCCCGGGAAGGCGG - Exonic
1163163420 19:15479384-15479406 CAGAAATACCCCTTGGAAGCTGG - Exonic
1163391975 19:17036621-17036643 CAGACAGACCCCAGGTGAGCTGG - Intergenic
1164597049 19:29537204-29537226 AAGCACGACCCCAGGGAAGGAGG - Intronic
1164673143 19:30084543-30084565 CAGAGGGAGCCCAGGGAATGTGG - Intergenic
1164968663 19:32510607-32510629 CAAAAGGACCCCAGTGTAACAGG + Intergenic
1166069591 19:40379344-40379366 CAGAAGGACAGCAGGAAAGGGGG - Exonic
925106762 2:1298600-1298622 AAGAAGGGACCCAGGGAAGGCGG - Intronic
925192164 2:1893432-1893454 CACAACGGTCCCAGGGAAGCAGG - Intronic
925430839 2:3791665-3791687 CATCAGGCCCCCGGGGAAGCTGG - Intronic
926928025 2:18007883-18007905 TAGAAGGAGCCCAAGGAAGGAGG - Intronic
927461937 2:23306811-23306833 AAAAAGGACTCCAGGGATGCAGG + Intergenic
930031486 2:47060786-47060808 CAGCAGCACCTCAAGGAAGCAGG + Exonic
930613314 2:53566958-53566980 CAGAAGGGCCCCAGAGATGAGGG + Intronic
931065025 2:58576187-58576209 CAGAAGCTCCCGAGGGAAGCTGG + Intergenic
931779053 2:65564280-65564302 AAGCAGCACCCCAGAGAAGCAGG - Intergenic
932587067 2:73036955-73036977 CAGATGGGCCCCATGTAAGCAGG + Intronic
933528026 2:83468535-83468557 GAGAAGGACCCCTGGGAGGGAGG - Intergenic
933737141 2:85504293-85504315 CAGAGGGACCTCGGGGCAGCTGG - Intergenic
933844329 2:86313424-86313446 CAGATGGAATCCAGAGAAGCTGG - Intronic
935152507 2:100450478-100450500 AAGAAGGGCCCAAGGGAAACAGG - Intergenic
935647760 2:105354987-105355009 CAGCAAGAACCCAGAGAAGCAGG + Intergenic
938387528 2:130877677-130877699 GAGAAGGACCCCTGAGAAGGTGG - Intronic
939176695 2:138757390-138757412 GAGGAGGACCCAAGGGAAGGTGG - Intronic
939748128 2:146003698-146003720 CAGACGGTCCCCAGGGAAGAAGG + Intergenic
940250436 2:151669687-151669709 CAGAAGGGCCACAGAGAAGAGGG + Intronic
941646931 2:168050611-168050633 CAGAAGGAGCCGAGGGATGCAGG + Intronic
942001611 2:171653429-171653451 CATAATGACACCAAGGAAGCAGG - Intergenic
946644491 2:221818316-221818338 AAGCAGGACCCTAGGGAAGAGGG - Intergenic
947124220 2:226850484-226850506 CAGAATGACCCCAGTTAATCTGG + Intronic
947257777 2:228183851-228183873 CAGAAGGCCACATGGGAAGCAGG + Intergenic
947909562 2:233792179-233792201 CAGAGGAGCCCCAGGGAAGGAGG - Intronic
1168840343 20:906044-906066 CAGGATGACCCCAGGGATCCTGG + Intronic
1170468284 20:16643028-16643050 CTGAAGGACTACAGGGGAGCTGG - Intergenic
1171266331 20:23774956-23774978 GAGAAGGAGCCCTGGGAACCAGG + Intergenic
1171276081 20:23857590-23857612 GAGAAGGAGCCCTGGGAACCAGG + Intergenic
1172564516 20:35918480-35918502 CAAAAGGACTCCAGAGAAGCAGG - Intronic
1172835166 20:37868763-37868785 TAGAAAGAACTCAGGGAAGCCGG + Intronic
1174433949 20:50491898-50491920 CAATAGGACACCAGGGGAGCTGG + Intergenic
1174986224 20:55455994-55456016 CTGAATTACCCCTGGGAAGCGGG - Intergenic
1175218055 20:57401763-57401785 CAGAAGGAGCCCAGGGCAGTGGG + Intronic
1175223198 20:57429225-57429247 CAGGAGGATCCCAGGCAGGCTGG - Intergenic
