ID: 1083782592

View in Genome Browser
Species Human (GRCh38)
Location 11:64925912-64925934
Sequence ACACCGCTGCCCCTGCTCAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083782587_1083782592 24 Left 1083782587 11:64925865-64925887 CCCACAGCTCCTCTCAGTTCCGC 0: 1
1: 0
2: 0
3: 15
4: 173
Right 1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 123
1083782589_1083782592 15 Left 1083782589 11:64925874-64925896 CCTCTCAGTTCCGCTATCAGAGC 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 123
1083782591_1083782592 -10 Left 1083782591 11:64925899-64925921 CCAGCAAGAGCTCACACCGCTGC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 123
1083782588_1083782592 23 Left 1083782588 11:64925866-64925888 CCACAGCTCCTCTCAGTTCCGCT 0: 1
1: 1
2: 1
3: 23
4: 266
Right 1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 123
1083782586_1083782592 29 Left 1083782586 11:64925860-64925882 CCGCTCCCACAGCTCCTCTCAGT 0: 1
1: 0
2: 2
3: 51
4: 587
Right 1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 123
1083782590_1083782592 5 Left 1083782590 11:64925884-64925906 CCGCTATCAGAGCAACCAGCAAG 0: 1
1: 0
2: 1
3: 5
4: 129
Right 1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG 0: 1
1: 0
2: 1
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083782592 Original CRISPR ACACCGCTGCCCCTGCTCAA AGG Exonic
900329583 1:2127401-2127423 CCACCGCCGCCCCTGCCCCACGG + Intronic
901220126 1:7578980-7579002 CCACCACTACCCCTGCTCCAGGG + Intronic
901303359 1:8215566-8215588 ACACCCCTGGCCCTGCCCAGGGG - Intergenic
901377236 1:8848132-8848154 ACACAGCTGCACCTGCTCTGCGG + Intergenic
902719169 1:18292675-18292697 ACACCGGTCCCTCTTCTCAAAGG + Intronic
904803141 1:33110979-33111001 ACACTGCAGCCTCTCCTCAAAGG - Intronic
907818192 1:57940650-57940672 ACACCAGTGCCACTGCTCCAGGG + Intronic
910431991 1:87167969-87167991 ACACCTCTGCCACCGCTCCATGG + Intronic
911151136 1:94597734-94597756 ACATTGCTGCCTCTGCTGAAGGG - Intergenic
912692600 1:111815634-111815656 ACACCTCTGACCCTGCTCCTTGG + Intronic
915064087 1:153210411-153210433 GCCCGGCTGCCCCTTCTCAAAGG - Intergenic
915479771 1:156176701-156176723 CCACCACTGACCCTGGTCAACGG - Exonic
916947012 1:169738991-169739013 ACACCACTGCCCCTGCTTCCCGG - Intronic
919738806 1:200970386-200970408 CCACCGCTGTCCCTTCCCAAGGG + Intronic
920286108 1:204881073-204881095 CCACCTCTGCCCCTGCCCCAGGG - Intronic
921138884 1:212286270-212286292 CACCCGCTGCCCCAGCTCAAAGG + Exonic
922350643 1:224732308-224732330 ACCCTGCTGGCCCTGGTCAATGG - Intronic
1064018066 10:11788037-11788059 ACAGAGCTGCACCTGCTCAGAGG + Intergenic
1068605367 10:58999489-58999511 AGAATGCTGCCCCTGCTCAAAGG + Intergenic
1069044058 10:63723943-63723965 ACACAGCTGCAGCTGCTCCAAGG + Intergenic
1070358002 10:75659135-75659157 GCACGTCTGCCCCTGCTCAAGGG + Intronic
