ID: 1083777964

View in Genome Browser
Species Human (GRCh38)
Location 11:64903414-64903436
Sequence CGGCCCCAGCACCTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1060
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 995}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083777953_1083777964 -8 Left 1083777953 11:64903399-64903421 CCTTCCACCCGGCCCCGGCCCCA 0: 1
1: 0
2: 9
3: 164
4: 3170
Right 1083777964 11:64903414-64903436 CGGCCCCAGCACCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 61
4: 995
1083777952_1083777964 -7 Left 1083777952 11:64903398-64903420 CCCTTCCACCCGGCCCCGGCCCC 0: 1
1: 0
2: 6
3: 76
4: 911
Right 1083777964 11:64903414-64903436 CGGCCCCAGCACCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 61
4: 995
1083777948_1083777964 2 Left 1083777948 11:64903389-64903411 CCTGTGGCCCCCTTCCACCCGGC 0: 1
1: 0
2: 3
3: 23
4: 291
Right 1083777964 11:64903414-64903436 CGGCCCCAGCACCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 61
4: 995
1083777950_1083777964 -5 Left 1083777950 11:64903396-64903418 CCCCCTTCCACCCGGCCCCGGCC 0: 1
1: 0
2: 9
3: 80
4: 879
Right 1083777964 11:64903414-64903436 CGGCCCCAGCACCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 61
4: 995
1083777951_1083777964 -6 Left 1083777951 11:64903397-64903419 CCCCTTCCACCCGGCCCCGGCCC 0: 1
1: 0
2: 9
3: 77
4: 912
Right 1083777964 11:64903414-64903436 CGGCCCCAGCACCTGGGGGAAGG 0: 1
1: 0
2: 3
3: 61
4: 995

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083777964 Original CRISPR CGGCCCCAGCACCTGGGGGA AGG Intronic
900013099 1:132748-132770 CGGCCCCAACCCCTGGGGATGGG + Intergenic
900043165 1:488735-488757 CGGCCCCAACCCCTGGGGATGGG + Intergenic
900064602 1:723732-723754 CGGCCCCAACCCCTGGGGATGGG + Intergenic
900102123 1:966415-966437 CGGCACCAGGGCCTGGGCGAGGG - Intergenic
900144015 1:1150273-1150295 GGGTCCCAGCACCTGCAGGAAGG + Intergenic
900294146 1:1940227-1940249 CAGGCCCAGCACCCGGGCGAGGG - Intronic
900516040 1:3082660-3082682 CAGCTCCAGATCCTGGGGGAGGG - Intronic
900993874 1:6109979-6110001 CTGCTCCAGCAGCTGGGGGCGGG + Exonic
901002482 1:6155498-6155520 AAGCCCCGGCACCTGGGGTAGGG - Intronic
901207738 1:7506337-7506359 CGGCCCCACTCCCAGGGGGAAGG + Intronic
901325033 1:8360681-8360703 TGGCGCCGGCAGCTGGGGGATGG + Exonic
901343623 1:8518309-8518331 CTGTCCCAGCACCTTGGGAATGG - Intronic
901411120 1:9084805-9084827 CAGCCCCATCACCTGGGAGCTGG + Intronic
901429092 1:9201615-9201637 CGCCCCCAGCATGTGGGAGAGGG + Intergenic
903180444 1:21602470-21602492 CGGCCCCAGCGCATGTGGGAGGG - Intronic
903218383 1:21855327-21855349 CGCCACCATCACCTGGAGGAAGG - Exonic
903339142 1:22643412-22643434 CTGCCCCAGCATCTGGCTGAGGG - Intergenic
903764626 1:25726220-25726242 TGGCTCCTGCACCTGGGGAAAGG + Intronic
904460026 1:30671034-30671056 CAGCCCCAGCACGGGGGGGAAGG + Intergenic
905237546 1:36560536-36560558 CGGCTCCAGCAACTGTGGAATGG - Intergenic
905672268 1:39799571-39799593 TCACCCCAGCACCTGGGGGGTGG - Intergenic
905674692 1:39817237-39817259 TCACCCCAGCACCTGGGGGGTGG + Intergenic
905768900 1:40624869-40624891 TGGCCCCAGCACCTGAGGCAGGG - Exonic
906078596 1:43069225-43069247 CGTCCCCAGCTGCAGGGGGAGGG - Intergenic
906108198 1:43307131-43307153 CAGCCCCACAACCTGGAGGAAGG - Exonic
906322988 1:44828141-44828163 CTGCCCCAGGAGCTGGGGGACGG - Exonic
906488628 1:46250251-46250273 AGGCCCCAGCAGCTGTGGGCAGG - Intronic
906557904 1:46728875-46728897 GGGACAGAGCACCTGGGGGAAGG + Intergenic
906753189 1:48285036-48285058 GGGACAGAGCACCTGGGGGAAGG - Intergenic
907437680 1:54459875-54459897 CTGTCCCAGCCCCTGGGGGTGGG + Intergenic
907953591 1:59207017-59207039 GGGACAGAGCACCTGGGGGAAGG + Intergenic
908598230 1:65711153-65711175 GGGACAGAGCACCTGGGGGATGG - Intergenic
909384281 1:75037196-75037218 GGGACAGAGCACCTGGGGGAAGG + Intergenic
910086328 1:83406945-83406967 CGGCCCCAGCTCCTGTTGGGTGG - Intergenic
910177250 1:84443603-84443625 GGGACAGAGCACCTGGGGGAAGG + Intergenic
910331041 1:86072517-86072539 GGGTCAGAGCACCTGGGGGAAGG + Intronic
910676632 1:89821838-89821860 CGCCCCCCGCGCCTGTGGGAGGG + Intronic
910940658 1:92530320-92530342 GGGACGAAGCACCTGGGGGAAGG + Intronic
911217947 1:95216312-95216334 GGGACAGAGCACCTGGGGGAAGG - Intronic
911632703 1:100200439-100200461 GGGACAGAGCACCTGGGGGAAGG + Intronic
911941912 1:104057603-104057625 GGGACAGAGCACCTGGGGGAAGG + Intergenic
912076679 1:105884293-105884315 GGGACACAGCACTTGGGGGAAGG - Intergenic
912235391 1:107844838-107844860 GGGACAGAGCACCTGGGGGAAGG + Intronic
912301349 1:108520351-108520373 GGGACGGAGCACCTGGGGGAAGG - Intergenic
912894826 1:113575797-113575819 GGGACAGAGCACCTGGGGGAAGG - Intronic
913021398 1:114791948-114791970 GGGACAGAGCACCTGGGGGAAGG - Intergenic
913430058 1:118780885-118780907 GGGACAGAGCACCTGGGGGAAGG - Intergenic
913600969 1:120420930-120420952 CTCCCCCAGGACCTGGTGGACGG - Intergenic
914086087 1:144455703-144455725 CTCCCCCAGGACCTGGTGGACGG + Intronic
914191979 1:145419654-145419676 CTCCCCCAGGACCTGGTGGACGG + Intergenic
914213996 1:145608024-145608046 CGGCTGCAGCACCTGGGAGAAGG + Exonic
914362106 1:146944372-146944394 CTCCCCCAGGACCTGGTGGATGG - Intronic
914465940 1:147928427-147928449 CGGCTGCAGCACCTGGGAGAAGG + Exonic
914589886 1:149097604-149097626 CTCCCCCAGGACCTGGTGGACGG + Intronic
915061324 1:153188312-153188334 GGGACAGAGCACCTGGGGGAAGG - Intergenic
915688496 1:157662181-157662203 GGGGCAGAGCACCTGGGGGAAGG + Intergenic
915992220 1:160529556-160529578 GGGACAGAGCACCTGGGGGAAGG - Intergenic
916028499 1:160855980-160856002 GGGCCTGAGCACCTGGGAGAAGG + Intronic
916625550 1:166552026-166552048 GGGTCAGAGCACCTGGGGGAAGG - Intergenic
916916143 1:169408429-169408451 GGGACAGAGCACCTGGGGGAAGG + Intronic
917009727 1:170457652-170457674 GGGACAGAGCACCTGGGGGAAGG - Intergenic
917163096 1:172080230-172080252 GGGACAGAGCACCTGGGGGAAGG - Intronic
917274676 1:173319373-173319395 GGGACAGAGCACCTGGGGGAAGG + Intergenic
917401325 1:174652904-174652926 GGGACAGAGCACCTGGGGGAAGG - Intronic
917406009 1:174709207-174709229 GGGACAGAGCACCTGGGGGAAGG + Intronic
918167193 1:181961533-181961555 GGGACAGAGCACCTGGGGGAAGG - Intergenic
918360349 1:183751169-183751191 GGGACAGAGCACCTGGGGGAAGG - Intronic
918632035 1:186730203-186730225 GGGACAGAGCACCTGGGGGAAGG - Intergenic
919461617 1:197884132-197884154 GGGACAGAGCACCTGGGGGAAGG - Intergenic
919748650 1:201023560-201023582 CGGGCCCAGCCCCGGGGGGCCGG - Exonic
920591213 1:207220690-207220712 CGCCCCCAGCCCCTGTGGGTCGG - Intergenic
920967199 1:210711163-210711185 CAGCCCCAGACCATGGGGGAAGG + Intronic
921296803 1:213712121-213712143 GGGACAAAGCACCTGGGGGAAGG - Intergenic
921976379 1:221207430-221207452 GGGTCAGAGCACCTGGGGGAAGG + Intergenic
922396841 1:225210544-225210566 GGGACAGAGCACCTGGGGGAAGG + Intronic
922675978 1:227550264-227550286 GGGACAGAGCACCTGGGGGAAGG + Intergenic
922691960 1:227700162-227700184 GGGACAGAGCACCTGGGGGAAGG + Intergenic
922716057 1:227872721-227872743 GGGACAGAGCACCTGGGGGAAGG + Intergenic
922768125 1:228166388-228166410 AGGGCCCAGCACCCGGGGGAGGG + Intronic
922800660 1:228363301-228363323 GACCCCCAACACCTGGGGGAAGG - Intronic
923061196 1:230476237-230476259 GGGACAGAGCACCTGGGGGAAGG - Intergenic
923081355 1:230658659-230658681 GGGACAGAGCACCTGGGGGAAGG - Intronic
924151638 1:241135717-241135739 CGGCCACACCACGTGGGAGAAGG - Intronic
924637049 1:245798314-245798336 CGGCCCCGGCCCATGGGGAAGGG + Intronic
924637356 1:245800783-245800805 GGGCCCCAGGAACTTGGGGAAGG + Intronic
924741167 1:246794998-246795020 CGGCCTCAGGGCCTGGGGGGTGG - Intergenic
924823066 1:247513116-247513138 GGGACAGAGCACCTGGGGGAAGG - Intronic
1063379001 10:5572558-5572580 CAGCTCCAGCTCCTGGAGGATGG - Intergenic
1063444531 10:6102258-6102280 CCTCCCCACCACCTGTGGGAAGG + Intronic
1064072980 10:12246581-12246603 CGGCCTCAGCAGCTGGGGCTGGG - Intronic
1064081013 10:12308075-12308097 CGGGCCCAGCACCTAAGGGGAGG + Intergenic
1064116815 10:12585256-12585278 AGGCCCCAGCATCTGGGGACGGG - Intronic
1065621653 10:27587853-27587875 GGGGCAGAGCACCTGGGGGAAGG + Intergenic
1065907695 10:30272630-30272652 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1066140783 10:32501948-32501970 GGGACAGAGCACCTGGGGGAAGG - Intronic
1066371962 10:34825035-34825057 AGGCCCCAGCACCTCGGGGAGGG - Intergenic
1066615437 10:37288883-37288905 GGGACAGAGCACCTGGGGGAAGG - Intronic
1067044423 10:42976287-42976309 CAGCCCCAGCTCCTCTGGGAGGG + Intergenic
1067209647 10:44249523-44249545 GGGACCGAGCACCTGGGGGAAGG - Intergenic
1067236333 10:44453809-44453831 AGGACAGAGCACCTGGGGGAAGG - Intergenic
1067332225 10:45333231-45333253 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1068086051 10:52374835-52374857 GGGACAAAGCACCTGGGGGAAGG - Intergenic
1068357059 10:55923114-55923136 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1068469912 10:57448085-57448107 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1068623054 10:59207955-59207977 GGGGCAGAGCACCTGGGGGAAGG + Intronic
1069120786 10:64567080-64567102 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1069264245 10:66438305-66438327 GGGACAGAGCACCTGGGGGAAGG - Intronic
1069348934 10:67502576-67502598 GGGACAGAGCACCTGGGGGAAGG - Intronic
1070234416 10:74608830-74608852 GGGACAGAGCACCTGGGGGAAGG - Intronic
1070632535 10:78096906-78096928 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1070999770 10:80818400-80818422 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1071272460 10:84020440-84020462 GGGACAAAGCACCTGGGGGAAGG + Intergenic
1071341250 10:84651256-84651278 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1071975812 10:90954908-90954930 GGGGCAGAGCACCTGGGGGAAGG - Intergenic
1072044939 10:91644696-91644718 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1072336427 10:94402603-94402625 CGGACCCACCATCTGGGGGTGGG - Exonic
1072953533 10:99869597-99869619 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1073698176 10:105893962-105893984 GGGACACAGCACCTGGGGGAAGG + Intergenic