1175815339 20:61880630-61880652 CAAGAGGACCCCAGGCCAGCAGG + Intronic
1175821647 20:61913299-61913321 CCTAAGGACTCCAGGGAAGGTGG + Intronic
1176159942 20:63642765-63642787 CGGAGGGTCCCCAGGGATGCTGG + Intronic
1176221681 20:63972284-63972306 CGGAAGGGCCCCAGCGAAGGAGG - Intronic
1176253387 20:64137902-64137924 CAGAAGCTCCCCAGGGCACCTGG + Intergenic
1179117436 21:38507047-38507069 CAGTTGCACCCCAGCGAAGCTGG - Intronic
1179617950 21:42593810-42593832 CAGAAGGAGCCCTGGGAGGAGGG - Intergenic
1179875659 21:44266086-44266108 CAGATGGGCCCCAGAAAAGCTGG + Intergenic
1180173819 21:46077885-46077907 CAGGTGGACCCAAGGAAAGCGGG + Intergenic
1180985147 22:19899581-19899603 CTGAAGGACCCCAGGGACAAGGG + Intronic
1181441221 22:22936030-22936052 CAGCAGGACCCCAGGGAGGGGGG + Intergenic
1181676326 22:24455850-24455872 CGGAGGGAGCCCTGGGAAGCTGG - Intergenic
1182253095 22:29017550-29017572 AAGAGGGACCACAGAGAAGCTGG + Intronic
1183061466 22:35338806-35338828 CAGGAGGGCCCCAGGGTGGCAGG - Intronic
1183617373 22:38953892-38953914 GAGAAGGAGCCCAGAGAAGGAGG - Intronic
1183629736 22:39025842-39025864 CAGGAAGAGCCCAGGAAAGCAGG - Intronic
1183633281 22:39046156-39046178 CAGAGAGACCCCAGGGGTGCAGG - Intronic
1183752009 22:39726511-39726533 CAGAAGGACGTCAGAGAAGCAGG - Intergenic
1184100945 22:42341558-42341580 CAGAAGACCCCCAAGGAAGCAGG + Intronic
1184673531 22:46027969-46027991 CAGAAGGCACCCACGGCAGCCGG - Intergenic
1184979453 22:48085588-48085610 TAGAGGGAGCCCAGGGCAGCTGG + Intergenic
1184981809 22:48100592-48100614 CAGCAGGAGCCCAGGGAACATGG - Intergenic
1185062307 22:48613437-48613459 GAGATGGACCCCAGAGAGGCTGG - Intronic
950161952 3:10766894-10766916 CAGATAAACCACAGGGAAGCAGG - Intergenic
955139545 3:56255549-56255571 CAGGAGGAGCCCAGAGAAGCAGG - Intronic
955668827 3:61380278-61380300 CAGAACCACCCCAGGCAAACTGG - Intergenic
957544554 3:81621003-81621025 AAGAAGGACCTCACGGAGGCGGG + Intronic
958914322 3:100031594-100031616 CAGGAGGAGCCAAGGGATGCGGG - Intronic
961330570 3:126135724-126135746 CAGGAGGAGGCCAGGGAAGCAGG - Intronic
961331839 3:126147181-126147203 CATGGGGACCCCAGAGAAGCTGG - Intronic
961385585 3:126521638-126521660 CAGGAGGACCCCAGGCCAGAGGG + Intergenic
961403331 3:126662470-126662492 CAGGAGGAGACCAGGGATGCCGG - Intergenic
961545717 3:127631436-127631458 CAGAAGGAGGCAAAGGAAGCAGG - Intronic
961601612 3:128066741-128066763 CAGAAGGGGCCCAGAAAAGCTGG - Intronic
962445054 3:135456449-135456471 CAGGAGGATCCCTGGGAAGGGGG + Intergenic
962535750 3:136327557-136327579 CTGAAAGACCCCAGGAAACCAGG - Intronic
962886666 3:139633974-139633996 CAGAAAGACCTGAGGGCAGCTGG - Intronic
963472218 3:145754527-145754549 CAGAAGGTACCCAGGAAAACAGG - Intergenic
963746278 3:149127882-149127904 GGGAAGGACACCAGGGATGCAGG + Intergenic
963972310 3:151443562-151443584 CAGAATCATCCCAGGGAAGTAGG - Exonic
965883182 3:173411792-173411814 CAGATGTAACCCAGAGAAGCAGG - Intronic
