ID: 1083781458

View in Genome Browser
Species Human (GRCh38)
Location 11:64920372-64920394
Sequence TGTGGTACACACATGGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083781458_1083781461 -6 Left 1083781458 11:64920372-64920394 CCCAGTGCCATGTGTGTACCACA 0: 1
1: 0
2: 1
3: 23
4: 137
Right 1083781461 11:64920389-64920411 ACCACAGCAGAAGATTAGACAGG 0: 1
1: 0
2: 0
3: 12
4: 162
1083781458_1083781463 3 Left 1083781458 11:64920372-64920394 CCCAGTGCCATGTGTGTACCACA 0: 1
1: 0
2: 1
3: 23
4: 137
Right 1083781463 11:64920398-64920420 GAAGATTAGACAGGACTGAGAGG 0: 1
1: 0
2: 1
3: 24
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083781458 Original CRISPR TGTGGTACACACATGGCACT GGG (reversed) Intronic
901057005 1:6453195-6453217 TGGGGCACATAAATGGCACTCGG - Intronic
901641838 1:10696517-10696539 TGGGGTATACACATGCCTCTGGG + Intronic
902460792 1:16574957-16574979 TATGGTGCAGACATGACACTCGG + Intronic
902461556 1:16581221-16581243 TATGGTACAGACATGACACTTGG + Intronic
902462340 1:16587526-16587548 TATGGTACAGACATGACACTTGG + Intronic
902477371 1:16695296-16695318 TGGGGCACATAAATGGCACTCGG + Intergenic
905490880 1:38342902-38342924 AGTGGCACACAAATGGCACATGG + Intergenic
905834289 1:41103929-41103951 TGTGGTACACAAATAGAAATAGG - Intronic
908990449 1:70081572-70081594 TGTGGTAGACTCATGAGACTGGG - Intronic
909504005 1:76367373-76367395 TGTGGTAAGCACAGGGCACTAGG + Intronic
913289459 1:117258838-117258860 TGTGGTATACACATGGCATTGGG - Intergenic
913603133 1:120440991-120441013 TATGGTACAGACATGACACTTGG - Intergenic
913603881 1:120447343-120447365 TATGGTACAGACATGACACTTGG - Intergenic
913604631 1:120453622-120453644 TACGGTACAGACATGACACTCGG - Intergenic
913640747 1:120810060-120810082 TATGGTACAGACATGACACTTGG - Intronic
913990445 1:143606978-143607000 TATGGTACAGACATGACACTTGG + Intergenic
914277731 1:146140285-146140307 CATGGTACAGACATGACACTTGG + Intronic
914364309 1:146964606-146964628 TATGGTACAGACATGACACTTGG - Intronic
914365079 1:146970896-146970918 TATGGTACAGACATGACACTTGG - Intronic
914487369 1:148122530-148122552 TATGGTACAGACATGACACTTGG + Intronic
914538777 1:148591233-148591255 TATGGTACAGACATGACACTTGG + Intronic
914587713 1:149077684-149077706 TATGGTACAGACATGACACTTGG + Intronic
919814171 1:201427365-201427387 TGTGGTTCCCACAGGGAACTTGG + Intronic
920764545 1:208819351-208819373 TCTGGTACACACCTGGCTCAGGG + Intergenic
921393984 1:214649265-214649287 TGTGGCACACCTATAGCACTTGG + Intronic
921850713 1:219929349-219929371 TGTGGTAGACACAAGTCCCTTGG + Intronic
922919981 1:229293962-229293984 TGTGGGCCACACATGGCAGCAGG + Intronic
923871278 1:237996571-237996593 TCTGGAACACAAATTGCACTGGG - Intergenic
1068922503 10:62499540-62499562 TATGGTACAAACATGGCAACAGG + Intronic
1069921530 10:71818605-71818627 TGAGCTACTCACATTGCACTGGG + Exonic
1071088489 10:81892069-81892091 TGTGATACATACGTGGGACTTGG + Intronic
1074392909 10:113072750-113072772 TGTGGTGCACACAGGTGACTCGG + Intronic
1074419357 10:113295320-113295342 TGTGGTACAGAAAGAGCACTGGG + Intergenic