1073884232 10:108019724-108019746 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1074016711 10:109542178-109542200 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1074592088 10:114822364-114822386 CCGCCCCGGCTCCTGGAGGAGGG - Intronic
1074668457 10:115758735-115758757 GGGACAAAGCACCTGGGGGAAGG - Intronic
1075197689 10:120375268-120375290 TGCCCCCAGCCCCTGGGGCATGG - Intergenic
1076022992 10:127089575-127089597 CAGCCCCCTCTCCTGGGGGAGGG - Intronic
1076346305 10:129781079-129781101 AGTCACCAGCAGCTGGGGGAGGG + Intergenic
1076373545 10:129969184-129969206 CGGCCCCAGCAGCTGGGCCCCGG + Intergenic
1076840743 10:133043972-133043994 AGGCCCCAGTCCCTGGGGCAGGG - Intergenic
1076969436 11:124952-124974 CGGCCCCAACCCCTGGGGATGGG + Intergenic
1077110028 11:858269-858291 ATGCACCAGCAGCTGGGGGATGG - Intronic
1077111931 11:865801-865823 CGCCCCCGGCACCTGGTGGAAGG + Exonic
1077146913 11:1050544-1050566 GGGCCGCAGCACATCGGGGAGGG - Intergenic
1077234584 11:1473846-1473868 TGCCCCCAGCACCCCGGGGATGG + Intronic
1077356312 11:2120533-2120555 CGGCCCCAGCAGGTGGGAGCGGG - Intergenic
1077413363 11:2413660-2413682 TGGGCCAGGCACCTGGGGGAAGG - Intronic
1077470753 11:2759445-2759467 TGGCCACAGCGCCTTGGGGAAGG - Intronic
1077562000 11:3270019-3270041 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1077567894 11:3315839-3315861 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1078096155 11:8298471-8298493 TGGCCCCAGCAGCTGGTTGAAGG + Intergenic
1078336402 11:10466574-10466596 GGGACAGAGCACCTGGGGGAAGG + Intronic
1078392854 11:10951871-10951893 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1078594064 11:12671851-12671873 GGGCCCCAGCACCTAAGGGCAGG - Intergenic
1078814074 11:14801741-14801763 GGGACAGAGCACCTGGGGGAAGG - Intronic
1079131568 11:17749798-17749820 CAGCCCCAACACCTGGAGTATGG + Intronic
1079316577 11:19412455-19412477 GGGACAGAGCACCTGGGGGAAGG + Intronic
1079517914 11:21290025-21290047 CGGACATAGCACCTGGGGGAAGG + Intronic
1079714950 11:23732432-23732454 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1079867952 11:25758829-25758851 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1080334585 11:31181248-31181270 GGGACAGAGCACCTGGGGGAAGG + Intronic
1081363336 11:42205882-42205904 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1082249633 11:49963996-49964018 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1083516174 11:63261421-63261443 GGGACAGAGCACCTGGGGGAAGG - Intronic
1083658685 11:64242163-64242185 GGACCCCAGCAGCGGGGGGAGGG - Exonic
1083777964 11:64903414-64903436 CGGCCCCAGCACCTGGGGGAAGG + Intronic
1083859330 11:65411585-65411607 AGGGCCCAGCATCCGGGGGAAGG - Exonic
1083883077 11:65557963-65557985 GGGCCGCAGGACCCGGGGGAGGG + Exonic
1083925081 11:65801208-65801230 CGTTCCCAGCAGCTGGGGCATGG - Intergenic
1083954177 11:65974015-65974037 CTGCCCCAGCCCCAGGGAGAGGG + Intronic
1084189315 11:67491844-67491866 GGGACCCAGCGCCGGGGGGAGGG - Exonic
1084431877 11:69115808-69115830 CGGCCGCCTCCCCTGGGGGAGGG + Intergenic
1084600237 11:70141212-70141234 CGGCCACAGCCCATGGGGGACGG - Intronic
1084642458 11:70434041-70434063 CGGCCCCCTCACCTGGAGGGTGG - Intronic
1085433907 11:76481780-76481802 GGGACAGAGCACCTGGGGGAAGG + Intronic
1086067824 11:82765162-82765184 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1086129246 11:83383502-83383524 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1086300291 11:85420537-85420559 GGGACAGAGCACCTGGGGGAAGG - Intronic
1086312252 11:85548596-85548618 GGGACAGAGCACCTGGGGGAAGG - Intronic
1086505344 11:87498228-87498250 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1086735607 11:90302249-90302271 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1087305809 11:96487672-96487694 GGGACAGAGCACCTGGGGGAAGG + Intronic
1087326323 11:96727731-96727753 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1087703741 11:101466314-101466336 GGGACAGAGCACCTGGGGGAAGG - Intronic
1088211888 11:107466062-107466084 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1089285427 11:117404760-117404782 GGGACAGAGCACCTGGGGGAAGG - Intronic
1089301920 11:117504143-117504165 TGGCCTCAGCACTTTGGGGATGG - Intronic
1089363090 11:117903911-117903933 AGGTCCCAGCACCCTGGGGATGG - Intronic
1089564542 11:119363915-119363937 CGGCCGCAGCTCCTTGGCGAGGG + Intronic
1089765981 11:120766059-120766081 GGGACAGAGCACCTGGGGGAAGG - Intronic
1090196467 11:124821032-124821054 CAGCCACACCACCTGGGAGAAGG + Intergenic
1090307821 11:125705484-125705506 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1090351824 11:126112850-126112872 CAGCCCCAGCCTCTCGGGGAAGG - Intergenic
1090720453 11:129467584-129467606 GAGACCGAGCACCTGGGGGAAGG + Intergenic
1091417160 12:298078-298100 GGGACAGAGCACCTGGGGGAAGG + Intronic
1091550177 12:1530652-1530674 CTGCCCCAGCATCGGGGGGGGGG + Intronic
1091669099 12:2439559-2439581 CTGCCCCAGCACGTGGGTGTGGG - Intronic
1091669110 12:2439596-2439618 CTGCCCCAGCACATGGGTGTGGG - Intronic
1091754173 12:3040971-3040993 AGGCCCCATCCCCTGGGGGGTGG + Intergenic
1092304414 12:7284087-7284109 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1092638938 12:10482199-10482221 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1093004469 12:14036309-14036331 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1093335999 12:17905678-17905700 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1093530844 12:20161206-20161228 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1093664420 12:21795156-21795178 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1093714543 12:22366471-22366493 AGGACAGAGCACCTGGGGGAAGG + Intronic
1094061035 12:26315917-26315939 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1094733063 12:33200461-33200483 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1094782016 12:33802439-33802461 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1095230334 12:39731758-39731780 GAGACACAGCACCTGGGGGAAGG - Intronic
1095406390 12:41871063-41871085 CGGACAGAGCACCTGGGGGAAGG + Intergenic
1095488535 12:42708725-42708747 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1095785696 12:46106638-46106660 AGGCCCGAGAACCAGGGGGAGGG + Intergenic
1096535621 12:52270842-52270864 CGGCATCAGCTCCTGTGGGATGG + Intronic
1097635151 12:62113599-62113621 GGGACAGAGCACCTGGGGGAAGG - Intronic
1097948760 12:65403211-65403233 GGGACAGAGCACCTGGGGGAAGG - Intronic
1098052980 12:66473360-66473382 AGGACAGAGCACCTGGGGGAAGG + Intronic
1098772301 12:74567999-74568021 GTGCCCCAGCTCCAGGGGGAGGG + Intergenic
1098991023 12:77065313-77065335 CGGCCCCAGCGCCAGTGGGGAGG - Intronic
1099071318 12:78048825-78048847 GGGACAGAGCACCTGGGGGAAGG - Intronic
1099435222 12:82634767-82634789 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1099492089 12:83300281-83300303 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1099797969 12:87422265-87422287 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1100111098 12:91243085-91243107 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1100136320 12:91557315-91557337 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1100308270 12:93371133-93371155 CCGCCCCATACCCTGGGGGAAGG - Intergenic
1100740089 12:97581916-97581938 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1101310915 12:103578056-103578078 GGTCGCCAGCATCTGGGGGAAGG + Intergenic
1101487951 12:105184862-105184884 GGGACAGAGCACCTGGGGGAAGG - Intronic
1101604737 12:106239577-106239599 AGGCTCCAGCACGTGGAGGATGG - Exonic
1101737796 12:107476047-107476069 GGGCCCCGGCTTCTGGGGGACGG - Intronic
1102298668 12:111756094-111756116 CGGCCCCAGCACAGGGCAGAAGG + Intronic
1102345530 12:112158800-112158822 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1102427468 12:112855490-112855512 GGGCCTCAGCACTTTGGGGAAGG - Intronic
1102953553 12:117045611-117045633 CAGCCCCTGCCCCTGGGGGCAGG + Intronic
1102955308 12:117054897-117054919 AGGCCCCAGCAGCATGGGGAGGG + Intronic
1103415978 12:120741666-120741688 CTCCCCCATCACCTGGAGGAAGG - Intergenic
1103622956 12:122200136-122200158 TGGCCACAGCCCCTGGGTGACGG + Intronic
1103623119 12:122200804-122200826 CCGGCCCAGCACCTGGAGGATGG - Exonic
1103685671 12:122730280-122730302 CGGCGGCATCACCTGGGAGATGG + Exonic
1104398237 12:128453764-128453786 CTGCCCCAGCCCCTGCGGGGTGG - Intronic
1104955293 12:132461938-132461960 CTGCCCCAAGACCTGAGGGAAGG + Intergenic
1105286263 13:19007359-19007381 AGGACAGAGCACCTGGGGGAAGG - Intergenic
1105316512 13:19270338-19270360 AGGACAGAGCACCTGGGGGAAGG + Intergenic
1105737337 13:23285216-23285238 CTGGGACAGCACCTGGGGGAAGG - Intronic
1106025855 13:25954390-25954412 GGGACAGAGCACCTGGGGGAAGG + Intronic
1106326294 13:28693666-28693688 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1106429472 13:29666106-29666128 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1106612256 13:31295422-31295444 GGGACAGAGCACCTGGGGGAAGG - Intronic
1106874190 13:34054376-34054398 TGGACAGAGCACCTGGGGGAAGG - Intergenic
1106902292 13:34366631-34366653 TGGCCTCAGCATCTGGGGCAGGG - Intergenic
1106983818 13:35321703-35321725 GGGACAGAGCACCTGGGGGAAGG - Intronic
1107473413 13:40712474-40712496 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1107742144 13:43462018-43462040 TGGGCCCAGCACCAGAGGGAAGG - Intronic
1108048766 13:46408699-46408721 GGGACAGAGCACCTGGGGGAAGG - Intronic
1108217740 13:48201411-48201433 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1108236881 13:48416950-48416972 GGGACAGAGCACCTGGGGGAAGG + Intronic
1108262756 13:48675248-48675270 GGGACAGAGCACCTGGGGGAAGG - Intronic
1108383850 13:49879909-49879931 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1108429603 13:50340806-50340828 CGGCCTCAGCTCCTTGAGGAAGG + Intronic
1108673995 13:52720910-52720932 AGGACAGAGCACCTGGGGGAAGG - Intronic