1076445231 10:130509759-130509781 CCACACCTGCCCCTGCTCAGAGG - Intergenic
1076751309 10:132544807-132544829 ACACCGCCGGCCGTTCTCAAAGG - Intronic
1076788470 10:132763945-132763967 AGACGGATGCCCCTCCTCAAAGG - Intronic
1077425598 11:2474549-2474571 CCACCGCTGCCCCTCCCTAAGGG - Intronic
1077474418 11:2779625-2779647 ACGGCTCTGCCCCTGCTCCATGG + Intronic
1080739973 11:35054844-35054866 CCATCCCTGCCCCTGCTCCATGG + Intergenic
1083782592 11:64925912-64925934 ACACCGCTGCCCCTGCTCAAAGG + Exonic
1084421590 11:69063221-69063243 ACACCGCGGCCCCAGCTCGAAGG + Intronic
1087114700 11:94512653-94512675 ACACTGCTGGCCGTGCTCTAGGG - Intergenic
1087163795 11:94977456-94977478 ACACAGCTGCTCCTGCTTTAGGG + Intronic
1090666932 11:128920562-128920584 ACACCTCTGCCCATGCGCCATGG + Exonic
1090755090 11:129783594-129783616 CCACTGCTGCAACTGCTCAAAGG + Intergenic
1092053980 12:5493773-5493795 CCACCGCTGCTGCTGCTGAAGGG + Intronic
1092120786 12:6042309-6042331 ACAACCCTGCCCCTTCACAAGGG + Intronic
1094541153 12:31364238-31364260 ACACTGCTGGCCCAGCTCAGTGG + Intergenic
1095856144 12:46862877-46862899 ACACCTCTGTCATTGCTCAATGG - Intergenic
1101195829 12:102381251-102381273 ACACCACTGCACCTGGCCAATGG - Intergenic
1101739089 12:107486168-107486190 ACTCCCCTGCCCCTGCAGAAGGG - Intronic
1103526897 12:121575204-121575226 CCTCCCCTGCCCCTGCCCAAGGG + Intronic
1106218263 13:27722154-27722176 ACACAGCTGCCTCTGCTCAGTGG + Intergenic
1109007810 13:56901052-56901074 ACAGCACTGCCCCTGCTCCACGG + Intergenic
1110948064 13:81449359-81449381 ACATCGCCTCCACTGCTCAATGG + Intergenic
1112442373 13:99433712-99433734 ACAGCACTCCACCTGCTCAATGG - Intergenic
1113396791 13:109955445-109955467 ACACTCCTGCCACTGCACAAGGG + Intergenic
1117283500 14:54263927-54263949 ACCCTGCTGCCCCTCCTCACTGG - Intergenic
1118186022 14:63539528-63539550 ACACCTCTGCCGCTGCTAAAAGG - Exonic
1122598006 14:102907025-102907047 ACACCTCTGCACCTGCTGAGGGG + Exonic
1123499331 15:20866173-20866195 CCACCGCTTCCCCTGCTGCAGGG - Exonic
1123556584 15:21439903-21439925 CCACCGCTTCCCCTGCTGCAGGG - Exonic
1123592805 15:21877138-21877160 CCACCGCTTCCCCTGCTGCAGGG - Intergenic
1123768782 15:23508585-23508607 CCACTGCTGCCACTGCTCAGAGG + Intergenic
1130202317 15:81843328-81843350 ACAGCAGTGCCCCTGCCCAATGG - Intergenic
1202964924 15_KI270727v1_random:167092-167114 CCACCGCTTCCCCTGCTGCAGGG - Intergenic
1135132734 16:19866304-19866326 AAACCGTTGCCCCTGGGCAAAGG + Intronic
1136747697 16:32606466-32606488 ATTCCTCAGCCCCTGCTCAAGGG + Intergenic
1203049831 16_KI270728v1_random:865675-865697 ATTCCTCAGCCCCTGCTCAAGGG + Intergenic
1142701118 17:1661563-1661585 CCACCACTGCCCCTGCCCCAGGG + Intronic
1143390326 17:6556151-6556173 ACACCGCGTCCCCTTCTCCACGG - Intronic
1145737758 17:27244938-27244960 ACTCAGCTGCCCCTGCTCTGTGG - Intergenic