968599860 4:1503748-1503770 CAGGAGGACCCCGGGGAGCCGGG - Intergenic
968648541 4:1751465-1751487 CAGAAGAGCCCCAGGGTTGCTGG - Intergenic
969309694 4:6346187-6346209 CAGAGGGTCCCCGGGGGAGCAGG - Intronic
969327469 4:6452211-6452233 CAGATGGCCCCCAGGCTAGCAGG - Intronic
969662529 4:8538555-8538577 GAGCAGGGCCCCAGGGAGGCAGG + Intergenic
969674591 4:8607836-8607858 AAGCACGACCCCCGGGAAGCAGG - Intronic
969694205 4:8725594-8725616 GAAATGGATCCCAGGGAAGCAGG - Intergenic
969696851 4:8739914-8739936 GAGAAGGAACCCAGGGGAGCAGG + Intergenic
970508615 4:16757819-16757841 CAGCAGGACCCCTGTGAAGTAGG + Intronic
971389928 4:26176223-26176245 CAGAAACACCCCACTGAAGCTGG + Intronic
976540455 4:86268449-86268471 CAGCAGGAAACCAGGGAGGCAGG - Intronic
977254427 4:94725353-94725375 ATGAGGGACCCCAAGGAAGCTGG - Intergenic
981000178 4:139821651-139821673 CAGGAGAACACCAGGGAAGCTGG + Intronic
981813007 4:148796656-148796678 GAAAAGGACCTCAGGGAAGTTGG + Intergenic
981835708 4:149050968-149050990 GAGCAGGACCTCAGGGAAGGAGG - Intergenic
983678791 4:170328340-170328362 CAGAAGGACCTCATGGAGGAAGG + Intergenic
985748529 5:1661430-1661452 GGGAGGGACCCCAGGGATGCTGG + Intergenic
985812870 5:2103132-2103154 CAGCAGGAGGCCGGGGAAGCGGG + Intergenic
986223811 5:5794402-5794424 CACAAAAACCCCAGGGAAGGAGG - Intergenic
986336387 5:6758847-6758869 CAAAAGGAACACACGGAAGCTGG - Intergenic
988696918 5:33631280-33631302 ATGAAGGACTCCAGGCAAGCGGG + Intronic
989187894 5:38642732-38642754 CAGAATAAGCCCTGGGAAGCAGG - Intergenic
990056362 5:51584758-51584780 AAGAAGGGCCCCACGGGAGCAGG + Intergenic
990951397 5:61302086-61302108 CAGAAGGGGCCCTGGGAGGCTGG - Intergenic
995564710 5:113421894-113421916 TGGAAGGACCCCAGGGAACTGGG - Intronic
997370370 5:133356024-133356046 CAGAAGGCCCCCTGGGACCCAGG - Intronic
997425341 5:133799136-133799158 CACGTGGAACCCAGGGAAGCTGG - Intergenic
997635298 5:135399749-135399771 CTGAAGGACCCCAGGGGAACCGG - Intronic
998853717 5:146375120-146375142 CAGAGGGTCCCCAGGGAGGCTGG - Intergenic
999244922 5:150148994-150149016 CAGCAGGAGGCCAGGGAAGGAGG + Intronic
1000201302 5:159013533-159013555 CAGAAGGACCCCAAGGTACAGGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001648037 5:173296858-173296880 CAGGAGGCCCCTAGGGTAGCAGG + Intergenic
1002529822 5:179837650-179837672 CAGAGGGACCCCAGGCCAGCTGG - Exonic
1002534734 5:179869972-179869994 CAGCAGGACGCCAGGGAGACAGG - Intronic
1003301717 6:4889946-4889968 CAGCAGGTCCCCAGGGATGCTGG + Intronic
1006007443 6:31013623-31013645 CAACAGGAACCCTGGGAAGCAGG - Intronic
1006092675 6:31637220-31637242 GAGAAGGACCTAAGGGAAGAAGG - Exonic
1006425694 6:33961698-33961720 CACAGGGACTCCAGAGAAGCAGG + Intergenic
1006599761 6:35217618-35217640 CCACAGGAGCCCAGGGAAGCGGG - Intronic
1006981969 6:38154309-38154331 GGGAAGGAGCCCAGGGGAGCTGG + Exonic
1007250337 6:40490859-40490881 CAGATCGAAGCCAGGGAAGCCGG - Intronic
1007340421 6:41187876-41187898 GAGGAAGACCCCAGAGAAGCTGG + Intergenic