1108998347 13:56763677-56763699 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1109187949 13:59292232-59292254 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1109661583 13:65467208-65467230 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1110356763 13:74575900-74575922 CGGCCCCAGGCCGTGGAGGAGGG + Intergenic
1110389753 13:74959991-74960013 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1110826359 13:79975584-79975606 GGGTCAGAGCACCTGGGGGAAGG + Intergenic
1110890333 13:80690127-80690149 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1112151970 13:96773710-96773732 GGGACAGAGCACCTGGGGGAAGG + Intronic
1112165895 13:96919250-96919272 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1112620106 13:101046554-101046576 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1112757799 13:102658747-102658769 GAGCTCCAGCTCCTGGGGGAGGG + Intronic
1113483415 13:110637979-110638001 GGGCTCCATCTCCTGGGGGAGGG - Intronic
1114644796 14:24249388-24249410 TGGCCCCAGCCCCTGGGGATGGG - Exonic
1114961778 14:27900883-27900905 TGGCCTGAGCACCTGGGGTAAGG + Intergenic
1115124237 14:29972854-29972876 GGGACAGAGCACCTGGGGGAAGG + Intronic
1115357213 14:32461095-32461117 GGGACAGAGCACCTGGGGGAAGG + Intronic
1115359759 14:32488135-32488157 GGGACAGAGCACCTGGGGGAAGG - Intronic
1115511323 14:34140173-34140195 GGGACAGAGCACCTGGGGGAAGG + Intronic
1115538097 14:34392052-34392074 GGGACAGAGCACCTGGGGGAAGG + Intronic
1115690981 14:35843793-35843815 AGGACAGAGCACCTGGGGGAAGG - Intronic
1115974360 14:38980798-38980820 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1116002472 14:39259203-39259225 GGGACAGAGCACCTGGGGGAAGG - Intronic
1116227564 14:42171436-42171458 GGGACTGAGCACCTGGGGGAAGG + Intergenic
1116511841 14:45756205-45756227 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1117104317 14:52382685-52382707 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1117172436 14:53114251-53114273 CGGACACAGCACCTGGGGGAAGG + Intronic
1117238017 14:53798747-53798769 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1117388562 14:55241060-55241082 CGGCCCCAGCACGACGGCGATGG + Intergenic
1117600046 14:57365447-57365469 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1119018435 14:71084457-71084479 GGGACAGAGCACCTGGGGGAAGG - Intronic
1119423113 14:74519703-74519725 CAGCCCCAGCAGCTGGGGAACGG - Intronic
1119483352 14:74973528-74973550 CGCAGCCAGCAGCTGGGGGAAGG + Intergenic
1120201379 14:81541211-81541233 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1121374530 14:93395553-93395575 CCTCCCCATCACCTGGTGGATGG - Intronic
1121511392 14:94515572-94515594 CGTCCCCAGCTCCTGGAGCAGGG - Intronic
1121639026 14:95473006-95473028 AGACCCCAGCACCCGGGGGCAGG + Intronic
1122344431 14:101049860-101049882 CAGACCCAGCCACTGGGGGAAGG - Intergenic
1122773928 14:104108932-104108954 CGCACCCAGCACCCAGGGGAGGG - Intronic
1122952648 14:105054154-105054176 TGGCCTCAGCACCTGACGGACGG + Intronic
1122980367 14:105189273-105189295 TGGCCCAAGCACCTGGGAGGTGG + Intergenic
1123017198 14:105381089-105381111 AGCCCCCATCACCTGGTGGAGGG - Exonic
1123480872 15:20629623-20629645 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1124419232 15:29505288-29505310 TGGACAGAGCACCTGGGGGATGG + Intronic
1124666757 15:31599039-31599061 GGGACAGAGCACCTGGGGGAAGG + Intronic
1124893995 15:33758676-33758698 GGGACAGAGCACCTGGGGGAAGG + Intronic
1124955189 15:34355764-34355786 AGGTCCCAGCTGCTGGGGGATGG - Exonic
1125288563 15:38120256-38120278 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1125511326 15:40293979-40294001 GAGCCCCAGGTCCTGGGGGAAGG - Intronic
1125674647 15:41495561-41495583 CGCACCCAGCACCTGGCGGCGGG - Intronic
1125784344 15:42301885-42301907 GGGACAGAGCACCTGGGGGAAGG + Intronic
1125841298 15:42803468-42803490 CTGCCCCAGGACCTGAGGCAGGG + Intronic
1126097676 15:45100814-45100836 GGGCCCCAGTCCCTGGGGGTGGG + Exonic
1127452539 15:59131144-59131166 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1128111608 15:65079707-65079729 GGGCCTCAGGTCCTGGGGGATGG - Intergenic
1128566067 15:68700980-68701002 CGCCCCCAGCTCCTCAGGGAGGG - Intronic
1129296674 15:74603743-74603765 CTCCCACAGCTCCTGGGGGATGG + Intronic
1129563254 15:76593354-76593376 GGGGCAGAGCACCTGGGGGAAGG + Intronic
1130547425 15:84867442-84867464 CAGGCCCAGCACCTCAGGGATGG - Intronic
1130724073 15:86419997-86420019 GGGACAGAGCACCTGGGGGAAGG + Intronic
1132014147 15:98301013-98301035 CGACCCCAGCTCCTGCTGGATGG - Intergenic
1132096467 15:98988524-98988546 GGGACAGAGCACCTGGGGGAAGG + Intronic
1132639706 16:972178-972200 CGGCCCCAGCAACACAGGGAAGG - Intronic
1132840052 16:1974527-1974549 TGTCACCAGCACCTGGGGGAGGG - Exonic
1133058329 16:3158556-3158578 CGGCCCCAGCACCGAGAGGAGGG - Intergenic
1133124996 16:3641052-3641074 CAGCAACAGCACCTGGGGGCTGG - Intronic
1133912474 16:10078556-10078578 GGCCCCCAGCCCCTGGGGGCAGG + Intronic
1134847132 16:17449427-17449449 CAGGCCCAGCACCTGGAAGAGGG + Intronic
1135057910 16:19245730-19245752 AGGCCCTGTCACCTGGGGGATGG - Intronic
1137296365 16:47097556-47097578 GGGACAGAGCACCTGGGGGAAGG + Intronic
1138151596 16:54662194-54662216 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1138266543 16:55663911-55663933 CTGCCCCAGGCCCTGGGGGAAGG + Intronic
1138540691 16:57685632-57685654 CGGAACCAGCATCTGGAGGAGGG - Exonic
1140165288 16:72544037-72544059 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1141553562 16:84821977-84821999 CTGCCCCAGATTCTGGGGGAAGG + Intronic
1142143851 16:88484516-88484538 CGGCCGCAGGACCTGGGGTCTGG + Intronic
1142148138 16:88501085-88501107 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148150 16:88501136-88501158 CATCACCAGCACCTGCGGGATGG - Intronic
1142148162 16:88501187-88501209 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148189 16:88501289-88501311 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148201 16:88501339-88501361 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148213 16:88501389-88501411 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148225 16:88501440-88501462 CATCACCAGCACCTGCGGGATGG - Intronic
1142148234 16:88501491-88501513 CATCACCAGCACCTGCGGGAGGG - Intronic
1142148244 16:88501542-88501564 CATCACCAGCACCTGCGGGATGG - Intronic
1143375414 17:6464197-6464219 CGGCCCCGGCGCCTGGGGGTTGG - Exonic
1143524970 17:7466582-7466604 CGCCCCCAGTAGCTGGTGGAAGG + Exonic
1143874150 17:9979274-9979296 CTACCCCAGCACCCTGGGGATGG + Intronic
1144371815 17:14598300-14598322 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1144767207 17:17739340-17739362 CTTCCCCAGCTCCTGGGGGCTGG - Intronic
1144781798 17:17811998-17812020 CTCCCCCAGCACCTAGGGAAAGG - Intronic
1144941681 17:18946591-18946613 CTGCCCCACACCCTGGGGGAAGG - Intergenic
1145240734 17:21239890-21239912 CCGCCCCAGCTACTGAGGGAGGG - Exonic
1145904918 17:28511018-28511040 TAGCCCCAGCACCTGGAGGAAGG + Intronic
1146058920 17:29594335-29594357 AGGCCCCAGCACCAGAGGGCAGG - Intronic
1146059698 17:29597993-29598015 CGGCTGCAGCATCTGGGGCAGGG + Intronic
1146708037 17:35016363-35016385 GGACTCCAGCACCTGGGTGAGGG - Exonic
1146766223 17:35524257-35524279 GGGACAGAGCACCTGGGGGAAGG + Intronic
1146825893 17:36023143-36023165 AGGACAGAGCACCTGGGGGAAGG - Intergenic
1147326022 17:39670021-39670043 CAGCCCCAGCCCCTGGGTGCTGG + Exonic
1147623500 17:41884054-41884076 AGGCCCCAGCATCTAGGGGATGG + Intronic
1147919342 17:43906724-43906746 GGGCGCTAGGACCTGGGGGAGGG + Intronic
1147949169 17:44097455-44097477 CTGCCCCAGCACCAGGAGAAAGG + Intronic
1148331409 17:46815928-46815950 TGGGCCCAGCACCTGGGGACAGG + Intronic
1148967435 17:51447521-51447543 GGGGCAGAGCACCTGGGGGAAGG + Intergenic
1149093819 17:52817009-52817031 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1149195655 17:54116951-54116973 GGGCACCATCACCTCGGGGATGG - Intergenic
1149281226 17:55108026-55108048 GGGACACAGCACCTGGGGGAAGG - Intronic
1149365504 17:55939510-55939532 TGGACAGAGCACCTGGGGGAAGG + Intergenic
1149998155 17:61415784-61415806 CTGGCCCAGGACCTGGGGGTGGG - Intergenic
1150090811 17:62323124-62323146 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1150210163 17:63437473-63437495 CAGGCCCAGCAGCTGGGAGAAGG + Exonic
1150545823 17:66155916-66155938 GGGACAGAGCACCTGGGGGAAGG + Intronic
1150613181 17:66749640-66749662 CGGCTCCAGACCCTGGGGTAGGG - Intronic
1151224731 17:72640042-72640064 CCAGCCCAGCACCTGGGAGAAGG - Intergenic
1151676913 17:75603315-75603337 GGGGCCCAGCACCTCGGGGCAGG + Intergenic
1151704027 17:75757430-75757452 GGGGCCCAGCACCTGGAGGCAGG + Exonic
1151963629 17:77420048-77420070 TGGCCCAGGCACCTGGGGGAGGG - Intronic
1152259853 17:79260991-79261013 CGGCCCCAGGACGGGAGGGAGGG - Intronic
1152357721 17:79814850-79814872 GGGCGCGGGCACCTGGGGGATGG + Intergenic
1152531821 17:80923317-80923339 CGGCACCAGCAGCTGGGGTTCGG + Intronic
1152546713 17:81004032-81004054 CTGCCCCAGGCCCTGCGGGAGGG + Intronic
1152899800 17:82934005-82934027 CTGCCCCAGCAGCGGTGGGAAGG - Intronic
1152905094 17:82965602-82965624 AGGGCCCCGAACCTGGGGGAGGG + Intronic
1153313368 18:3699744-3699766 GGGACAGAGCACCTGGGGGAAGG - Intronic
1153562198 18:6382920-6382942 GGGACAGAGCACCTGGGGGAAGG - Intronic
1153702667 18:7711866-7711888 GGGACTCAGCACCAGGGGGAAGG + Intronic
1153798509 18:8647259-8647281 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1154269472 18:12906896-12906918 AGGCCACAGCACCTGAGGGTGGG - Intronic
1156166701 18:34429614-34429636 GGGACATAGCACCTGGGGGAAGG - Intergenic
1156521837 18:37728479-37728501 CGCCCCCAGCAGTAGGGGGAAGG - Intergenic
1156582407 18:38393088-38393110 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1156626827 18:38919861-38919883 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1157178826 18:45477590-45477612 GGGACAAAGCACCTGGGGGAAGG - Intronic
1157695064 18:49716070-49716092 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1157959053 18:52132041-52132063 CGGCCGCATACCCTGGGGGAAGG - Intergenic
1158073046 18:53495989-53496011 GGGACAGAGCACCTGGGGGAAGG + Intronic