1075343420 10:121664923-121664945 TGGAATACACACATGCCACTAGG + Intergenic
1076354048 10:129839610-129839632 GTTGGTACACACCTGGCCCTGGG + Intronic
1078002530 11:7509449-7509471 TGATGGACACACATGGCTCTTGG + Exonic
1080762026 11:35260521-35260543 TGTGGTACACTCCAGGGACTTGG - Exonic
1081662765 11:44898205-44898227 TGCTGTACCCACAGGGCACTGGG + Intronic
1083075391 11:60031931-60031953 TGTGGGTGTCACATGGCACTTGG - Intergenic
1083781458 11:64920372-64920394 TGTGGTACACACATGGCACTGGG - Intronic
1084436964 11:69148610-69148632 TGAGGTACACACATGACTGTGGG - Intergenic
1091368975 11:135043107-135043129 TGTGCTTCTCACATGGCCCTGGG + Intergenic
1092266392 12:6984258-6984280 TGTGGTTCACTCATGGCCTTTGG - Intronic
1096780798 12:53991011-53991033 TGTGGAACCCCCATGGCAATGGG - Intronic
1100169675 12:91959860-91959882 TGTGGAAAACACATGACACTTGG - Intergenic
1103056934 12:117828826-117828848 AGTGGGACACAGATGGCAGTTGG - Intronic
1104032654 12:125076243-125076265 TGTGGAACACATATGTTACTGGG + Intronic
1104981804 12:132576562-132576584 TGTGGTACGTACTTGGCACATGG - Intronic
1108342777 13:49514281-49514303 TGTGTTACATACATTGCTCTAGG + Intronic
1110110344 13:71737336-71737358 TCTGGAACACAAATGGAACTTGG + Intronic
1110610391 13:77481101-77481123 TATGGAACACACATGTCACTTGG - Intergenic
1111914905 13:94350783-94350805 TGGGGCACACAGATGGCATTAGG + Intronic
1112506397 13:99978917-99978939 TGTAGTACAAAAATTGCACTAGG + Intergenic
1113678299 13:112223252-112223274 TGTGGTCCTCACCTGGCACGGGG - Intergenic
1117281738 14:54248112-54248134 TGTGGTCCACAGATGACATTTGG + Intergenic
1120177397 14:81309621-81309643 TGAGCTACATACATGGCTCTAGG - Intronic
1121114332 14:91332824-91332846 CCTGGCACACACAAGGCACTTGG - Intronic
1121501476 14:94441783-94441805 AGTGGTACACACATGCAGCTGGG + Intergenic
1121795804 14:96734416-96734438 TATGGTAAACACCTGGCTCTAGG - Intergenic
1121931625 14:97977674-97977696 TGTTGTGCACACATGTCACTTGG - Intronic
1122447424 14:101780293-101780315 TCAGGTACACACATTACACTAGG + Intronic
1122587903 14:102823123-102823145 TGAGGTAGACAGATGGCAGTGGG + Intronic
1123925818 15:25109674-25109696 TGCGGTGCCCACATGCCACTGGG + Intergenic
1126869089 15:52968499-52968521 TGCGGTACACACCTAGTACTGGG - Intergenic
1127469583 15:59278531-59278553 TCTGCTACATACAAGGCACTGGG + Intronic
1130067368 15:80615901-80615923 TGTGGTACATCCAGGGCACAAGG - Intergenic
1132665594 16:1080099-1080121 TGGGGTAGACACAGGGCAGTAGG + Exonic
1133425886 16:5689100-5689122 TGTAACACAAACATGGCACTTGG + Intergenic
1133456676 16:5948313-5948335 TGTGGGAGACACATGGCCTTTGG + Intergenic
1135704081 16:24659498-24659520 AGTGGTACAAACATGGCTCACGG + Intergenic
1136922873 16:34346187-34346209 TGAGGAACACAGATGGCACCAGG - Intergenic
1136981700 16:35065619-35065641 TGAGGAACACAGATGGCACCAGG + Intergenic
1138786624 16:59854161-59854183 GGAGGTACACAAATGGCACAAGG - Intergenic
1139102981 16:63790707-63790729 TTTGTAACACACATGGTACTTGG - Intergenic
1140514125 16:75530082-75530104 GGTGGTCCACACATGCCACGCGG + Exonic
1143336412 17:6174814-6174836 TCTGGAATACACATGGCACAGGG + Intergenic
