ID: 1083783785

View in Genome Browser
Species Human (GRCh38)
Location 11:64932295-64932317
Sequence CAGAACATGAGTTAGTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083783785_1083783791 28 Left 1083783785 11:64932295-64932317 CCAGCTAACTAACTCATGTTCTG 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1083783791 11:64932346-64932368 TCTTATGGGCCATAACCCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1083783785_1083783786 13 Left 1083783785 11:64932295-64932317 CCAGCTAACTAACTCATGTTCTG 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1083783786 11:64932331-64932353 CAGACTTCCTCCCGTTCTTATGG 0: 1
1: 0
2: 1
3: 8
4: 94
1083783785_1083783787 14 Left 1083783785 11:64932295-64932317 CCAGCTAACTAACTCATGTTCTG 0: 1
1: 0
2: 0
3: 3
4: 113
Right 1083783787 11:64932332-64932354 AGACTTCCTCCCGTTCTTATGGG 0: 1
1: 0
2: 1
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083783785 Original CRISPR CAGAACATGAGTTAGTTAGC TGG (reversed) Intronic
905685673 1:39905880-39905902 CAGAGCATGAGTGAGGTAGGGGG - Intergenic
909833859 1:80229432-80229454 GTGAACAAGAGTCAGTTAGCAGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919010461 1:191954715-191954737 CAAAATATGTGTTAATTAGCTGG + Intergenic
919088272 1:192947605-192947627 CATAACAGGAGTTACTTACCTGG + Intergenic
920131525 1:203735792-203735814 CAGAACAGAAGCTAGTTAGAAGG - Intronic
921887245 1:220319498-220319520 AAGAACATGAGTTTGCTAGGGGG + Intergenic
1066183272 10:32984010-32984032 AATAAGATGAGTTATTTAGCTGG - Intronic
1072937327 10:99725855-99725877 AAGAAAATGAGTCAGTTAGAAGG - Intronic
1073916810 10:108414657-108414679 TAGATAATGAGTTAGTTAGTGGG + Intergenic
1075665181 10:124224681-124224703 CAGAAGCTGAGTGAGTGAGCTGG + Intergenic
1075915700 10:126165020-126165042 CAGACCATGAGTTCTTTACCAGG - Intronic
1080849906 11:36059202-36059224 CAGAAAATGAGAAAATTAGCTGG + Intronic
1083783785 11:64932295-64932317 CAGAACATGAGTTAGTTAGCTGG - Intronic
1094457622 12:30655554-30655576 AAGAACAGAATTTAGTTAGCAGG - Intronic
1096763542 12:53863697-53863719 CAGAAAATGAGTTGGTTATCTGG + Intergenic
1101205213 12:102480401-102480423 CTGAAAATGAATTGGTTAGCAGG + Exonic
1101300285 12:103472609-103472631 CAGAGCATGAGAAAATTAGCTGG + Intronic
1102486752 12:113263699-113263721 CAGAGGATGAGTGAGTTAACAGG - Intronic
1107125927 13:36846503-36846525 CAGAGGATAAGTTAGATAGCTGG + Exonic
1107139935 13:36987512-36987534 GAGAACAGGAGCAAGTTAGCGGG - Intronic
1111834975 13:93376987-93377009 CAGAACATAAATTATTTAGTGGG - Intronic
1114779155 14:25519074-25519096 CTGAACATGTGTTAGGTAACAGG + Intergenic
1115707818 14:36016085-36016107 CAGAACATTTGTTATTTAACTGG + Intergenic
1116876234 14:50114904-50114926 CAGTACATGGTTTAGTTAACAGG - Intronic
1117649969 14:57893638-57893660 CAGGACATGAGTTACAAAGCAGG - Intronic
1118216174 14:63810597-63810619 CAGAACAAGAGTTAATTACATGG + Intergenic
1202880405 14_KI270722v1_random:53380-53402 CAGAACAAGATTTAGTTACATGG + Intergenic
1131699175 15:94915332-94915354 CTGAACATGAGTCAGTCTGCAGG + Intergenic
1137861754 16:51854007-51854029 CAGAACATGATTTTGGTGGCAGG + Intergenic