1158659301 18:59371727-59371749 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1158855793 18:61542414-61542436 TGGGGCCAGCACCTGTGGGAGGG + Intronic
1158930950 18:62325061-62325083 CAGCCCGAGCACCTGGGCCAGGG + Intergenic
1159690552 18:71482614-71482636 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1160254845 18:77239613-77239635 CAGCAGCAGCCCCTGGGGGACGG - Intergenic
1160489473 18:79325078-79325100 CCTCCCCAGAACCTGGGAGAGGG - Intronic
1160583962 18:79902708-79902730 CGGCCCCTCCACCTGCGGAAGGG + Exonic
1160646241 19:194878-194900 CGGCCCCAACCCCTGGGGATGGG + Intergenic
1160689766 19:456179-456201 CGGCCGCAGCCCCCGGGTGATGG + Intronic
1160980527 19:1814646-1814668 AGGACCCAGCAGCTGGGGGCAGG - Intergenic
1161129365 19:2579135-2579157 CCGCCTCAGCATCTGCGGGATGG + Intronic
1161273925 19:3404905-3404927 CGGGCCCGAGACCTGGGGGAGGG + Intronic
1161331057 19:3688017-3688039 CGGCCCCGCCACCTGCGGGCTGG - Intronic
1161686193 19:5703851-5703873 CCCCCTCAGCTCCTGGGGGAAGG + Intronic
1161982626 19:7637708-7637730 CGGCCCCGGTTCTTGGGGGAAGG + Intronic
1162028781 19:7908629-7908651 AGGCCCCAGCTCCTGTGGGAGGG + Intronic
1162110645 19:8397933-8397955 GGGCCCCGGCACCTGAGGGTGGG - Intronic
1162296670 19:9818702-9818724 CGGCCCCGCCTCCGGGGGGAAGG - Intronic
1162806340 19:13139661-13139683 TGGGCCCAGCTCCTGGGGGCTGG + Exonic
1162833695 19:13302772-13302794 CGGCCCCAGCTCCCAGTGGAGGG - Intronic
1163057156 19:14728901-14728923 CGACCCCAGCCCATGGGGGAAGG - Intronic
1163503355 19:17688684-17688706 CGGCACCAGCACCGGGCAGATGG + Intergenic
1163534485 19:17869322-17869344 TGTCCCCAGCACCTGCCGGAGGG + Intergenic
1163782524 19:19257895-19257917 CGGACCCGGCACCTGGCGGCTGG - Exonic
1163807173 19:19406225-19406247 CGGCCCGGGCACGTGGGGGCCGG + Intronic
1163821649 19:19499585-19499607 TGCCCCCAGCACCTGGGGTTGGG + Intronic
1164047493 19:21555266-21555288 GGGACAGAGCACCTGGGGGAAGG - Intronic
1164085956 19:21902696-21902718 TGGGCCCAGCACCTAGGTGATGG + Intergenic
1164112787 19:22184900-22184922 GGGACAGAGCACCTGGGGGAAGG + Intronic
1164204066 19:23043395-23043417 TGGGCCCAACACCTAGGGGATGG - Intergenic
1164265273 19:23610203-23610225 GGGTCAGAGCACCTGGGGGAGGG - Intronic
1165432159 19:35779021-35779043 TGGCACCAGCATCTGGGGGCAGG - Exonic
1166075493 19:40411658-40411680 CGTACCCAGCCCCTGGGGTAAGG + Intronic
1166304511 19:41929831-41929853 CGGTCTCAGCACCTGGGCGCTGG - Intronic
1167281549 19:48572167-48572189 TGGCCCCATCTCCTGGGGCAAGG + Intronic
1167332987 19:48867807-48867829 CGGCCCTGGCAGCTGCGGGAGGG + Intronic
1167610691 19:50506533-50506555 CAGCCCCAGTACCTGGGGCAGGG + Exonic
1167633453 19:50639707-50639729 CGGCCCCGGCGCATGGGGGCGGG - Intronic
1167784746 19:51627724-51627746 GGGGCCCAGCAACTGTGGGAGGG + Exonic
1168108639 19:54179867-54179889 CAGTCCAAGCCCCTGGGGGAAGG + Intronic
1168530812 19:57127389-57127411 GGGACAGAGCACCTGGGGGAAGG - Intronic
925027613 2:621761-621783 CGGCCGCAGGACCGGGGCGAAGG - Intergenic
926943930 2:18167799-18167821 GGGACAGAGCACCTGGGGGAAGG - Intronic
927182835 2:20459139-20459161 GGGACAGAGCACCTGGGGGAAGG + Intergenic
927469526 2:23362595-23362617 TGGCCCCAGCTCCTTGTGGATGG - Intergenic
927559415 2:24059359-24059381 CTGGACCAGCACCTGGGGGGGGG + Intronic
928308335 2:30189899-30189921 CGACCCCAGCCCATGGGGGGGGG + Intergenic
928488323 2:31754866-31754888 GGGACAGAGCACCTGGGGGAAGG + Intergenic
928619307 2:33072441-33072463 CTGCCCCAGACCCTGGAGGAAGG - Intronic
928830591 2:35478104-35478126 GGGACAGAGCACCTGGGGGAAGG + Intergenic
929545777 2:42854563-42854585 AGGCCCCGGCTCCTGGAGGAAGG - Intergenic
929574723 2:43044283-43044305 GGGCCCCAGCCCCTGAGGGGTGG + Intergenic
929666280 2:43836571-43836593 CGTTCTCAGCAGCTGGGGGATGG - Intronic
929857851 2:45651247-45651269 CGGCCCCACCTCCTGGGCGCCGG - Intergenic
930264683 2:49186104-49186126 GGGACAGAGCACCTGGGGGAAGG - Intergenic
930516080 2:52409754-52409776 GGGACAGAGCACCTGGGGGAAGG - Intergenic
930860306 2:56065157-56065179 TAGACACAGCACCTGGGGGAAGG - Intergenic
931074006 2:58689024-58689046 GGGACACAGCACCTGGGGGGAGG + Intergenic
931212050 2:60206938-60206960 GGGACAGAGCACCTGGGGGAAGG - Intergenic
931516046 2:63051296-63051318 CGGCCCCGGCAGCTGAGGGCAGG + Exonic
931566487 2:63620556-63620578 GGGACAGAGCACCTGGGGGAAGG + Intronic
931886656 2:66625588-66625610 GGGACAGAGCACCTGGGGGAAGG - Intergenic
931907557 2:66858864-66858886 GGGACAGAGCACCTGGGGGAAGG - Intergenic
932307625 2:70715241-70715263 AGGCCCCAGCACCTAGAGCAGGG + Intronic
932370014 2:71179009-71179031 CAGGCCGAGCACCTGGGGGCGGG - Intergenic
932416393 2:71576113-71576135 CAGCCCCTGCACCTGGGTGAGGG + Intronic
932523387 2:72437505-72437527 GGGACAGAGCACCTGGGGGAAGG - Intronic
932646744 2:73510821-73510843 GGGACAGAGCACCTGGGGGAAGG - Intronic
932913928 2:75834523-75834545 GGGACAGAGCACCTGGGGGAAGG + Intergenic
933166589 2:79083365-79083387 GGGACAGAGCACCTGGGGGAAGG - Intergenic
933804628 2:85989129-85989151 CTGCCCCAACCCATGGGGGACGG + Intergenic
934614397 2:95762374-95762396 TGGCACCAGCACCTGGGGAGGGG - Intergenic
934646506 2:96062125-96062147 TGGCACCAGCACCTGGGGAGGGG + Intergenic
934768454 2:96893705-96893727 CGTCCCCAGCGCCTGCGGCACGG + Intronic
934839907 2:97618207-97618229 TGGCACCAGCACCTGGGGAGGGG + Intergenic
935010901 2:99135189-99135211 GGGACAGAGCACCTGGGGGAAGG - Intronic
935068846 2:99676147-99676169 GGGCCCCATCAGCTGGGGTAGGG - Intronic
935090820 2:99893176-99893198 TGGCCCCAGCACCAGGGAGCAGG - Intronic
935961536 2:108429978-108430000 GGGACAGAGCACCTGGGGGAAGG + Intergenic
936999924 2:118456888-118456910 GGGACAGAGCACCTGGGGGAAGG - Intergenic
937573564 2:123392208-123392230 GGGACAGAGCACCTGGGGGAAGG + Intergenic
937792543 2:125977888-125977910 CAGCCACAGCAGCTGGGAGATGG - Intergenic
937837124 2:126482863-126482885 GGGCGCCAGCACCTGGCTGAAGG + Intergenic
937988663 2:127650196-127650218 CGGCCACTGCACCTGTGGGCAGG + Intronic
938168100 2:129050255-129050277 AGGACAGAGCACCTGGGGGAAGG - Intergenic
938187258 2:129242797-129242819 TGGGCCCAACACCTGGGTGATGG - Intergenic
938379200 2:130827182-130827204 CTGCCCCAGCTCCTGGAGCAGGG - Intergenic
938874378 2:135517868-135517890 GGGACAGAGCACCTGGGGGAAGG - Intronic
938933398 2:136107186-136107208 TGACCCCAGCTCTTGGGGGAAGG - Intergenic
939033316 2:137101923-137101945 AGGACAGAGCACCTGGGGGAAGG + Intronic
939640799 2:144638279-144638301 GGGACAGAGCACCTGGGGGAAGG - Intergenic
939802001 2:146721501-146721523 GGGCACCAGCACCTGGATGAGGG - Intergenic
939840657 2:147183042-147183064 GGGACAGAGCACCTGGGGGAAGG + Intergenic
939876649 2:147586067-147586089 GGGACAAAGCACCTGGGGGAAGG - Intergenic
939937724 2:148313259-148313281 GGGACAGAGCACCTGGGGGAAGG - Intronic
939946967 2:148421965-148421987 GGGACACAGCACCTGGGGGAAGG + Intronic
940417779 2:153442652-153442674 GGGACAGAGCACCTGGGGGAAGG - Intergenic
940565113 2:155351149-155351171 GGGTCAGAGCACCTGGGGGAAGG - Intergenic
940593961 2:155766702-155766724 GGGGCAGAGCACCTGGGGGAAGG - Intergenic
940946550 2:159624228-159624250 GGGACACAGCACCTGGGGGAAGG + Intergenic
941239351 2:163017229-163017251 GGGACAGAGCACCTGGGGGAAGG - Intergenic
941571465 2:167175745-167175767 GGGACAGAGCACCTGGGGGAAGG - Intronic
942010818 2:171761111-171761133 CTGCCCCTTCACCTGGGGGAAGG + Intergenic
942124048 2:172805260-172805282 CAGCCCCAGCTCCTAAGGGAGGG - Intronic
942199947 2:173560448-173560470 GGGACAGAGCACCTGGGGGAGGG + Intergenic
942407265 2:175668847-175668869 GGGACAGAGCACCTGGGGGAAGG + Intergenic
942431248 2:175913907-175913929 GGGACAGAGCACCTGGGGGAAGG - Intergenic
942890224 2:180980177-180980199 GGGCCCCAGTACCTGGGCAAGGG - Intronic
942953643 2:181750145-181750167 GGGACAGAGCACCTGGGGGAAGG - Intergenic
943599097 2:189892840-189892862 GGGACAGAGCACCTGGGGGAAGG - Intronic
943660534 2:190554690-190554712 GGGACAGAGCACCTGGGGGAAGG + Intergenic
943972412 2:194428079-194428101 CTGCCCCAGCACCTGGAAGGTGG - Intergenic
944607974 2:201370149-201370171 GGGACAGAGCACCTGGGGGAAGG + Intergenic
944764402 2:202849663-202849685 AGGACAGAGCACCTGGGGGAAGG + Intronic
945210843 2:207380813-207380835 GGGACAGAGCACCTGGGGGAAGG - Intergenic
945486849 2:210406804-210406826 GGGACAGAGCACCTGGGGGAAGG - Intergenic
945490199 2:210445993-210446015 AGGACAGAGCACCTGGGGGAAGG + Intronic
945533722 2:210986817-210986839 GGGACAGAGCACCTGGGGGAAGG - Intergenic
945927454 2:215819858-215819880 GGGACAGAGCACCTGGGGGAAGG + Intergenic
945945244 2:215988926-215988948 GGGACAGAGCACCTGGGGGAAGG + Intronic
947364725 2:229381811-229381833 GGGACAGAGCACCTGGGGGAAGG + Intronic
947681371 2:232037143-232037165 GGGACAGAGCACCTGGGGGAAGG - Intronic
948146095 2:235709253-235709275 TGGCCCTGGCACCTGTGGGAAGG + Intronic
948625738 2:239266857-239266879 AGGCCACAGCACCTGGGTGTGGG - Intronic
948795111 2:240398719-240398741 CGGCCCCAGCAGCCCAGGGAGGG - Intergenic
948895812 2:240926358-240926380 AGGCACCAGCCCCTGTGGGAGGG + Intronic
1169061065 20:2660671-2660693 AGGCCCCAGAAACTGGGGGAGGG - Intronic
1169198316 20:3695013-3695035 CGGCTCCAGCACATGGGGTTGGG - Intronic
1169320003 20:4624930-4624952 GGGGCAGAGCACCTGGGGGAAGG - Intergenic
1169605915 20:7319168-7319190 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1169912476 20:10658250-10658272 CCAACACAGCACCTGGGGGATGG + Intronic
1170133958 20:13052926-13052948 GGGACAGAGCACCTGGGGGAAGG + Intronic
1171000901 20:21414368-21414390 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1171513350 20:25706309-25706331 GGGACACAGCACTTGGGGGAAGG - Intergenic
1172466922 20:35162106-35162128 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1173454085 20:43189759-43189781 CGGCCCCGGCCCCCGCGGGAAGG - Exonic
1173751114 20:45477767-45477789 GGGACAGAGCACCTGGGGGAAGG - Intronic
1173774947 20:45697469-45697491 TAGTCCCAGCACCTGGGAGATGG - Intronic
1174190987 20:48740311-48740333 CACTCCCAGCACCTGGGGTAAGG - Intronic
1175477366 20:59286325-59286347 AGGGCCCAGCAGCTGGGGGAAGG + Intergenic
1175769954 20:61617293-61617315 TGTCCCCAGCACCTGGGGCCTGG + Intronic
1175928596 20:62482679-62482701 TGGCCCAGGCAGCTGGGGGAGGG + Intergenic