1011519988 6:88194583-88194605 CACAATGACAGCAGGGAAGCTGG + Intergenic
1012549659 6:100455367-100455389 CAGGAGGACCCCAGGGACCAGGG - Intronic
1014218183 6:118773584-118773606 CAGAAGGAGCCCAGGCAAGCTGG - Intergenic
1014218200 6:118773645-118773667 CAGAAGGAGTCCAGGCAAGCTGG - Intergenic
1014218218 6:118773706-118773728 CAGAAGGAGCCCAGGCAAGCTGG - Intergenic
1014218236 6:118773767-118773789 CAGAAGGAGCCCAGGCAAGCTGG - Intergenic
1017040304 6:150302995-150303017 CAGCAGTATCCCACGGAAGCAGG + Intergenic
1017500251 6:155017343-155017365 CAGAAGGACCCCTGTGAAAGGGG + Intronic
1017758086 6:157546609-157546631 CAGCAGGGGGCCAGGGAAGCTGG + Intronic
1017864647 6:158432436-158432458 CAGAAAGTTCTCAGGGAAGCAGG - Intronic
1022015512 7:26345564-26345586 CATAGGGAACACAGGGAAGCAGG - Intronic
1022206809 7:28172749-28172771 TGTAAGGACCCCAGGTAAGCTGG + Intronic
1024146473 7:46522437-46522459 CAGAAAGACCCCAGGGAGGGCGG + Intergenic
1024366690 7:48528635-48528657 CAGATGGAACTCAGGGGAGCAGG + Intronic
1024405605 7:48976011-48976033 TACAAGGAGCCCAGGAAAGCAGG + Intergenic
1027144319 7:75683507-75683529 CAGATGCACCCTGGGGAAGCTGG + Intronic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1028267817 7:88749458-88749480 CAGTAGTACCCCGGGGAAGAGGG + Intergenic
1029826939 7:103207363-103207385 CAGATGGAGCCCAGGGAAATGGG - Intergenic
1032000978 7:128265177-128265199 AAGAAGGGCCTCCGGGAAGCCGG + Intergenic
1033494934 7:141884511-141884533 CAGAAAAACCCTAGGGATGCAGG - Intergenic
1034914159 7:155023149-155023171 CAGGAGGATCCCACGGGAGCAGG - Intergenic
1035283567 7:157792597-157792619 CAGTAGGACCTTGGGGAAGCTGG + Intronic
1035382235 7:158447498-158447520 CAGCAGGGCCCCAGGGAGCCCGG + Intronic
1035427225 7:158787122-158787144 CTGCAGGAGCCCAGGGAAGGAGG + Intronic
1035608132 8:942710-942732 CTTAAGGACCCCAGTGAAGTTGG - Intergenic
1035784394 8:2249655-2249677 GAGGAGGAGCCAAGGGAAGCTGG + Intergenic
1036214241 8:6865978-6866000 CAGCAGGACCCCTGGCCAGCTGG + Intergenic
1038589905 8:28827386-28827408 CAGAAGGACCACTTGGAAGGTGG + Intronic
1039429105 8:37511763-37511785 CACAAGGACACCGGGGAGGCAGG + Intergenic
1039565505 8:38549347-38549369 CCCATGGACCCCAGGGATGCAGG - Intergenic
1039613495 8:38937207-38937229 GAGAATGACCTCAGGGAAGGAGG + Intronic
1040277273 8:46020487-46020509 ATGAAGGACCCCAGGGAAAGGGG - Intergenic
1040278551 8:46026114-46026136 AAGAAGGCCCCCAGGGAAAGGGG - Intergenic
1044016375 8:87052259-87052281 CAGAAGGAAGCTATGGAAGCAGG - Intronic
1045583235 8:103500853-103500875 CCGAACCACCCTAGGGAAGCGGG - Intronic
1045649739 8:104330325-104330347 TCCAAGGACCCCAGGGACGCTGG - Intronic
1048348282 8:133595111-133595133 GAGAATGATCCCAGAGAAGCTGG + Intergenic
1048853724 8:138669037-138669059 CAGGAATGCCCCAGGGAAGCTGG + Intronic
1049297823 8:141852515-141852537 CAGAGGGGCCCCGTGGAAGCAGG + Intergenic
1049303769 8:141886240-141886262 CAGAAGGAGACAAGGTAAGCTGG + Intergenic