1144358224 17:14466355-14466377 TGGCGCACACACATGGCTCTTGG + Intergenic
1146175595 17:30664179-30664201 TATGGATCACACATGGCTCTAGG + Intergenic
1146349044 17:32080225-32080247 TATGGATCACACATGGCTCTAGG + Intergenic
1162699135 19:12500614-12500636 TGTGGCACACAGATTGCATTAGG + Intronic
1162766717 19:12924359-12924381 TGGGGTACAGGCATGGCAATGGG + Intronic
1162983367 19:14253729-14253751 TATGGATCACACATGGCTCTAGG - Intergenic
1164865499 19:31601157-31601179 AGAGGTACACTCATGGCACCGGG - Intergenic
1168487204 19:56773852-56773874 TGTGGTCCACAGATTGCATTTGG - Intergenic
1202677993 1_KI270711v1_random:24968-24990 TATGGTACAGACATGACACTTGG + Intergenic
1202711389 1_KI270714v1_random:21122-21144 TGGGGCACATAAATGGCACTCGG + Intergenic
925163448 2:1702468-1702490 TGGGGTTCACACATGTCACTGGG - Intronic
927852371 2:26507943-26507965 TGTGGTGCACACAGGGTCCTAGG + Intronic
939880919 2:147630414-147630436 TGTAGTACATAAATGGCACTCGG + Intergenic
941493577 2:166173239-166173261 TGTGTAACCCACATGCCACTTGG + Intergenic
943616082 2:190094292-190094314 TCTGGTACACTAAAGGCACTAGG - Intronic
944021830 2:195114621-195114643 GGTGGTTTACACATGGCATTGGG + Intergenic
944903709 2:204241809-204241831 AGTGGTACAAACATGGCTCATGG - Intergenic
946057213 2:216912639-216912661 AGTGGTACACACAAGACATTGGG + Intergenic
1169045825 20:2533778-2533800 TGTGCAACACACATGCCACGAGG + Intergenic
1169470168 20:5878220-5878242 TGTGCTACACACACAGGACTTGG + Intergenic
1169904654 20:10590074-10590096 TCTGGTACACAATAGGCACTCGG + Intronic
1170871735 20:20212497-20212519 TCTGGTGCACACCTGGCTCTTGG - Intronic
1173635971 20:44557865-44557887 TATGGTACAAACATGAGACTTGG + Intronic
1178880715 21:36448002-36448024 TGGGGCACACACATGGCACATGG + Intergenic
1180110618 21:45647093-45647115 TGTGGTACAGAGATGTCACATGG + Intronic
1184432777 22:44451212-44451234 TGTGGTGCACACAGAGCGCTTGG - Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
955110254 3:55942098-55942120 TGGGTTGCACAAATGGCACTGGG + Intronic
955596390 3:60595004-60595026 TGTGTTCCTCACATGCCACTGGG + Intronic
956203376 3:66730712-66730734 TGTGGTATACAGGTGGGACTTGG + Intergenic
956743992 3:72297184-72297206 TGTGGTCCACAGATCACACTTGG - Intergenic
959173744 3:102877278-102877300 TGGGGTACACAAATGGGACAAGG + Intergenic
966153135 3:176887671-176887693 TTGGGTACACACCTGGCAGTGGG - Intergenic
969967672 4:11013980-11014002 TGTGGGACCCTCATGGCTCTTGG + Intergenic
971272751 4:25166052-25166074 TATGGTACTCACATGGCAGAAGG - Intronic
971342337 4:25782047-25782069 TTTGCCACACACTTGGCACTTGG + Intronic
972640332 4:40919586-40919608 AATGGTACACACTTGGGACTGGG + Intronic
973650119 4:52990952-52990974 TGTGGAACACACCTGGCTGTAGG + Intronic
974941466 4:68474264-68474286 TGTGTTATACAAATGGGACTAGG + Intronic
979988011 4:127339288-127339310 TGTGTTACATAAATGGCATTTGG + Intergenic
981762306 4:148208073-148208095 TGTGTTCCACACATGGTTCTAGG - Intronic
982165143 4:152607415-152607437 TGTGGAACACAGATGCCAATGGG + Intergenic
982302310 4:153892239-153892261 TAGGGTCCACACATGCCACTTGG - Intergenic