1176039699 20:63058896-63058918 GGGCCCCACCACCTGGGAAAGGG - Intergenic
1176088455 20:63308548-63308570 CTGCCCCAGCACGTGGGTCAGGG - Exonic
1176239956 20:64071381-64071403 CGGCCGCTGCACCTGGCAGATGG + Intronic
1176242019 20:64079685-64079707 CGCCCCCCGCGCGTGGGGGAGGG - Intronic
1176295474 21:5069850-5069872 CAGCCCCAGCCCCTGGGGTCTGG + Intergenic
1176891831 21:14327698-14327720 TGGACAGAGCACCTGGGGGAAGG + Intergenic
1177042655 21:16132800-16132822 GGGGCAGAGCACCTGGGGGAAGG - Intergenic
1177050321 21:16225136-16225158 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1177425931 21:20922635-20922657 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1177763809 21:25433987-25434009 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1177770858 21:25514011-25514033 CGAAAACAGCACCTGGGGGATGG + Intergenic
1178007155 21:28234576-28234598 AGGACAGAGCACCTGGGGGAAGG + Intergenic
1179861576 21:44192274-44192296 CAGCCCCAGCCCCTGGGGTCTGG - Intergenic
1179874055 21:44258639-44258661 CGGCCCCGGGACCTCGGGGAAGG - Exonic
1180175064 21:46083306-46083328 GGGCCTCAGACCCTGGGGGAGGG + Intergenic
1180596282 22:16975542-16975564 GGGACAGAGCACCTGGGGGAAGG + Intronic
1180984460 22:19896419-19896441 AGGGCACAGCTCCTGGGGGAAGG - Intronic
1181061248 22:20283107-20283129 AGGCCCCAGCACCTGCATGACGG - Intronic
1181559680 22:23692816-23692838 CAGCACCAGCACCAGGGGAAGGG + Exonic
1181765388 22:25087866-25087888 AGCCCCCAGCACCTGGGGAATGG + Intronic
1183185301 22:36288402-36288424 CATCTCCCGCACCTGGGGGAAGG + Exonic
1183281274 22:36933889-36933911 CTGGCCCAGTACCTGGTGGAGGG - Exonic
1183343082 22:37292830-37292852 CGGCCCCAGCCCCAGGAGCAGGG + Intronic
1183786284 22:40030875-40030897 CACTACCAGCACCTGGGGGAGGG + Exonic
1184191078 22:42894935-42894957 GGGCTGCAGCACCTGGAGGAAGG + Intronic
1184374440 22:44102878-44102900 TAACCCCAGCACCTGGGGGTGGG - Intronic
1184520511 22:44991314-44991336 CGGACCCAGCACCTGTGAGGTGG - Intronic
1184807324 22:46803461-46803483 CCGCCTCAGCTCCTGGGGGCCGG - Intronic
1185088473 22:48753218-48753240 CGGACCCTTCACCTTGGGGACGG - Intronic
1185268514 22:49917926-49917948 CGGACCTCCCACCTGGGGGATGG - Intronic
1185289599 22:50016867-50016889 CAGCCCCAGTACATGGGGGACGG - Intronic
949598635 3:5574853-5574875 TGTCCCCAGCAGCTGGAGGATGG + Intergenic
949683362 3:6541095-6541117 GGGACAGAGCACCTGGGGGAAGG - Intergenic
950425365 3:12922300-12922322 AGGCACCACCACCTGGGGGTGGG - Intronic
950466988 3:13161526-13161548 GAGGCCCAGCTCCTGGGGGAAGG + Intergenic
950597407 3:13996887-13996909 GGGACAGAGCACCTGGGGGAAGG - Intronic
950924956 3:16731216-16731238 CGGACAGAGCACCTGGGGGAAGG + Intergenic
950992073 3:17449765-17449787 AGGACGGAGCACCTGGGGGAAGG + Intronic
951183133 3:19682290-19682312 GGGACAGAGCACCTGGGGGAAGG - Intergenic
951434216 3:22643209-22643231 GGGACAGAGCACCTGGGGGAAGG - Intergenic
951671572 3:25189444-25189466 GGGCCCCTGCTCCTAGGGGAGGG - Intronic
951795442 3:26533604-26533626 GGGACAGAGCACCTGGGGGAAGG - Intergenic
953243317 3:41168610-41168632 AGGGCCCTGCACCTGGGGGATGG - Intergenic
953433397 3:42858056-42858078 GGGCCAGAGCACCTGGGGGAAGG + Intronic
953813880 3:46137341-46137363 CGGGGCCAGCCCCTGGGGAAAGG - Intergenic
953901637 3:46846988-46847010 CGGCCCCAGCACCTTGTGATGGG + Intergenic
954071625 3:48147031-48147053 TGGCGCCAGCACCTTGGAGATGG + Intergenic
954507691 3:51092545-51092567 GGGACAGAGCACCTGGGGGAAGG + Intronic
954508149 3:51097213-51097235 GGGACAGAGCACCTGGGGGAAGG - Intronic
954531130 3:51320859-51320881 GGGACAGAGCACCTGGGGGAAGG + Intronic
954886758 3:53881858-53881880 AGGCCCCAGCCCCTGGTGGGGGG - Intronic
954990860 3:54839678-54839700 AGGCCCCAGCACATCAGGGAGGG - Intronic
955414250 3:58678208-58678230 GGGACAGAGCACCTGGGGGAAGG - Intergenic
955453932 3:59100136-59100158 GGGACAGAGCACCTGGGGGAAGG - Intergenic
955657786 3:61263444-61263466 GGGACAGAGCACCTGGGGGAAGG - Intergenic
956005861 3:64777321-64777343 GGGACAGAGCACCTGGGGGAAGG + Intergenic
957044560 3:75363797-75363819 CTACACCAGCACCTGGAGGACGG - Intergenic
959074593 3:101736231-101736253 GGGACAGAGCACCTGGGGGAAGG + Intronic
959093029 3:101924650-101924672 GGGACAGAGCACCTGGGGGAAGG - Intergenic
959120063 3:102222700-102222722 GGGACAGAGCACCTGGGGGAAGG - Intronic
959735018 3:109648431-109648453 GGGACAGAGCACCTGGGGGAAGG + Intergenic
960055021 3:113270953-113270975 CGGGCCCACCTGCTGGGGGATGG + Intronic
960177327 3:114532521-114532543 GGGACAGAGCACCTGGGGGAAGG + Intronic
960226872 3:115179221-115179243 CGGACAGAGCACCTGGGGGTAGG - Intergenic
960378080 3:116927902-116927924 GGGACAGAGCACCTGGGGGAAGG - Intronic
960491592 3:118322219-118322241 GGGACATAGCACCTGGGGGAAGG - Intergenic
960776562 3:121262851-121262873 GGGACAGAGCACCTGGGGGAAGG + Intronic
961310635 3:125997110-125997132 GGGCCAGAGCACCTGGGGAAAGG + Intergenic
961977562 3:131042644-131042666 GGGACAGAGCACCTGGGGGAAGG + Intronic
962156906 3:132957254-132957276 GGGACAGAGCACCTGGGGGAAGG + Intergenic
962181059 3:133206909-133206931 GGGATACAGCACCTGGGGGAAGG - Intronic
962765761 3:138560903-138560925 GGGACAGAGCACCTGGGGGAAGG + Intronic
963027492 3:140933922-140933944 GGGACAGAGCACCTGGGGGAAGG + Intergenic
963629253 3:147712767-147712789 GGGACAGAGCACCTGGGGGAAGG - Intergenic
963827526 3:149970998-149971020 CCGCCGCAGCTCCTCGGGGAGGG - Exonic
964053140 3:152420141-152420163 GGGACAGAGCACCTGGGGGAAGG + Intronic
964332634 3:155620794-155620816 GGGACAGAGCACCTGGGGGAAGG + Intronic
965017294 3:163174266-163174288 GGGACAGAGCACCTGGGGGAAGG - Intergenic
965091028 3:164163029-164163051 GTGACCCAGCACCTGGGGGTAGG - Intergenic
965323512 3:167274818-167274840 TGACCCCAGCCCATGGGGGAAGG + Intronic
966255183 3:177909001-177909023 GGGACAGAGCACCTGGGGGAAGG + Intergenic
966309464 3:178576876-178576898 GGGACAGAGCACCTGGGGGAAGG + Intronic
966493772 3:180556825-180556847 GGGACAGAGCACCTGGGGGAAGG + Intergenic
966637869 3:182156314-182156336 GGGACAGAGCACCTGGGGGAAGG - Intergenic
967270478 3:187728564-187728586 CAGCCTCAGCACCTGGGGCAGGG + Intronic
967419524 3:189258610-189258632 GGGACAGAGCACCTGGGGGAAGG - Intronic
967562620 3:190934618-190934640 GGGACAGAGCACCTGGGGGAAGG - Intergenic
967638656 3:191834981-191835003 GGGACAGAGCACCTGGGGGAAGG + Intergenic
968371440 3:198224648-198224670 CGGCCCCAACCCCTGGGGATGGG - Intergenic
968596564 4:1489083-1489105 TGGCCTCAGCACCTGGGGTGGGG + Intergenic
968600863 4:1508665-1508687 TGGCCCCAGCAGCTGTGGCACGG + Intergenic
968829051 4:2922744-2922766 GGGACAGAGCACCTGGGGGAAGG - Intronic
969675220 4:8610726-8610748 CAGCCCCTGCACCTGTGGGTGGG - Intronic
970679421 4:18489699-18489721 AGGACAGAGCACCTGGGGGAAGG + Intergenic
970685286 4:18559951-18559973 GGGACAGAGCACCTGGGGGAAGG + Intergenic
971186493 4:24382770-24382792 GGGACAGAGCACCTGGGGGAAGG + Intergenic
971277435 4:25211422-25211444 CGGCCCTATAACCTGGAGGAAGG - Intronic
971430019 4:26556122-26556144 GGGACAGAGCACCTGGGGGAAGG - Intergenic
971679081 4:29673676-29673698 GGGACAGAGCACCTGGGGGAAGG + Intergenic
971805225 4:31350174-31350196 AGGTCCCAGGACCTGGAGGAAGG + Intergenic
972162548 4:36244391-36244413 CGGCCGCCGCACCTGGAGGCGGG + Exonic
972743228 4:41909115-41909137 GGGACAGAGCACCTGGGGGAAGG - Intergenic
972962793 4:44474245-44474267 GGGACAGAGCACCTGGGGGAAGG + Intergenic
973619272 4:52711503-52711525 CACCCCCAACACCTGGGGAAAGG + Intergenic
974263935 4:59560213-59560235 GGGACAGAGCACCTGGGGGAAGG - Intergenic
974307051 4:60155970-60155992 GGGACAGAGCACCTGGGGGAAGG - Intergenic
974453265 4:62093953-62093975 GGGACAGAGCACCTGGGGGAAGG - Intergenic
974491584 4:62571533-62571555 GGGACAGAGCACCTGGGGGAAGG - Intergenic
974786698 4:66626896-66626918 AGGCCCACCCACCTGGGGGAGGG - Intergenic
974814003 4:66982274-66982296 GGGACAGAGCACCTGGGGGAAGG + Intergenic
974814649 4:66989120-66989142 GGGACAGAGCACCTGGGGGAAGG - Intergenic
974851735 4:67412329-67412351 GGGACAGAGCACCTGGGGGAAGG - Intergenic
974946581 4:68536009-68536031 GGGACAGAGCACCTGGGGGAAGG - Intergenic
975305708 4:72846790-72846812 GGGACAGAGCACCTGGGGGAAGG + Intergenic
975424932 4:74214814-74214836 AGGACAGAGCACCTGGGGGAAGG - Intronic
975533013 4:75420539-75420561 AGGACAGAGCACCTGGGGGAAGG - Intergenic
975620290 4:76290261-76290283 GGGACAGAGCACCTGGGGGAAGG - Intronic
975638834 4:76478511-76478533 GGGACAGAGCACCTGGGGGAAGG + Intronic
976439328 4:85055301-85055323 GGGACAGAGCACCTGGGGGAAGG + Intergenic
976445928 4:85129731-85129753 GGGACAGAGCACCTGGGGGAAGG - Intergenic
976655878 4:87488695-87488717 GGGACAGAGCACCTGGGGGAAGG - Intronic
976669546 4:87636703-87636725 GGGACAGAGCACCTGGGGGAAGG + Intergenic
976809899 4:89089685-89089707 GGGACAGAGCACCTGGGGGAAGG - Intronic
976903475 4:90208105-90208127 GGGACAGAGCACCTGGGGGAAGG - Intronic
977046948 4:92079519-92079541 GGGACAGAGCACCTGGGGGAAGG + Intergenic
977154524 4:93555639-93555661 GGGACAGAGCACCTGGGGGAAGG + Intronic
977177005 4:93829756-93829778 CAGCCCCAGCTTCTGCGGGAGGG + Exonic
977601396 4:98937283-98937305 CGACCCCAGCCCATCGGGGAGGG + Intergenic
977632933 4:99263422-99263444 GGGACAGAGCACCTGGGGGAAGG - Intergenic
977723437 4:100267381-100267403 CGGACAGAGCACCTGGGGGAAGG - Intergenic
977774474 4:100900979-100901001 GGGACAGAGCACCTGGGGGAAGG + Intergenic
977897780 4:102383933-102383955 GGGACAGAGCACCTGGGGGAAGG - Intronic
978090333 4:104707385-104707407 GGGACAGAGCACCTGGGGGAAGG + Intergenic
978108318 4:104931093-104931115 GGGACAGAGCACCTGGGGGAAGG + Intergenic
978179489 4:105775953-105775975 GGGACAGAGCACCTGGGGGATGG - Intronic
978186013 4:105858016-105858038 GGGACAGAGCACCTGGGGGAAGG - Intronic
978236869 4:106471165-106471187 GGGACAGAGCACCTGGGGGAAGG - Intergenic
978313324 4:107409823-107409845 GGGACAGAGCACCTGGGGGACGG + Intergenic
979965932 4:127076944-127076966 GGGACAGAGCACCTGGGGGAAGG - Intergenic
979998663 4:127463758-127463780 GGGACAGAGCACCTGGGGGAAGG - Intergenic
980100272 4:128535475-128535497 GGGACTGAGCACCTGGGGGAAGG - Intergenic
980200632 4:129652039-129652061 GGGACAGAGCACCTGGGGGAAGG + Intergenic