1140428276 16:74879510-74879532 TAGAACAAGAATTACTTAGCAGG + Intronic
1141678980 16:85532980-85533002 CAGAACAGGAGGTAGGGAGCGGG - Intergenic
1143992478 17:10978023-10978045 CAGAACATGAGCTATGTAGTGGG - Intergenic
1144759152 17:17697558-17697580 CTGAACATGATTTATTTATCTGG + Intronic
1145284202 17:21492404-21492426 CAGAACAAGAGTTAATTACATGG + Intergenic
1145393249 17:22473120-22473142 CAGAACAAGAGTTAATTACATGG - Intergenic
1145821863 17:27844175-27844197 CAGAACAAGAGTTAATTATATGG + Intronic
1149423250 17:56530931-56530953 TAGAAGATGTGTTAGTTATCTGG - Intergenic
1149981568 17:61315413-61315435 CAGAACAGGAGTGCGTTGGCTGG - Intronic
1153435818 18:5066921-5066943 CAGAACAGGAATTAATTAGAAGG - Intergenic
1202656014 1_KI270708v1_random:22480-22502 CAGAACAAGATTTAGTTACATGG + Intergenic
928667078 2:33560243-33560265 CAGAAAATAAATTAGTTGGCTGG - Intronic
932143844 2:69302012-69302034 TAGGAAATGAGTTATTTAGCTGG - Intergenic
933269949 2:80222620-80222642 CAATACATAAATTAGTTAGCTGG + Intronic
941722355 2:168825301-168825323 CAGATCATGAGTTGCATAGCTGG + Intronic
943009461 2:182429649-182429671 CACAAAATGAGTTGGTTAGATGG - Intronic
1169420675 20:5456653-5456675 CAGAACAAGAGTTAATTACATGG - Intergenic
1169865836 20:10198847-10198869 CAGAACTTGACTTAGAAAGCTGG - Intergenic
1170406096 20:16038987-16039009 AAAAACCTGAGGTAGTTAGCAGG + Intronic
1170443232 20:16399398-16399420 CAGAGCATGATTTAGTGAACAGG - Intronic
1170600259 20:17836263-17836285 GAGAACATGAGATGGTTAGGAGG - Intergenic
1172124295 20:32616174-32616196 CAAAACATGAAAAAGTTAGCTGG + Intergenic
1175111210 20:56649385-56649407 CAAAACATAAAATAGTTAGCTGG - Intergenic
1176641727 21:9310930-9310952 CAGAACAAGATTTAGTTACATGG + Intergenic
1180350742 22:11800287-11800309 CAGAACAAGATTTAGTTACATGG + Intergenic
1180375017 22:12083683-12083705 CAGAACAAGATTTAGTTACATGG + Intergenic
1180387467 22:12191789-12191811 CAGAACAAGATTTAGTTACATGG - Intergenic
1183249715 22:36721622-36721644 CAGAACATGCCTTATGTAGCCGG - Intergenic
953316202 3:41928971-41928993 CATAAAATGAGTTAGTAAGCAGG - Intronic
956330612 3:68102913-68102935 CAGAACATGATTTGGGTAGGAGG - Intronic
957098412 3:75799727-75799749 CAGAACAAGATTTAGTTACATGG - Intergenic
960117326 3:113909530-113909552 CAGAACTTGAGTTAATGACCAGG + Intronic
960640873 3:119821491-119821513 CACAACATGTGTTGGTTACCTGG + Intronic
961691535 3:128673660-128673682 CAAAACAAAAGTTAGCTAGCTGG - Intronic
968333521 3:197892875-197892897 CAGAACAGTAGTTACTTACCTGG + Intronic
1202745167 3_GL000221v1_random:94088-94110 CAGAACAAGATTTAGTTACATGG - Intergenic
968961173 4:3744453-3744475 CAGAACCTGGGGTAGGTAGCCGG + Intergenic
969874943 4:10129345-10129367 AAGAACATGAGTCAGTGGGCTGG - Intergenic
970423326 4:15924984-15925006 AAAAACATGAATGAGTTAGCTGG - Intergenic
971685370 4:29759018-29759040 CAGAAAATGAGATAATGAGCTGG - Intergenic
973072334 4:45878522-45878544 CAGAATATGACTTTGATAGCTGG + Intergenic
975052026 4:69877455-69877477 CAGAACATCACTTTTTTAGCTGG - Intergenic
978272483 4:106907565-106907587 ATAAACATGAGTTAATTAGCAGG - Intergenic
980437665 4:132799649-132799671 CAGAACATGAGTTAATTTCTGGG - Intergenic
982869710 4:160562930-160562952 CAGTACCTGTGTTAGTTAGTTGG - Intergenic
983501558 4:168505316-168505338 CAAAATATGAGTTAATAAGCAGG + Intronic
983552372 4:169031190-169031212 CAGATAATGAGGTAGTTAGATGG - Intergenic
1202756604 4_GL000008v2_random:69132-69154 CAGAACAAGATTTAGTTACATGG + Intergenic
986880413 5:12163074-12163096 CAAAACAAGAGTTAGTTATGTGG + Intergenic
988770071 5:34424125-34424147 CAGAACAGGAGTTAGTTACATGG + Intergenic
989716829 5:44473459-44473481 CAGAACAAGAGTTAATTATATGG - Intergenic
992022974 5:72643155-72643177 CAGAACCTGAGTTCCTTACCAGG - Intergenic
994343762 5:98661991-98662013 CAGAACTTGAGTTTCTCAGCAGG + Intergenic
995443991 5:112222719-112222741 CAGCAGATGAGTCAGTTATCTGG - Intronic
1001520220 5:172385977-172385999 CAGAACAGGACTGAGTTTGCTGG - Intronic
1001588389 5:172849005-172849027 CAGAACAGGAGTAAGGCAGCCGG + Intronic
1007198618 6:40085766-40085788 CAGCACAGGAGTTGGTTAACAGG - Intergenic
1009764297 6:68049245-68049267 CAAAACCTCAGTTAGATAGCAGG + Intergenic
1012412390 6:98973716-98973738 CAGATAATGAGTTAGTTTCCTGG + Intergenic
1014502925 6:122214841-122214863 CAGTACATGTATTAGTTTGCTGG - Intergenic
1016519599 6:144931664-144931686 CAGACCCTGATTTGGTTAGCAGG + Intergenic
1017118308 6:150999936-150999958 CAGAACATGAGGAAGTTACTGGG - Intronic
1017852386 6:158315990-158316012 CAGAATATGAGTTACTTCTCAGG - Intronic
1025280474 7:57623349-57623371 CAGGAAATGAGTGAGTTTGCAGG - Intergenic
1025304257 7:57842158-57842180 CAGGAAATGAGTGAGTTTGCAGG + Intergenic
1028253762 7:88566740-88566762 CAGAAAATGAATTAATTAGAAGG - Intergenic
1031253377 7:119415970-119415992 CAGCACAAGGATTAGTTAGCAGG - Intergenic
1034245304 7:149639580-149639602 CTGAACAGGAGTTATTTTGCTGG - Intergenic
1034736686 7:153435332-153435354 CAGAACATGATCTAGTCTGCGGG - Intergenic
1036031899 8:4983207-4983229 CAGTACATGAGTCAATAAGCAGG + Intronic
1039959191 8:42232557-42232579 CAGAACAAGAATTAATTACCTGG - Intergenic
1040085721 8:43338693-43338715 CAGACCATGAGTTAGTAAATTGG - Intergenic
1044800689 8:95951471-95951493 CAGAACATGTGTTAGAGAGGGGG - Intergenic
1045281592 8:100754187-100754209 CAGAAAATGAATCAGTTAGTGGG - Intergenic
1056952717 9:91057137-91057159 CAGAAAATGAGTCAGAGAGCAGG + Intergenic
1058529657 9:105893162-105893184 CAGCACATAAGCTAGGTAGCTGG + Intergenic
1060259088 9:122058047-122058069 CAGAGCATGAGTTATTCTGCTGG + Intronic
1203713791 Un_KI270742v1:124038-124060 CAGAACAAGATTTAGTTACATGG - Intergenic
1203537401 Un_KI270743v1:53986-54008 CAGAACAAGATTTAGTTACATGG + Intergenic
1185543198 X:920555-920577 CAGAACATGAGGCAGGGAGCCGG - Intergenic
1186428154 X:9481231-9481253 CAGAACAGGAGTTAATTACATGG + Intronic
1187079153 X:15967792-15967814 CAGAATATGAGTTAATTACATGG - Intergenic
1189864038 X:45305423-45305445 CAGAACAGGAGTTAGTTGCAAGG + Intergenic
1189951690 X:46238756-46238778 CAGAACTTGAGTTAATGACCAGG + Intergenic
1192309153 X:69995552-69995574 CAGAACATGACTTCATTAGAGGG - Intronic
1197972201 X:132126611-132126633 CAGTACCTGAATTAGTGAGCTGG - Intronic
1198439576 X:136649588-136649610 CAAAACAAGATTCAGTTAGCTGG - Intronic