1150549020 17:66192050-66192072 CCACCGCCGCCCCTGCCAAACGG + Intronic
1154457393 18:14543038-14543060 CCACCGCTTCCCCTGCTGCAAGG - Exonic
1157559248 18:48634767-48634789 ACACCGTTGCCACTTCTCTAGGG + Intronic
1161384469 19:3983634-3983656 TCACTTCTGCCCCTGCTCCAGGG + Intronic
1162447128 19:10730390-10730412 CCACCGCTACCCTAGCTCAAGGG - Intronic
1167262882 19:48469032-48469054 CCACCTCTGCGCCTGCTCAAAGG - Exonic
1167736176 19:51295860-51295882 ACAGCCCTGGCCCTGCTCGAAGG - Intergenic
1168161797 19:54515319-54515341 ACCCCGCTCACCCTGCTCCAAGG - Intergenic
925772636 2:7298219-7298241 CCACCCCTGTCACTGCTCAATGG - Intergenic
926036209 2:9637899-9637921 ACAGAGCTGCTCCTGCTGAAGGG - Intergenic
926584883 2:14675065-14675087 ACCCCCCCGCCCCTGCTCCAGGG + Intergenic
927522404 2:23707254-23707276 AGACCGCTGTCCCTGCTCCCCGG - Exonic
927812496 2:26187740-26187762 ACTGCCCTGCCCCAGCTCAAAGG - Exonic
927967764 2:27282252-27282274 TCACCCCTGCCCTTGCTCAAGGG + Intergenic
929588613 2:43131285-43131307 TCACCGAGGCCCCTGCTCAGGGG + Intergenic
932750702 2:74369872-74369894 TCACCGCACACCCTGCTCAAAGG + Intronic
933658284 2:84906389-84906411 ACTCCGCTTCTCCTGCTCAATGG - Exonic
934949152 2:98564528-98564550 CCTCTGCTGCCACTGCTCAAAGG - Intronic
940912855 2:159224382-159224404 TCACCGCTCCTCCTGCTCAATGG - Intronic
944984364 2:205158519-205158541 AAACCTCTTCCCCTGCTCCATGG + Intronic
947736890 2:232459755-232459777 ACACCCCTGCACCTGACCAAGGG + Exonic
1170398669 20:15956646-15956668 ACACCGCTGCTGCTGTTCCAGGG - Intronic
1172275322 20:33676064-33676086 GGACCCCTGCCCTTGCTCAAGGG + Exonic
1176816766 21:13610315-13610337 CCACCGCTTCCCCTGCTGCAGGG + Exonic
1179224539 21:39442278-39442300 AAACCGCTGGCCCTTCTCACTGG - Intronic
1181854812 22:25774247-25774269 CCACCGCTGTCCATGGTCAAGGG + Intronic
1182298929 22:29327332-29327354 CCACGGCTGCCCCTGATCAGGGG + Intergenic
1183279954 22:36926661-36926683 ACACCGGGGCCCCTCCTCCAGGG - Intronic
1183830576 22:40416564-40416586 ACACAGCTGCCCCTGCTCACAGG + Intronic
1185018034 22:48357059-48357081 CCACAGATGCCCCTGCTCAGGGG + Intergenic
949192528 3:1267257-1267279 ATACCACTTTCCCTGCTCAATGG - Intronic
953146912 3:40286008-40286030 CCCCCGCTGCCCCTGCTTCATGG - Intergenic
954289844 3:49643845-49643867 TCTCCGCAGCCCCTGCTCCAGGG + Intronic
954314786 3:49795276-49795298 CCACAGCTGGCCCTGCTCAAAGG + Exonic
962316597 3:134363384-134363406 ACCTGGCTGCCCCTCCTCAATGG - Intronic
966748298 3:183299078-183299100 AAACCGCTGCTCCTGCTGACTGG + Intronic
967359225 3:188610463-188610485 ATACTGCAGCCCCTTCTCAAAGG - Intronic
969507619 4:7597904-7597926 ACACCAGTTCCCCTCCTCAATGG - Intronic
975575545 4:75858875-75858897 AAACCAATGTCCCTGCTCAAAGG - Intergenic
984727545 4:183036127-183036149 ACACTGGTGCCCCTGCTCAGAGG - Intergenic
985922374 5:2987619-2987641 AAACTGATGCCCCAGCTCAAAGG - Intergenic