980633874 4:135473554-135473576 GGGACAGAGCACCTGGGGGAAGG - Intergenic
981273218 4:142868250-142868272 GGGACAGAGCACCTGGGGGAAGG + Intergenic
981296705 4:143140896-143140918 GGAACACAGCACCTGGGGGAAGG + Intergenic
981629747 4:146804768-146804790 GGGACACAGCACCTCGGGGAAGG + Intronic
981662558 4:147184415-147184437 GGGACAGAGCACCTGGGGGAAGG + Intergenic
981859806 4:149341142-149341164 GGGACAGAGCACCTGGGGGAAGG - Intergenic
981885382 4:149666960-149666982 GGGACAGAGCACCTGGGGGAAGG + Intergenic
981940017 4:150271893-150271915 GGGACAGAGCACCTGGGGGAAGG + Intronic
982725555 4:158902591-158902613 GGGACAGAGCACCTGGGGGAAGG - Intronic
982733229 4:158978976-158978998 GGGACAGAGCACCTGGGGGAAGG - Intronic
982852908 4:160342081-160342103 GGGACAGAGCACCTGGGGGAAGG - Intergenic
983044469 4:162969470-162969492 GGGACAGAGCACCTGGGGGAAGG - Intergenic
983179491 4:164630975-164630997 GGGACAGAGCACCTGGGGGAAGG + Intergenic
983331344 4:166333347-166333369 GGGACAGAGCACCTGGGGGAAGG - Intergenic
983543337 4:168935795-168935817 GAGACACAGCACCTGGGGGAAGG + Intronic
983596270 4:169471732-169471754 GGGACAGAGCACCTGGGGGAAGG - Intronic
983602688 4:169548574-169548596 GGGACAGAGCACCTGGGGGAAGG - Intronic
983872678 4:172840396-172840418 AGGGCCCAGCAGCTGGCGGAAGG - Intronic
984618695 4:181927556-181927578 GGGACAGAGCACCTGGGGGAAGG + Intergenic
985359854 4:189162199-189162221 CGGCCCCGCCACTTGGGAGATGG + Intergenic
985472091 5:52990-53012 CAGCCTCCGCACCTGGCGGAGGG + Intergenic
985692200 5:1319639-1319661 TGGCCCCAGGCCCTGAGGGAAGG + Intronic
985784152 5:1885516-1885538 AGGCCCCAGCGCCTGGGGTCCGG + Intronic
985789039 5:1915580-1915602 AGGCCTCAGCACATGGGGGCAGG - Intergenic
986268952 5:6215127-6215149 CGCCCCCAGTAACTGGGTGATGG - Intergenic
986323036 5:6649328-6649350 GGGACAGAGCACCTGGGGGAGGG - Intronic
986581705 5:9272395-9272417 GGGACAGAGCACCTGGGGGAAGG + Intronic
987045460 5:14103446-14103468 CGACCCCAGCCCATGGGGGAGGG + Intergenic
988618263 5:32795542-32795564 GGGACAAAGCACCTGGGGGATGG + Intergenic
989618999 5:43366753-43366775 GGGACAGAGCACCTGGGGGAAGG - Intergenic
990224241 5:53631491-53631513 GGGACAGAGCACCTGGGGGAAGG - Intronic
990837848 5:60042330-60042352 GGGACAGAGCACCTGGGGGAAGG + Intronic
991026626 5:62037254-62037276 GGGACAGAGCACCTGGGGGAAGG - Intergenic
991128176 5:63090829-63090851 GGGACAGAGCACCTGGGGGAAGG + Intergenic
991242373 5:64474588-64474610 GGGACAGAGCACCTGGGGGAAGG + Intergenic
992038829 5:72808635-72808657 GGGACAGAGCACCTGGGGGAAGG - Intergenic
992254829 5:74911373-74911395 GGGACAGAGCACCTGGGGGAAGG - Intergenic
993119175 5:83753995-83754017 GGGACAGAGCACCTGGGGGAAGG + Intergenic
993381813 5:87217474-87217496 GGGACAGAGCACCTGGGGGAAGG - Intergenic
993402732 5:87473108-87473130 GGGACAGAGCACCTGGGGGAAGG + Intergenic
993403983 5:87488344-87488366 GGGACAGAGCACCTGGGGGAAGG + Intergenic
993410428 5:87567132-87567154 GGGACACAGCACCTGGGGGAAGG - Intergenic
993807946 5:92436308-92436330 GGGCCTAAGCCCCTGGGGGAGGG + Intergenic
993911601 5:93690587-93690609 GGGACATAGCACCTGGGGGAAGG + Intronic
994005123 5:94828561-94828583 AGGTCAGAGCACCTGGGGGAAGG - Intronic
994015081 5:94955799-94955821 GGGACAGAGCACCTGGGGGAAGG + Intronic
994042590 5:95275114-95275136 CTTGCCCAGCACTTGGGGGAAGG + Intronic
994142813 5:96360939-96360961 GGGACACAGCACCTGGGGGAAGG - Intergenic
994378125 5:99038138-99038160 GGGACAGAGCACCTGGGGGAAGG + Intergenic
994609567 5:102019102-102019124 GGGACAGAGCACCTGGGGGAAGG + Intergenic
994642008 5:102421654-102421676 GGGACAGAGCACCTGGGGGAAGG + Intronic
994721518 5:103385775-103385797 GGGACAGAGCACCTGGGGGAAGG - Intergenic
995136530 5:108685721-108685743 GGGACAGAGCACCTGGGGGAAGG - Intergenic
995252230 5:110006604-110006626 GGGACAGAGCACCTGGGGGAAGG - Intergenic
995612411 5:113924138-113924160 GGGACAGAGCACCTGGGGGAAGG + Intergenic
995695786 5:114876753-114876775 GGGACAGAGCACCTGGGGGAAGG + Intergenic
995790609 5:115882807-115882829 GGGACAGAGCACCTGGGGGAAGG - Intronic
995808612 5:116080711-116080733 GGGACAGAGCACCTGGGGGAGGG + Intergenic
996065181 5:119071476-119071498 CGGCCGCCGCCCCTGAGGGAAGG + Exonic
996129989 5:119770062-119770084 GGGACAGAGCACCTGGGGGAAGG + Intergenic
996171050 5:120292300-120292322 TGCCCCCAGCACCTGGAGGATGG - Intergenic
996648102 5:125841227-125841249 GGGACAGAGCACCTGGGGGAAGG + Intergenic
996754564 5:126922112-126922134 CGGCCACAGGTCGTGGGGGAAGG + Intronic
997004787 5:129804719-129804741 GGGACAGAGCACCTGGGGGAAGG - Intergenic
997252333 5:132398639-132398661 GGGACAGAGCACCTGGGGGAAGG + Intergenic
998752046 5:145333377-145333399 GGGACAGAGCACCTGGGGGAAGG - Intergenic
998972732 5:147610790-147610812 GGGACACAGCACCTAGGGGAAGG - Intronic
999030024 5:148280890-148280912 AGGACAGAGCACCTGGGGGAAGG - Intronic
999468707 5:151831683-151831705 GGGACAAAGCACCTGGGGGAAGG + Intronic
999489793 5:152038906-152038928 GGGACAGAGCACCTGGGGGAAGG - Intergenic
999502332 5:152159914-152159936 GGGACAGAGCACCTGGGGGAAGG - Intergenic
999688360 5:154122689-154122711 GGGGCAGAGCACCTGGGGGAAGG + Intronic
999983973 5:156984976-156984998 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1000312211 5:160056005-160056027 CCTACCCAGCACCTGGGGCAAGG - Intronic
1000406526 5:160893577-160893599 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1000798334 5:165693018-165693040 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1000820151 5:165973278-165973300 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1000996056 5:167960302-167960324 GGGACAGAGCACCTGGGGGAAGG - Intronic
1001278007 5:170365115-170365137 CTTCCCCAGCACCTGGTGCAGGG + Intronic
1001362624 5:171103207-171103229 GGGACAGAGCACCTGGGGGAAGG - Intronic
1001933117 5:175687104-175687126 CTGCCCCTGCTCCTGGGGGCTGG - Intergenic
1002673576 5:180890231-180890253 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1002677211 5:180926855-180926877 GGGACAGAGCACCTGGGGGAAGG + Intronic
1002685831 5:181008545-181008567 TGGACAGAGCACCTGGGGGAAGG + Intergenic
1002730678 5:181330194-181330216 CGGCCCCAACCCCTGGGGATGGG - Intergenic
1002753852 6:143910-143932 CGGCCCCAACCCCTGGGGATGGG + Intergenic
1003098201 6:3157903-3157925 GGGCCCCGGAACCAGGGGGAGGG + Intergenic
1003416845 6:5917452-5917474 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1004275711 6:14233505-14233527 TGGCCTCTGCACCTGGAGGATGG + Intergenic
1004944431 6:20596269-20596291 GGGACAGAGCACCTGGGGGAAGG - Intronic
1005569394 6:27130148-27130170 CAGCCCCTGCCCCTGGGGGATGG - Intronic
1005761289 6:28970248-28970270 CCGCCCCAGAAGCTGGTGGAGGG + Intergenic
1005795807 6:29360297-29360319 GGGACAGAGCACCTGGGGGAAGG + Intronic
1006200010 6:32279747-32279769 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1006317551 6:33299217-33299239 AGTCTCCAGCCCCTGGGGGAAGG + Exonic
1006318549 6:33305216-33305238 CGACGCCAGCACCTGGGTAAGGG - Exonic
1006501020 6:34458826-34458848 CTGCCCCAGACCCTGGGGGAAGG - Intergenic
1006854675 6:37124581-37124603 CTGCCCCAGACCCTGGAGGAAGG + Intergenic
1007195558 6:40056887-40056909 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1007749937 6:44065653-44065675 CGGCTCCAGCACATGGGAGAGGG + Intergenic
1008758360 6:54824602-54824624 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1008864031 6:56188519-56188541 TGGACAGAGCACCTGGGGGAAGG + Intronic
1008896796 6:56565805-56565827 GGGACAGAGCACCTGGGGGAAGG - Intronic
1009194044 6:60663557-60663579 GGGACACAGCACCTGGAGGAAGG - Intergenic
1009240831 6:61184001-61184023 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1009290143 6:61870425-61870447 GGGACAGAGCACCTGGGGGAAGG + Intronic
1009709570 6:67300241-67300263 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1009945317 6:70336233-70336255 GGGACACAGCACCTGGGAGAAGG - Intergenic
1010039103 6:71360927-71360949 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1010446960 6:75959475-75959497 GGGACAGAGCACCTGGGGGAAGG - Intronic
1010822634 6:80433269-80433291 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1011020647 6:82809099-82809121 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1011209214 6:84936580-84936602 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1011387639 6:86815242-86815264 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1011776742 6:90739365-90739387 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1012043456 6:94239216-94239238 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1012127887 6:95453855-95453877 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1012207423 6:96478511-96478533 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1013025082 6:106263375-106263397 GGGACACAGCACCTGGGGGAAGG + Intronic
1013200672 6:107892157-107892179 GGGACAGAGCACCTGGGGGAAGG - Intronic
1013225672 6:108118200-108118222 CGGCCGCAGCATCTCCGGGAGGG - Intronic
1013375278 6:109508810-109508832 CTGGACCAGCCCCTGGGGGATGG + Intronic
1013390291 6:109679487-109679509 GGGACAGAGCACCTGGGGGAAGG + Intronic
1013453042 6:110303698-110303720 GGGTCAGAGCACCTGGGGGAAGG + Intronic
1013920102 6:115394193-115394215 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1013939634 6:115645683-115645705 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1014070418 6:117175409-117175431 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1014169834 6:118266704-118266726 CTGCCCCAGCACCTGGAGGCAGG + Intronic
1014176985 6:118342150-118342172 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1014223496 6:118822732-118822754 GGGACAGAGCACCTGGGGGAAGG - Intronic
1014225260 6:118840028-118840050 GGGACAGAGCACCTGGGGGAAGG - Intronic
1014466379 6:121761027-121761049 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1014569089 6:122986724-122986746 TGGACAGAGCACCTGGGGGAAGG + Intergenic