983237781 4:165199338-165199360 TGTAGTACCCACCTGGCACTAGG + Intronic
983872873 4:172842479-172842501 TGTGGTGCATTCATAGCACTTGG - Intronic
984161984 4:176264011-176264033 TGTGGTAGACACTTGGAAATAGG - Intronic
985245103 4:187972295-187972317 TGTGAAAGGCACATGGCACTAGG - Intergenic
990328849 5:54705519-54705541 TGTGGCATACTCCTGGCACTTGG - Intergenic
992522109 5:77564993-77565015 TGTAGTACAATCATGGCAATGGG - Intronic
995314583 5:110753814-110753836 TGTGGTAAACACTTAGGACTGGG - Intronic
997263055 5:132478321-132478343 CGTGGTACACACGTGGTGCTTGG + Intergenic
998061813 5:139124802-139124824 TGTGCTTCACAGATGACACTTGG - Intronic
998506715 5:142678309-142678331 TGTGGTAAAGGCATGGCATTCGG + Intronic
998682295 5:144482421-144482443 TGTGCTGCACACAGGTCACTAGG + Exonic
998758230 5:145404002-145404024 TTTGGTACACACATTTCTCTTGG - Intergenic
1002535286 5:179872520-179872542 TGTGGCAGACACATGCCATTTGG + Intronic
1002668756 5:180847561-180847583 TCTGGCACACAAATGGCTCTTGG + Intergenic
1003728666 6:8794864-8794886 TGTGGTACATACAAGGCAGTAGG - Intergenic
1005262093 6:24072120-24072142 TGTGGTCCCCACATCACACTTGG + Intergenic
1005394779 6:25369989-25370011 GATGGTACACACATGGCAAAAGG - Intronic
1008205632 6:48653382-48653404 TGTAGTACCCATATGGCACCGGG - Intergenic
1009819007 6:68775342-68775364 TGGGGATCACACATGGCCCTTGG - Intronic
1016530472 6:145053692-145053714 TGTGGAACACAGATAGCTCTTGG + Intergenic
1017825152 6:158076274-158076296 TGTGGGCCAGACATGGCACCAGG + Intronic
1018396207 6:163379790-163379812 TGTGGTATAAACATGGCTCCTGG + Intergenic
1019665365 7:2249556-2249578 ACTGGTACACAGAGGGCACTGGG + Intronic
1019999932 7:4749884-4749906 TGTGGGACACACAGGTCGCTGGG - Intronic
1020824248 7:13007537-13007559 TGTGGTACACTCATGCCAAATGG - Intergenic
1022498974 7:30870915-30870937 TGGGGGGCACACATGGCCCTGGG - Intronic
1031040863 7:116837239-116837261 AGTGGTACACACCTGCTACTCGG + Intronic
1033304145 7:140212134-140212156 AGTGATTCATACATGGCACTTGG + Intergenic
1034078121 7:148251905-148251927 TGTGGTACGTATATGGAACTGGG - Intronic
1035902447 8:3471892-3471914 GTTAATACACACATGGCACTTGG + Intronic
1047211157 8:122841513-122841535 TCTTGTACATACAGGGCACTTGG + Intronic
1047319025 8:123761975-123761997 TGTGTTACACAGATGGCACCGGG - Intergenic
1055266930 9:74503969-74503991 TGTGGTTAACTAATGGCACTGGG + Intronic
1056512480 9:87319125-87319147 TGAAGTCCACACCTGGCACTGGG + Intergenic
1058464830 9:105216757-105216779 TGTGATACAGAAAGGGCACTGGG - Intergenic
1060511725 9:124239613-124239635 TGTGTCACGCACTTGGCACTTGG + Intergenic
1061676726 9:132221486-132221508 GCTGGCACACACATGGCACCTGG - Intronic
1186674868 X:11805600-11805622 TGTGTTACACACATGGTATTGGG - Intergenic
1190776721 X:53558577-53558599 TTTGGCATACACATGGCACCAGG - Intronic
1191773437 X:64786378-64786400 TGTGGGACAGACCTGGCACATGG - Intergenic
1199682490 X:150236559-150236581 TGAGATACAAACAGGGCACTTGG + Intergenic
1199871587 X:151903192-151903214 TGTGGTTCCCATGTGGCACTTGG + Intergenic
1200148772 X:153941444-153941466 CGTGGGTCACACATGGCCCTGGG + Intronic