985947345 5:3196440-3196462 CCACCGCAGCCCCTGCTCTATGG - Intergenic
995192129 5:109329141-109329163 ACACCATAGCCCCTGCTAAAGGG - Intergenic
997418085 5:133744534-133744556 TCACAGCTGCCTCTGCTCAATGG - Intergenic
998776471 5:145609472-145609494 CAACTGCTGCCCCTGCTTAAGGG - Intronic
1002423484 5:179162599-179162621 ACACGGTCGCCCCTGCTCGAGGG + Intronic
1002897123 6:1385800-1385822 CCACCCCTGCCCCAGCGCAAGGG - Intergenic
1003465499 6:6376528-6376550 ACACCCCTGCTCCTGCTGCATGG - Intergenic
1004167445 6:13269479-13269501 ACACAGCTGGCCCTTGTCAATGG + Intronic
1010062278 6:71636532-71636554 ACACAGCTGCTCCTGCTCCAGGG + Intergenic
1011680155 6:89775530-89775552 ACACCAGTGCCACTGCTGAAAGG + Intronic
1011834312 6:91411658-91411680 ACACCCTTGCCCCTGCCCATAGG - Intergenic
1014310496 6:119794501-119794523 ACACTGCTGTACCTGCACAAAGG + Intergenic
1015595184 6:134859546-134859568 ACACTCCTGCCCCTCCACAATGG - Intergenic
1016335784 6:143003424-143003446 CCACCCCTGCCCCTCCTCAGTGG - Intergenic
1017043764 6:150328238-150328260 ACACTGATGTCCCAGCTCAAGGG + Intergenic
1017282965 6:152643194-152643216 TCACAGCTGCCCTTGCTCAGAGG + Intergenic
1017452304 6:154565443-154565465 ACAGCTCTGACCCTGCTCATGGG + Intergenic
1017608273 6:156156396-156156418 ACACAGCTGCCACTCCTCAAAGG + Intergenic
1017878682 6:158544707-158544729 TCACCCCCTCCCCTGCTCAATGG + Intronic
1019644302 7:2120915-2120937 TCACCCCTGCACCTGCTCTAGGG + Intronic
1022750136 7:33215995-33216017 ACAACCCTTCCCCTGCTGAATGG - Intronic
1023266926 7:38416364-38416386 CCAATGCTGCCCCTGCTCATGGG + Intronic
1026486866 7:70829430-70829452 AAACCGCTGCCTCTGTTCAGGGG + Intergenic
1029169093 7:98618083-98618105 ACACCGCTGCTCTTGCTGGAAGG + Intronic
1029582475 7:101446475-101446497 ACACAGCTGTCACTGCCCAAGGG + Intronic
1033566230 7:142580842-142580864 CCATCTCTGTCCCTGCTCAAAGG - Intergenic
1034489481 7:151385717-151385739 TCACTGCTCCCCCTGCTCATGGG + Intronic
1037588456 8:20294386-20294408 CCGCAGCTGGCCCTGCTCAAAGG - Intronic
1040532633 8:48277730-48277752 ACACCTTTGCCCCTCCCCAAGGG + Intergenic
1049914280 9:301597-301619 ACACTGCAGACCCTGCTAAAAGG + Intronic
1052786424 9:32832314-32832336 ACTCCTCTGCCCTTGCACAAGGG + Intergenic
1061196228 9:129108574-129108596 CCACCCCTGCCCCATCTCAAAGG - Intronic
1061412644 9:130429711-130429733 ACACCGCTGCAGCTGCCCCAGGG + Intronic
1203530595 Un_GL000213v1:139179-139201 CCACCGCTTCCCCTGCTGCAGGG - Intergenic
1186786293 X:12959163-12959185 TCACTGCTGCCCCTGCTTGAGGG + Intergenic
1193687203 X:84591964-84591986 CCACAGCTGCCCCTCCTCACAGG - Intergenic
1197378128 X:125707482-125707504 ACCCCGCTGCCACTGTTCCAAGG + Intergenic
1200375305 X:155774143-155774165 GCACCACTGCCTCTGATCAAAGG + Exonic
1200700840 Y:6401169-6401191 ACACCGCTGACACTTCTCCACGG + Intergenic
1201033272 Y:9763529-9763551 ACACCGCTGACACTTCTCCACGG - Intergenic