1014836507 6:126166718-126166740 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1014872587 6:126614652-126614674 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1014922476 6:127229021-127229043 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1015108958 6:129569497-129569519 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1015387015 6:132635659-132635681 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1016418351 6:143857041-143857063 GGGACAGAGCACCTGGGGGAAGG - Intronic
1017322678 6:153111474-153111496 GGGACAGAGCACCTGGGGGAAGG + Intronic
1017571455 6:155749121-155749143 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1017940757 6:159050892-159050914 CGGCCCCTGCTCCTCGGGGTTGG + Intergenic
1018186483 6:161269519-161269541 CAGTCCCAGCTGCTGGGGGAGGG + Intronic
1018805837 6:167258806-167258828 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1019025833 6:168962334-168962356 CAGCCCCAGCACCGGGTGGCCGG + Intergenic
1019071862 6:169353480-169353502 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1019087983 6:169499979-169500001 TGCACCCAGCAGCTGGGGGAAGG - Intronic
1019203620 6:170341113-170341135 GGGACAGAGCACCTGGGGGAAGG - Intronic
1019472160 7:1226925-1226947 GGGCCCCAGCACCAGGGCTAGGG - Intergenic
1019659869 7:2218235-2218257 AGGCCCCAGCCCCTGTGGGCTGG + Intronic
1020358234 7:7300917-7300939 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1020367189 7:7393561-7393583 CGGACAGAGCACCTGGGGGAAGG - Intronic
1020639943 7:10742454-10742476 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1021014710 7:15518203-15518225 GGGACAGAGCACCTGGGGGAAGG + Intronic
1021071702 7:16249261-16249283 GGGACAGAGCACCTGGGGGAAGG + Intronic
1021086045 7:16421570-16421592 CGGTCCCAGCGCCTGCGGGAGGG + Intergenic
1021166958 7:17354051-17354073 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1021502269 7:21344891-21344913 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1021749301 7:23779446-23779468 GGGACAGAGCACCTGGGGGAAGG - Intronic
1021805680 7:24352671-24352693 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1022520707 7:31005228-31005250 CAGCCCCTGCACCTGGCTGAGGG + Intergenic
1022787535 7:33653333-33653355 CTGCCCCATCCCCAGGGGGAAGG - Intergenic
1022884484 7:34628640-34628662 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1023051707 7:36258433-36258455 GGGACAGAGCACCTGGGGGAAGG - Intronic
1023061637 7:36333040-36333062 GGGACAGAGCACCTGGGGGAAGG + Intronic
1023966387 7:44965078-44965100 CGGGCCCGCCACCTGGGAGAGGG + Exonic
1024495492 7:50041191-50041213 GGGACAGAGCACCTGGGGGAAGG + Intronic
1024647778 7:51383940-51383962 CGGCCCCTACCCCTGGGGGTGGG + Intergenic
1024703313 7:51928093-51928115 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1024998476 7:55294520-55294542 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1025211485 7:57021455-57021477 CGACCCCAGCACCAGGCAGAGGG + Intergenic
1025694832 7:63769409-63769431 CGGCCCCAACCCCTGGGGATGGG - Intergenic
1026479243 7:70764201-70764223 CGGGCCCGGCTCCTTGGGGAAGG - Intronic
1026488188 7:70838707-70838729 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1027303206 7:76863409-76863431 CGGCCCCAGCTCCTGTTGGGTGG - Intergenic
1027510308 7:79071556-79071578 GGGACAGAGCACCTGGGGGAAGG - Intronic
1027637128 7:80689549-80689571 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1028145834 7:87319122-87319144 AGGACAGAGCACCTGGGGGAAGG - Intergenic
1028337365 7:89674071-89674093 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1028627926 7:92898369-92898391 GGGACACAGCACCTGGGTGAAGG - Intergenic
1028945562 7:96575574-96575596 GGGACAGAGCACCTGGGGGAAGG - Intronic
1028998323 7:97126423-97126445 GGGCCACAGCACCTGGGGGAAGG - Intronic
1029438564 7:100575380-100575402 TGGCCCCAGCACGTGAGGGCAGG - Intronic
1029524679 7:101087636-101087658 TGGCACCAGCACCGGGGGGCCGG + Exonic
1029542313 7:101191073-101191095 CTGCCCCATCCCCTGGAGGAAGG - Intergenic
1029851060 7:103462351-103462373 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1030140990 7:106304093-106304115 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1030159583 7:106493406-106493428 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1030245209 7:107377830-107377852 GGGACAGAGCACCTGGGGGAAGG + Intronic
1030325802 7:108217526-108217548 GGGACAGAGCACCTGGGGGAAGG - Intronic
1030361067 7:108596016-108596038 CTGCCCCAGAACTTCGGGGAAGG + Intergenic
1030500772 7:110356389-110356411 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1030612587 7:111705810-111705832 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1031397697 7:121293127-121293149 GGGACAGAGCACCTGGGGGAAGG - Intronic
1032295880 7:130638332-130638354 GGGACAGAGCACCTGGGGGAAGG - Intronic
1032530427 7:132615389-132615411 CAGCCCCCGCCCCTGGCGGAGGG + Intronic
1032883416 7:136114436-136114458 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1033242346 7:139690549-139690571 CAGCCCCAGCACTTTGGGGTGGG + Intronic
1033303787 7:140209450-140209472 TGTCTCCAGCAGCTGGGGGAAGG + Intergenic
1033617704 7:143032545-143032567 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1034272979 7:149812257-149812279 TGTCCCCAGGAGCTGGGGGATGG + Intergenic
1035998272 8:4573729-4573751 GGGACAGAGCACCTGGGGGAAGG - Intronic
1036553828 8:9839208-9839230 TGGACAGAGCACCTGGGGGAAGG + Intergenic
1036685187 8:10904753-10904775 TGAACACAGCACCTGGGGGAAGG + Intronic
1037258238 8:16979424-16979446 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1038326594 8:26577233-26577255 CGGGCCCGGCTCCTGGGGGCGGG - Intronic
1038354372 8:26813552-26813574 CAGGCCAAGCACCTGAGGGATGG - Intronic
1038805864 8:30790665-30790687 CTGCCCCAGGAGCTGGGGCAGGG + Intronic
1039283023 8:36006944-36006966 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1039566067 8:38553521-38553543 AGGCCCCTGCACCTGGGGTTGGG + Intergenic
1039595572 8:38787546-38787568 CGGCTCCAGCTCCTAGGGGCAGG - Exonic
1040538065 8:48326970-48326992 TGGGCCCAGGACCCGGGGGAGGG + Intergenic
1040736597 8:50515836-50515858 GGGACAGAGCACCTGGGGGAAGG + Intronic
1041050854 8:53932662-53932684 GGGACAAAGCACCTGGGGGAAGG + Intronic
1041155102 8:54977420-54977442 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1041287343 8:56274050-56274072 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1041419040 8:57646605-57646627 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1041836685 8:62223956-62223978 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1041838288 8:62241848-62241870 GGGACACAGCACCTGGGGGAAGG - Intergenic
1041900588 8:62978322-62978344 GGGACAGAGCACCTGGGGGAAGG - Exonic
1042070766 8:64931027-64931049 GGGACAAAGCACCTGGGGGAAGG - Intergenic
1042812863 8:72845545-72845567 GGGACAGAGCACCTGGGGGAAGG - Intronic
1043028921 8:75106633-75106655 CTTCCCAGGCACCTGGGGGAAGG + Intergenic
1043253616 8:78106217-78106239 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1043647203 8:82535971-82535993 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1044115275 8:88327596-88327618 CGCCCCCAGCTCCTGCGGGAAGG + Intronic
1044335854 8:90984775-90984797 CTGCCCCAGCACCTGGTGCCAGG - Intronic
1044509426 8:93058105-93058127 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1044685695 8:94823569-94823591 CGGCGCCTGCACCTGGGGAGCGG + Intronic
1044820751 8:96154241-96154263 TGGCCCCGGCGCCTGGGGGCGGG - Intronic
1045185131 8:99830206-99830228 GGGACAGAGCACCTGGGGGAAGG - Intronic
1045199711 8:99967765-99967787 GGGACAGAGCACCTGGGGGACGG + Intronic
1045390629 8:101710798-101710820 GGGACAGAGCACCTGGGGGAAGG + Intronic
1045618951 8:103952137-103952159 GGGACAGAGCACCTGGGGGAAGG + Intronic
1045783727 8:105897505-105897527 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1045975051 8:108122632-108122654 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1046106544 8:109673065-109673087 CGGACAGAGCACCTGGGGGAAGG + Intronic
1046277855 8:111986109-111986131 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1046891232 8:119423086-119423108 CAGCTCCAGCTCCTGGAGGAAGG - Exonic
1046947426 8:119987638-119987660 GGGACAGAGCACCTGGGGGAAGG - Intronic
1047133720 8:122051896-122051918 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1048584709 8:135764189-135764211 CTGCCCCATTACCTGGGGGATGG + Intergenic
1048914061 8:139165279-139165301 GGGACACAGCACCTGGGGGAAGG - Intergenic
1049497176 8:142941494-142941516 GGGCCCCATCACCTGTGGCACGG - Intergenic
1049706494 8:144045583-144045605 CTGCTCCAACACTTGGGGGAGGG - Intronic
1049708231 8:144052437-144052459 CCGCCCCCGCACCTGGGAGGCGG + Exonic
1049748772 8:144273880-144273902 CTGCCTGCGCACCTGGGGGAGGG + Intronic
1049805555 8:144537214-144537236 CAGCCCCAGAAGCAGGGGGAGGG - Intronic
1049814462 8:144591672-144591694 CGGCCTGAGCACCTGGAGGGCGG + Intronic
1049964654 9:767275-767297 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1050031817 9:1393914-1393936 GGGACAGAGCACCTGGGGGATGG + Intergenic
1050201299 9:3148622-3148644 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1050852103 9:10300798-10300820 GAGACCGAGCACCTGGGGGAAGG + Intronic
1050973872 9:11912017-11912039 TGGACAGAGCACCTGGGGGAAGG - Intergenic
1050982364 9:12036300-12036322 CGGCCTGAGCTCCTAGGGGAAGG + Intergenic
1051124855 9:13792171-13792193 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1051298081 9:15618130-15618152 AGGACAGAGCACCTGGGGGAAGG - Intronic
1051353968 9:16223911-16223933 GGGACAGAGCACCTGGGGGAAGG + Intronic
1051548769 9:18305740-18305762 GGGACACAGCACTTGGGGGATGG + Intergenic
1051611600 9:18967353-18967375 GGGACAGAGCACCTGGGGGAAGG - Intronic
1051695770 9:19766900-19766922 GGGGCAGAGCACCTGGGGGAAGG - Intronic
1051733287 9:20170411-20170433 TGACCCCAGCCCATGGGGGAGGG - Intergenic
1051998510 9:23248269-23248291 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1052125089 9:24765004-24765026 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1052134129 9:24889312-24889334 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1052144005 9:25025491-25025513 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1052667961 9:31518986-31519008 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1052840478 9:33288523-33288545 TGGGCCCAGCTCCTGGGGGCTGG + Intergenic
1052857519 9:33416431-33416453 CTGCCCCGGCACCTGGGGCCTGG - Intergenic
1053454783 9:38225695-38225717 TGTCCCCAGCACCTGGGATAGGG - Intergenic
1053503706 9:38622037-38622059 CGGCCCCAGGACCAGGGGTGCGG + Intergenic
1053608120 9:39680995-39681017 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1053865961 9:42437355-42437377 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1054245411 9:62661414-62661436 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1054559540 9:66695945-66695967 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1054719835 9:68593754-68593776 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1055125665 9:72716368-72716390 GGGACAGAGCACCTGGGGGAAGG - Intronic
1055239276 9:74164160-74164182 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1055390904 9:75821354-75821376 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1055537833 9:77267774-77267796 GGGACGGAGCACCTGGGGGAAGG - Intronic
1055571825 9:77624303-77624325 GGGACAGAGCACCTGGGGGAAGG + Intronic
1055628794 9:78201449-78201471 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1055894853 9:81162935-81162957 TGGACAGAGCACCTGGGGGAAGG + Intergenic
1056302588 9:85257755-85257777 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1056385101 9:86090353-86090375 GGGACAGAGCACCTGGGGGAAGG - Intronic
1056732440 9:89178008-89178030 GGGCCCCAGCACCTGGTCGCTGG + Exonic
1057577740 9:96256937-96256959 CCACGACAGCACCTGGGGGATGG - Intronic
1057827239 9:98380514-98380536 GGGCCCCAGTGCCAGGGGGAAGG - Intronic
1058072826 9:100619218-100619240 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1058408508 9:104703993-104704015 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1058559000 9:106203834-106203856 GGGACAGAGCACCTGGGGGAGGG - Intergenic
1060235008 9:121856726-121856748 AGCCCCCAGCAGCTGTGGGATGG + Intronic
1060283196 9:122227469-122227491 CTGGGCCATCACCTGGGGGAGGG + Exonic
1060572668 9:124656877-124656899 TGTCCCCAGGGCCTGGGGGAGGG + Intronic
1060948600 9:127586323-127586345 CGACCCCAGCACCCTGGAGAGGG - Intergenic
1061071553 9:128313948-128313970 CTGCCCCAGAAGCTGGGGGTGGG + Intronic
1062003725 9:134229172-134229194 GGGGCCCAGCTCCTGGGCGATGG + Intergenic
1062077043 9:134595144-134595166 GGGCCCCAACAGCTGGGGCAAGG - Intergenic
1062397917 9:136359935-136359957 CCCACCCAGCACCCGGGGGAGGG + Intronic
1062440637 9:136567781-136567803 AGGCTGCAGCACCTGGGGAAGGG - Intergenic
1062467568 9:136687808-136687830 CTGCCCCGGCAGCGGGGGGAGGG - Intergenic
1062488302 9:136791863-136791885 GGCCCCCAGCACCTGCGGGCAGG - Intronic
1062665722 9:137670440-137670462 TGCACCCAGCACCGGGGGGAGGG - Intronic
1062755087 9:138282704-138282726 CGGCCCCAACCCCTGGGGATGGG - Intergenic
1203578995 Un_KI270745v1:26873-26895 CGGCCCCAACCCCTGGGGATGGG - Intergenic
1186193860 X:7092758-7092780 CGCCCCAAGCACCTGGGTCATGG - Intronic
1186354255 X:8773473-8773495 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1186599756 X:11024400-11024422 GGGACAGAGCACCTGGGGGAGGG - Intergenic
1186773267 X:12838964-12838986 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1186832555 X:13404785-13404807 CGGACAGAGCACCTGGGGGAAGG + Intergenic
1187372667 X:18723578-18723600 CATCCGCAGCACCTGGGGCAAGG - Intronic
1187648274 X:21373953-21373975 CGGCCCCACCACCGAGGGGAGGG - Intergenic
1187784365 X:22867214-22867236 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1188084173 X:25882871-25882893 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1188129972 X:26419371-26419393 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1188193265 X:27197518-27197540 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1188296406 X:28455717-28455739 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1189590688 X:42507564-42507586 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1189702569 X:43727278-43727300 GGGCCAGAGCACCTGGGGGAAGG - Intronic
1189721816 X:43927399-43927421 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1190108620 X:47575263-47575285 GGAACCCACCACCTGGGGGAAGG + Exonic
1190341413 X:49299617-49299639 GGGACAGAGCACCTGGGGGAAGG - Intronic
1190958420 X:55220583-55220605 CTGCATCAGGACCTGGGGGAAGG - Exonic
1190963693 X:55277730-55277752 GGGACAGAGCACCTGGGGGAAGG - Intronic
1191135317 X:57058198-57058220 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1191631997 X:63331561-63331583 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1191705160 X:64086204-64086226 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1191785046 X:64908117-64908139 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1191793827 X:64999974-64999996 GGGACAGAGCACCTGGGGGAAGG + Intronic
1191848548 X:65568926-65568948 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1192128934 X:68530072-68530094 GGGACAGAGCACCTGGGGGATGG - Intronic
1192228504 X:69246442-69246464 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1192637139 X:72830735-72830757 GGGACAGAGCACCTGGGGGAAGG - Intronic
1192644575 X:72890079-72890101 GGGACAGAGCACCTGGGGGAAGG + Intronic
1192692162 X:73375200-73375222 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1192953128 X:76039225-76039247 GGGACAGAGCACCTGGGGGAGGG - Intergenic
1192966497 X:76182886-76182908 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1192977614 X:76303023-76303045 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1193060109 X:77197063-77197085 AGGACAAAGCACCTGGGGGAAGG - Intergenic
1193068633 X:77283361-77283383 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1193081537 X:77411646-77411668 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1193351994 X:80474760-80474782 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1193361655 X:80586481-80586503 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1193389213 X:80906639-80906661 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1193571716 X:83152187-83152209 GGGACAAAGCACCTGGGGGAAGG + Intergenic
1193685479 X:84572015-84572037 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1193830048 X:86279076-86279098 GGGACAGAGCACCTGGGGGAAGG + Intronic
1193897315 X:87129139-87129161 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1193949377 X:87778946-87778968 GGGACGGAGCACCTGGGGGAAGG + Intergenic
1194419977 X:93661242-93661264 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1194624825 X:96215062-96215084 GGGACAGAGCACCTGGGGGAGGG + Intergenic
1194798346 X:98240445-98240467 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1194837423 X:98698718-98698740 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1194901255 X:99514447-99514469 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1194954372 X:100162203-100162225 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1195102348 X:101567390-101567412 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1195127388 X:101822152-101822174 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1195232969 X:102869788-102869810 GGGGCAGAGCACCTGGGGGAAGG - Intergenic
1195415080 X:104611264-104611286 GGGACAGAGCACCTGGGGGAAGG - Intronic
1195580238 X:106493426-106493448 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1195774773 X:108391302-108391324 GGGACAGAGCACCTGGGGGAAGG - Intronic
1195826223 X:109003878-109003900 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1195882191 X:109603919-109603941 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1195985617 X:110626850-110626872 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1196281128 X:113825122-113825144 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1196545676 X:116962183-116962205 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1196571323 X:117268881-117268903 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1196587253 X:117443973-117443995 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1196602900 X:117622693-117622715 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1196845271 X:119892152-119892174 TGGCGCCAGCACCTGGGTGGTGG + Intergenic
1197051239 X:122061568-122061590 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1197071234 X:122300191-122300213 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1197184788 X:123574011-123574033 GGGACACAGCACCTGCGGGAAGG + Intergenic
1197880708 X:131164017-131164039 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1198062639 X:133062276-133062298 GGGACAGAGCACCTGGGGGAAGG + Intronic
1198489986 X:137129969-137129991 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1198519043 X:137433913-137433935 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1198663522 X:138996712-138996734 GGGACAGAGCACCTGGGGGAAGG + Intronic
1198784435 X:140272508-140272530 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1199004077 X:142674984-142675006 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1199012138 X:142770381-142770403 GGGACAGAGCACCTGGGGGAAGG - Intergenic
1199094517 X:143724008-143724030 GGGACCGAGCACTTGGGGGAAGG + Intergenic
1199436653 X:147819906-147819928 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1199584240 X:149396391-149396413 TGACCCCAGCCCATGGGGGAGGG + Intergenic
1200206157 X:154317806-154317828 GGGTGGCAGCACCTGGGGGAAGG + Intronic
1200218283 X:154378469-154378491 CCGCCCCAGCAGCGGCGGGAAGG - Intergenic
1200388447 X:155917914-155917936 GGGACCGAGCACCTGGGGGAAGG - Intronic
1200803360 Y:7407219-7407241 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1201371435 Y:13269117-13269139 GGGACATAGCACCTGGGGGAAGG - Intronic
1201424246 Y:13831488-13831510 CGGCGCCAGCAACTGGGGAAGGG + Intergenic
1201543239 Y:15132048-15132070 GGGACAGAGCACCTGGGGGAAGG + Intergenic
1201946427 Y:19515308-19515330 GGGACAGAGCACCTGGGGGAAGG + Intergenic