1049382767 8:142325637-142325659 CAGAAGGACCCTAAGTTAGCAGG + Intronic
1050131782 9:2420512-2420534 CAGAAGGAAACAAAGGAAGCTGG - Intergenic
1051739803 9:20240337-20240359 CAAAGGGAACCCAAGGAAGCTGG + Intergenic
1051748545 9:20318243-20318265 AAGAAGTTCACCAGGGAAGCAGG - Intergenic
1051816024 9:21106335-21106357 CAGAAGGTCCTCAGAGAAGCTGG + Intergenic
1054834046 9:69657963-69657985 CTGTAGAACCCCAGGGATGCAGG + Intronic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1055815020 9:80194840-80194862 CAGATGGTTCCCAGGGAGGCAGG - Intergenic
1056138191 9:83649333-83649355 CACAAAGAACCCAGGGAAGAAGG + Intergenic
1057037020 9:91818503-91818525 CACCTGGACCCCAGGGGAGCTGG + Intronic
1057823322 9:98352169-98352191 GATAAGGACACCAGGCAAGCTGG + Intronic
1058828592 9:108796065-108796087 CAGACTGTCCCCAGGGATGCTGG + Intergenic
1059495046 9:114702532-114702554 CAGAAAGACCCCAGAGATGTGGG - Intergenic
1060034449 9:120242897-120242919 TAGGAGGGCCCAAGGGAAGCAGG + Intergenic
1062053200 9:134457760-134457782 CAGGATGACCCCAGGGCAGGAGG - Intergenic
1062183770 9:135205350-135205372 CAGAAGGTCCCCTGGGGAGGGGG + Intergenic
1062596883 9:137303542-137303564 CAGGAGGACCCCAGGGCCTCAGG - Intergenic
1185546869 X:953122-953144 GAGAATGACCCCAGGGCAGGAGG - Intergenic
1186470334 X:9816526-9816548 CACAAGGACCACAAGGATGCCGG - Intronic
1188041044 X:25369924-25369946 CAGTAGGACTCCAGGGATGTGGG + Intergenic
1195522230 X:105844580-105844602 CTGAAGGGCCTCAGGGAAGTAGG - Intronic
1195721903 X:107876003-107876025 CAGACTGTCCCCAGGGAGGCTGG - Intronic
1195943272 X:110182541-110182563 TAGGAGTTCCCCAGGGAAGCAGG - Intronic
1197325991 X:125094142-125094164 CAGCAGGGCCTCAGGGACGCTGG - Intergenic
1197664681 X:129210849-129210871 CTGAAGGACCCCTGTGAGGCCGG + Intergenic
1198609027 X:138376483-138376505 GAGAAGGACCAGTGGGAAGCTGG - Intergenic
1199166357 X:144679880-144679902 CAGAAGGAACACACGGGAGCTGG + Intergenic
1199575504 X:149310203-149310225 CAGAAGGATCTCAGGGAGGTAGG + Intergenic
1199726076 X:150582576-150582598 CATAAGGACCCCAGTCATGCTGG - Intronic
1199783996 X:151087799-151087821 TAGAAGGAAACCAAGGAAGCTGG - Intergenic
1200059160 X:153476584-153476606 CAGAAGGCGCCTAGAGAAGCTGG - Intronic
1200212896 X:154354753-154354775 CAGAGGGGCCCCAGGGGAACAGG + Intronic
1200875728 Y:8152720-8152742 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic
1200945624 Y:8833058-8833080 CCAAAGGACATCAGGGAAGCTGG + Intergenic
1201583250 Y:15532920-15532942 CATAACCCCCCCAGGGAAGCTGG - Intergenic
1202102691 Y:21327191-21327213 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic
1202188979 Y:22221403-22221425 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic
1202239764 Y:22754458-22754480 CTGAAGGAAGCCAGGGAAGAAGG + Intergenic
1202392750 Y:24388220-24388242 CTGAAGGAAGCCAGGGAAGAAGG + Intergenic
1202478033 Y:25281897-25281919 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic