ID: 1083785088

View in Genome Browser
Species Human (GRCh38)
Location 11:64940357-64940379
Sequence CAGAAGGAGTGAAGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1990
Summary {0: 1, 1: 2, 2: 4, 3: 115, 4: 1868}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083785088_1083785101 10 Left 1083785088 11:64940357-64940379 CCTACCTCCCTTCACTCCTTCTG 0: 1
1: 2
2: 4
3: 115
4: 1868
Right 1083785101 11:64940390-64940412 GGCTTCTATTACTCTAGGACAGG 0: 1
1: 0
2: 0
3: 8
4: 61
1083785088_1083785100 5 Left 1083785088 11:64940357-64940379 CCTACCTCCCTTCACTCCTTCTG 0: 1
1: 2
2: 4
3: 115
4: 1868
Right 1083785100 11:64940385-64940407 TGGGGGGCTTCTATTACTCTAGG 0: 1
1: 0
2: 0
3: 4
4: 86
1083785088_1083785103 29 Left 1083785088 11:64940357-64940379 CCTACCTCCCTTCACTCCTTCTG 0: 1
1: 2
2: 4
3: 115
4: 1868
Right 1083785103 11:64940409-64940431 CAGGCCCCCAGACCAGAGGATGG 0: 1
1: 0
2: 4
3: 32
4: 317
1083785088_1083785102 25 Left 1083785088 11:64940357-64940379 CCTACCTCCCTTCACTCCTTCTG 0: 1
1: 2
2: 4
3: 115
4: 1868
Right 1083785102 11:64940405-64940427 AGGACAGGCCCCCAGACCAGAGG 0: 1
1: 0
2: 1
3: 32
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083785088 Original CRISPR CAGAAGGAGTGAAGGGAGGT AGG (reversed) Intronic
900084954 1:888451-888473 GAGAAGGAGAGAAGGAAGGAAGG + Intergenic
900174703 1:1286552-1286574 CAGAAGGAGGGAAGGTGGGAGGG + Intronic
900503111 1:3016309-3016331 CAGAAGGAAAGAAGAGAGGGAGG + Intergenic
900725536 1:4214149-4214171 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
900892310 1:5458381-5458403 GGGAAGGAGGGAAGGGAGGAAGG - Intergenic
901125646 1:6926679-6926701 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
901155869 1:7137815-7137837 GAGATGGAGAGAAGGGATGTGGG - Intronic
901276462 1:7995232-7995254 AGGAAGGAGGGAAGGGAGGGAGG - Intergenic
901315973 1:8308605-8308627 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
901479662 1:9516188-9516210 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
901497804 1:9631976-9631998 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
901690129 1:10967400-10967422 CACAAGGACTGAAAGGAGGCAGG - Intronic
901938570 1:12644934-12644956 GAGAAGGAGGGAAGGAAGGGAGG - Intronic
901938604 1:12645061-12645083 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
901938663 1:12645294-12645316 CAAAAGGAGGGAAGGAAGGAAGG - Intronic
901961440 1:12829364-12829386 GAGAATGAGAGAAGGGAGGCAGG - Intronic
901968028 1:12883971-12883993 GAGAATGAGAGAAGGGAGGCAGG - Intronic
901989514 1:13101312-13101334 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
901992299 1:13125452-13125474 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
902017148 1:13317809-13317831 GAGAATGAGAGAAGGGAGGCAGG + Intronic
902214624 1:14926554-14926576 CAGAAAGGGTGAAGGGCAGTAGG - Intronic
902515229 1:16986417-16986439 CAGCGGGAGAGAAGGGAGGTGGG - Intronic
902553826 1:17235187-17235209 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902699834 1:18164311-18164333 CAGAAGGAAGGAAGAGAGGGAGG - Intronic
902746553 1:18478545-18478567 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
902750297 1:18503885-18503907 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
902759016 1:18568725-18568747 GAGAAGGAGGGAAGGGAGGAAGG + Intergenic
902769124 1:18635492-18635514 AAGAAGGAAGGAAGGAAGGTAGG + Intronic
902927138 1:19703473-19703495 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
903323565 1:22556525-22556547 AAGGAGGAGTGAGGGGTGGTGGG + Intergenic
903359946 1:22770752-22770774 AGGAAGGGATGAAGGGAGGTTGG + Intronic
903480887 1:23652471-23652493 CGGGAGGACTGAAGGGAGGAGGG + Intergenic
903655417 1:24946381-24946403 AGGAAGGAGAGAAGGGAGGGAGG - Intronic
903690018 1:25166892-25166914 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
903690047 1:25166964-25166986 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
903905422 1:26682428-26682450 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
903954446 1:27015405-27015427 AAGATGGAGTGAAGCGAGATGGG - Intergenic
904045094 1:27603946-27603968 CAGGAGGAGGGAGGGGAGGAGGG - Intronic
904401162 1:30257651-30257673 CAGGTGGAGTGAGGGCAGGTGGG - Intergenic
904455009 1:30642289-30642311 CAGGTGGAGTGAGGGCAGGTGGG - Intergenic
904497615 1:30895904-30895926 GAGATGGAGAGGAGGGAGGTTGG + Intronic
904562521 1:31408328-31408350 GAGATGGAATGAAGGGAGGGAGG - Intergenic
904563201 1:31412462-31412484 CAGATGGAGAGAAGGGAGGATGG + Intronic
904565964 1:31428666-31428688 CAGACGGAGAGCAGGGAGGAGGG + Intronic
904591803 1:31619128-31619150 CAGAGGGAGAGGAGGGAGCTTGG - Exonic
904619259 1:31765626-31765648 CAGAAGGAGGGAAAAGAGGGCGG - Intergenic
904653646 1:32025718-32025740 AGGAAGGAGGGAAGGGAGGGAGG - Intronic
905258374 1:36700323-36700345 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
905363973 1:37438767-37438789 GAGAAGGAGGGAAGCAAGGTGGG + Intergenic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
905396443 1:37669643-37669665 CAGAGGGAGGGAAGGAAGGAAGG - Intergenic
905396458 1:37669713-37669735 CAGAGGGAGGGAAGGAAGGAAGG - Intergenic
905421699 1:37850502-37850524 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
905499460 1:38425407-38425429 CAGAGTCAGTGAAGGGAGATAGG - Intergenic
905929421 1:41776840-41776862 CTGTAAGAGTGAAGGGAGGGAGG - Intronic
905933738 1:41807445-41807467 CAGAGGGAGTGAGGGAAGGAGGG + Intronic
906818759 1:48906649-48906671 CAGATGGAGCGAGGGGAGCTAGG + Intronic
907193201 1:52665702-52665724 AAGAAGGATGGGAGGGAGGTGGG - Intronic
907437488 1:54458945-54458967 AGGAAGGAGGGAAGGAAGGTGGG + Intergenic
907492866 1:54820072-54820094 AAGAAGGAGGGAAGGAAGGAAGG - Intronic
907719227 1:56956003-56956025 CAGAAGGAAGGAAGGAAGGTAGG - Intronic
908017473 1:59858753-59858775 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
908434531 1:64092140-64092162 AAGAAGGGAGGAAGGGAGGTAGG - Intronic
908613308 1:65887308-65887330 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
908647116 1:66290190-66290212 TAGAAGGGGTGAAGGGCAGTGGG + Intronic
909419179 1:75444335-75444357 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
909692102 1:78420846-78420868 AGGAAGGAGGGAAGGGAGGGAGG - Intronic
909692164 1:78421067-78421089 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
909837713 1:80277360-80277382 CAGAAGAAGCAAAGAGAGGTGGG - Intergenic
909972093 1:82002873-82002895 CAGAACGAGGGAAGGGAAATAGG + Intergenic
910049040 1:82955605-82955627 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
910058798 1:83063897-83063919 CAGAAGGAAGGCAGGGAGGGAGG - Intergenic
910521280 1:88124782-88124804 AGGAAGGAGTGAAGGAAGGTGGG + Intergenic
910535689 1:88295106-88295128 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
910554634 1:88517721-88517743 GAGAAGGAGAGAAGGAAGGAAGG + Intergenic
910734907 1:90442955-90442977 CAGAAGGAAAGGAGGGAGGGAGG + Intergenic
910757660 1:90709293-90709315 AGGAAGGAGAGAAGGGAGGGAGG + Intergenic
910851348 1:91652151-91652173 CACCCGGTGTGAAGGGAGGTGGG + Intergenic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911236676 1:95419746-95419768 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
911254139 1:95614825-95614847 AAGAATGAGAGAAGGGAGGAAGG - Intergenic
911559460 1:99386076-99386098 CAGTAGGAGATAAGAGAGGTTGG + Intergenic
911642695 1:100305975-100305997 CAGAAAGAGTGAGAGAAGGTGGG - Intergenic
911824623 1:102465993-102466015 CAGAAGGTGTGAAGGGTTGATGG + Intergenic
911939578 1:104024610-104024632 GAGAAGGAAGGAAGGGAGGAAGG - Intergenic
912214618 1:107594144-107594166 CAAAAGGAGAGAAGGGGTGTAGG - Intronic
912355081 1:109048391-109048413 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912556081 1:110517132-110517154 AGGAAGGAATGAAGGGAGGAAGG + Intergenic
912557149 1:110524585-110524607 GTGAAGGACTGAAGGAAGGTGGG + Intergenic
912562972 1:110563527-110563549 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
912593766 1:110853504-110853526 AAGAAGATCTGAAGGGAGGTAGG - Intergenic
912631006 1:111246784-111246806 GGGAAGGAGTGGAAGGAGGTGGG + Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912832716 1:112967928-112967950 CAGAGGGAGGGTAGGGAGGAAGG - Intergenic
912865040 1:113249034-113249056 AAGAAGGAATGAAGGAAGGAGGG - Intergenic
912880155 1:113404092-113404114 CAGCAGCAGTTATGGGAGGTGGG - Intronic
913010421 1:114677765-114677787 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
913057776 1:115178214-115178236 CAGAAGGAGAAAAGGAAGGAAGG - Intergenic
913167373 1:116200515-116200537 AAGAAGGAATGAAAGGAGGAAGG - Intergenic
913172386 1:116244457-116244479 AAGAAAGAGTAAAGGGAGATAGG - Intergenic
913678352 1:121164238-121164260 AATACGGAGTGAGGGGAGGTAGG - Intergenic
913705573 1:121418915-121418937 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
913708176 1:121449370-121449392 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
913993158 1:143634159-143634181 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
914030191 1:143951876-143951898 AATACGGAGTGAGGGGAGGTAGG - Intronic
914159259 1:145116075-145116097 AATACGGAGTGAGGGGAGGTAGG + Intergenic
914264485 1:146026841-146026863 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
914373299 1:147050466-147050488 CGGAAGGAAGGAAGGGAGGGAGG + Intergenic
914503243 1:148265529-148265551 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
915080825 1:153350561-153350583 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
915310119 1:155002382-155002404 AAGAAGGAGGGAAAGGAGGAGGG + Intergenic
915330492 1:155108822-155108844 AAGAAAGAGAGAAGGGAGGAAGG - Intergenic
915466511 1:156101625-156101647 CGGAAGGAAGGAAGGGAGGGAGG + Intronic
915483469 1:156203664-156203686 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
915532166 1:156508956-156508978 CATCAGCAGTGGAGGGAGGTGGG + Intergenic
915940980 1:160117945-160117967 AGGGAGGAGTGGAGGGAGGTTGG + Intronic
916203518 1:162294154-162294176 AAGAAGGAAGGAAGGCAGGTAGG + Intronic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916285937 1:163105122-163105144 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
916339271 1:163710800-163710822 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
916593359 1:166215986-166216008 CAAAAGGAGGGAAGGTAGGAGGG - Intergenic
916628003 1:166580442-166580464 CAGGAAGAGTGAGAGGAGGTTGG - Intergenic
916672770 1:167038569-167038591 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
916681011 1:167105130-167105152 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
916689535 1:167177170-167177192 AAGAAGGAAAGAAGGGAGGGAGG - Intergenic
916722639 1:167496206-167496228 CAGAAGGAAGGAAGGTAGGTAGG + Intronic
916816310 1:168356598-168356620 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
916862367 1:168819838-168819860 CGGAAGGAGGGAAGGAAGGAGGG + Intergenic
917036063 1:170748174-170748196 GAGTAGGAGGGAAGGGAGGGAGG - Intergenic
917203700 1:172545872-172545894 CAGAAGGACGGAAGGCAGGCAGG - Intronic
917600695 1:176570915-176570937 CAGCAGCAGTGTAGGGAGGCAGG - Intronic
917636258 1:176939848-176939870 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
917739734 1:177950959-177950981 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
918105967 1:181415489-181415511 GAGAAGGAGTAGAAGGAGGTGGG + Intronic
918362523 1:183773196-183773218 AAGAAGGAAAGAAGGGAGGGAGG - Intronic
918469923 1:184861560-184861582 AAGAAGGAGAGAAGGAAGGAAGG + Intronic
918522963 1:185434992-185435014 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
918895347 1:190336785-190336807 GTGAAGGAGGGAAGGGAGGGAGG - Intronic
918899518 1:190395964-190395986 CAGAAGGAAAGAAGGAAGGAAGG + Intronic
919267292 1:195286263-195286285 AAGAAGGAGAAAAGGGAGGAAGG - Intergenic
919348025 1:196411133-196411155 AAGAAGGAAGGAAGGGAGGTAGG - Intronic
919431758 1:197502702-197502724 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
920128714 1:203714092-203714114 TAGAAGGAGTGGCGGGTGGTAGG + Intronic
920167244 1:204044624-204044646 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
920465658 1:206182761-206182783 AATACGGAGTGAGGGGAGGTAGG - Intergenic
920849268 1:209617709-209617731 CAGAAGGAGGGGTGAGAGGTGGG - Intronic
920850485 1:209624975-209624997 AAGAAGGAAGGAAGGAAGGTAGG + Intronic
921068844 1:211642561-211642583 CAGAGGTAGTGAAGGCAGGAGGG - Intergenic
921285038 1:213601920-213601942 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
921285061 1:213602201-213602223 AAGAAGGAATGGAGGGAGGGAGG - Intergenic
921312316 1:213856468-213856490 AGGAAGGAGGGAAGGGAGGGAGG - Intergenic
921333574 1:214064382-214064404 CAGATGCAGAGAAGAGAGGTGGG - Intergenic
921642510 1:217572011-217572033 AGGAAGGAAGGAAGGGAGGTAGG + Intronic
921847637 1:219900970-219900992 AAGAAGGAAGGAAGGGAGGTGGG + Intronic
921936668 1:220802315-220802337 AAGAATGAGTTTAGGGAGGTGGG - Intronic
921984708 1:221299964-221299986 CAGGGGGAATGAAGAGAGGTGGG - Intergenic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
922404577 1:225298705-225298727 CAGCAGGAGTGAGGGTGGGTGGG + Intronic
922691408 1:227694943-227694965 CAGAAGGAGGGAAGGAAGGAAGG - Intergenic
922723333 1:227909928-227909950 GGGAAGGAATGAAGGGAGGAGGG + Intergenic
923332933 1:232942502-232942524 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
923509774 1:234640447-234640469 AGGAAGGAAAGAAGGGAGGTGGG + Intergenic
923941965 1:238837735-238837757 AAGAAGGAAGGAAGGAAGGTAGG - Intergenic
923970906 1:239202239-239202261 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
924033467 1:239910738-239910760 GAGAGGGAGGGGAGGGAGGTGGG + Exonic
924045443 1:240024926-240024948 AAGAAGGAGGGAAGGAAGGGAGG + Intronic
924138184 1:240993077-240993099 CAGAAGGAAGGAAGGAAGGAGGG + Intronic
924202513 1:241674830-241674852 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
924448548 1:244156962-244156984 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
924467768 1:244313723-244313745 CATAAGGAGGGAAGGGAGCCTGG - Intergenic
924521141 1:244807357-244807379 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
924585728 1:245359684-245359706 GGGAAGGAGGGAAGGGAGGGAGG - Intronic
924643287 1:245853960-245853982 GAGAAAGAGGCAAGGGAGGTGGG - Intronic
924728721 1:246692759-246692781 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
924949797 1:248872134-248872156 AAGAAGGAAGGAAGGGAGGCAGG - Intergenic
1062965571 10:1605175-1605197 CAGAAGAAGAGAAGGAAGGGAGG - Intronic
1063016905 10:2087505-2087527 GAGAAGGAGAGAAGGAAGGGAGG + Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063286298 10:4692246-4692268 AGGAAGGAAGGAAGGGAGGTAGG + Intergenic
1063349155 10:5338297-5338319 TAGAAGGAAGGAAGGAAGGTGGG - Intergenic
1063511263 10:6647208-6647230 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1063525223 10:6778728-6778750 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1063576318 10:7265196-7265218 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1063692141 10:8296982-8297004 AAGAAGGAAAGAAGGGAGGGAGG - Intergenic
1063713127 10:8500069-8500091 CAGAAAGAAAGAAGGGAGGGAGG - Intergenic
1063876387 10:10483858-10483880 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1063990297 10:11554124-11554146 CAGAAGGAGTGAAGGAAGGTGGG + Intronic
1064099327 10:12450101-12450123 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1064235838 10:13574367-13574389 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
1064341513 10:14489896-14489918 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1064405683 10:15060050-15060072 CAGAAGGAGAGAAGAGAAGAGGG - Intronic
1064643529 10:17437645-17437667 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
1064651872 10:17517515-17517537 AAGGAGGAAGGAAGGGAGGTAGG - Intergenic
1064717138 10:18188243-18188265 AAGAAGGAAAGAAGGCAGGTAGG - Intronic
1064752547 10:18546107-18546129 GAGAAGGAATGAGGGGAGCTGGG - Exonic
1065088284 10:22203019-22203041 AGGAAGGAGGGAAGGAAGGTAGG - Intergenic
1065114803 10:22475088-22475110 CAGTAGGAGAAACGGGAGGTGGG + Intergenic
1065223354 10:23518518-23518540 AAGAAGGAGGGAAGGAAGGGAGG - Intergenic
1065250772 10:23810233-23810255 CAGAAAGAGGGTAGGTAGGTAGG - Intronic
1065437261 10:25716329-25716351 CAGAAGGAAGAAAGGGAGGCAGG + Intergenic
1065445215 10:25791328-25791350 CAGAAGGAGGGAAGAGAGAAGGG + Intergenic
1065497297 10:26342158-26342180 AGGAAGGAGTGAAGGAAGGAAGG + Intergenic
1065608545 10:27446776-27446798 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1065608552 10:27446858-27446880 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1065689087 10:28315182-28315204 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
1065745397 10:28836487-28836509 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1065765635 10:29026941-29026963 AAGAAGGAAGGGAGGGAGGTAGG + Intergenic
1065874338 10:29983877-29983899 GAGAAGGAGGGAAGGAAGGAGGG + Intergenic
1065923862 10:30418135-30418157 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1065933452 10:30499834-30499856 AAGAAGGAGGGAAGGAAGGGAGG + Intergenic
1065933491 10:30499989-30500011 AAGAAGGAGGGAAAGGAGGAAGG + Intergenic
1066473428 10:35721739-35721761 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1066556590 10:36621171-36621193 AAGAAGGAATAAAGGGAGGAAGG - Intergenic
1066565694 10:36719558-36719580 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1067167595 10:43878043-43878065 GAGAAGGAGGGAATGGAGGAAGG - Intergenic
1067719909 10:48720295-48720317 CAGGAGGAGGGAAGAGGGGTCGG + Intronic
1068033510 10:51732014-51732036 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1068174013 10:53433518-53433540 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1068329086 10:55538433-55538455 AAGAAGGAAGGAAGGGAGGAAGG - Intronic
1068758769 10:60683913-60683935 CAGAAGGAAGGAAGAAAGGTAGG + Intronic
1068895523 10:62195597-62195619 CAGAGGGAATGAAGGAAGGAAGG + Exonic
1068927836 10:62558500-62558522 CAGAAAGATGGAAGGGAGGGAGG - Intronic
1069195616 10:65547206-65547228 CAGAAGGAGGTAAGGTAAGTTGG + Intergenic
1069637770 10:69936087-69936109 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
1069647907 10:70017734-70017756 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1069680983 10:70284921-70284943 CAGAAGCAGGGAAGGGTAGTGGG + Intergenic
1069730995 10:70613281-70613303 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1070507552 10:77127616-77127638 GAGAAGGAGAGAAGGCAGGAAGG + Intronic
1070979201 10:80630770-80630792 CAGCTGGAGTGAAGGGGGCTGGG + Intronic
1070984989 10:80680981-80681003 GGGCAGGAGTCAAGGGAGGTAGG + Intergenic
1071019578 10:81036183-81036205 CAGAAGGTGTGAACTGAGGGTGG + Intergenic
1071140742 10:82506576-82506598 CAGAAAGAGGAAAGGTAGGTAGG - Intronic
1071443654 10:85726540-85726562 CACAAGGGATGAAGGGAGGAGGG + Intronic
1071519519 10:86320488-86320510 CAGAAGGAGAGAAAGGAGAATGG + Intronic
1071554881 10:86594287-86594309 GAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1071731585 10:88253790-88253812 CAGGAGGAGGGGAGGGAGGGGGG - Intergenic
1071800758 10:89057086-89057108 AAGGAGGAGTGAGGGGAGGCAGG + Intergenic
1072116421 10:92374469-92374491 CAAAAGGAGGGAGGGGAGGGTGG - Intergenic
1072124237 10:92431337-92431359 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1072193196 10:93092909-93092931 AAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1072296441 10:94013299-94013321 TAGGAGGAGTGAAGTGAGGAGGG + Intronic
1072313277 10:94177881-94177903 GAGAGGTAGTGAAGGGAGGAAGG - Intronic
1072454956 10:95567586-95567608 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1072586783 10:96789927-96789949 GAGAAGGAGGGAAGGAAGGAGGG - Intergenic
1072746383 10:97941923-97941945 CAGAAGGAGGCCAGTGAGGTAGG - Intronic
1072806987 10:98429930-98429952 CAGAAGGGGTGGAGGGAGCCAGG - Intronic
1072812119 10:98470073-98470095 CAGGTGGAGTGAAGACAGGTAGG + Intronic
1072916018 10:99537634-99537656 AAGAAGGAGGGAAGGGAGGGAGG + Intergenic
1072926944 10:99624048-99624070 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1072934571 10:99699884-99699906 AAGAAGGAGGGAAGGGAGGGAGG - Intronic
1073261754 10:102195886-102195908 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1073294945 10:102433262-102433284 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1073598506 10:104823461-104823483 GGAAAGGAGAGAAGGGAGGTGGG - Intronic
1073707133 10:105997621-105997643 CAGAAGAAATGAAGAGATGTTGG - Intergenic
1074311803 10:112328772-112328794 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
1074342988 10:112652744-112652766 AAGAAGGAAGGAAGGGAGGAAGG + Intronic
1074409159 10:113210900-113210922 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1074440680 10:113475042-113475064 CAGCAGTGGTGGAGGGAGGTGGG + Intergenic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1074573481 10:114646685-114646707 CAGGAGGAGTTACAGGAGGTTGG + Intronic
1074615898 10:115067882-115067904 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1074809625 10:117090752-117090774 CAGAAGGAAGGAAGGAAGGAAGG + Intronic
1074899565 10:117804449-117804471 CAGAAGGAGTGCTGGCAGCTTGG + Intergenic
1074967471 10:118504069-118504091 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1074967488 10:118504255-118504277 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1075105966 10:119540241-119540263 AAGAAGGAAGGAAGGGAGGAAGG - Intronic
1075240621 10:120775223-120775245 CAGAAGGACAGAAGAGGGGTTGG - Intergenic
1075648771 10:124113844-124113866 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1075667115 10:124239493-124239515 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1075863480 10:125697444-125697466 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1076185767 10:128447369-128447391 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1076292761 10:129360387-129360409 CAGACGGATTTAGGGGAGGTGGG + Intergenic
1076303866 10:129449520-129449542 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1076303879 10:129449556-129449578 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1076358764 10:129871592-129871614 CAGAAGGAGGGAAGGGGTTTGGG + Intronic
1076457674 10:130612113-130612135 CAGAAAAAGTCAAGGGAAGTTGG - Intergenic
1076558670 10:131346866-131346888 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
1076558683 10:131346913-131346935 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
1076558696 10:131346960-131346982 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
1076558708 10:131347007-131347029 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
1077089775 11:773173-773195 CAGCAGGGGTGCAGGGAGGAAGG - Intronic
1077108444 11:851784-851806 CAGAATGACTGAAGGGCAGTGGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077272265 11:1686854-1686876 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1077354347 11:2108268-2108290 CAGAGGGAGTGAAGGGAGAGAGG + Intergenic
1077549685 11:3194540-3194562 TGGAAGGAGGGAAGGGGGGTAGG - Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077659113 11:4051038-4051060 GAGAAGGTAGGAAGGGAGGTGGG + Intronic
1077693426 11:4370454-4370476 CAGGAGGAAGGGAGGGAGGTGGG - Intergenic
1077761365 11:5103164-5103186 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1077785577 11:5380157-5380179 CATAATGACTGAAGAGAGGTAGG + Intronic
1077899869 11:6479539-6479561 CAGCAGGAGTCAAGGATGGTGGG + Intronic
1078067964 11:8090250-8090272 CCGAAGCAGTGACGGGATGTGGG - Intronic
1078227524 11:9405867-9405889 GAGAAGGAGGGAAAGGAGGAAGG - Intronic
1078472678 11:11604363-11604385 CAGAATCAGTGAAGTGAGGCAGG + Intronic
1079238297 11:18705131-18705153 CAGAAGGTGAGATGAGAGGTGGG + Intronic
1079292097 11:19197417-19197439 AAGAAGGAGGGAAGGAAGGAAGG - Intronic
1079370145 11:19845675-19845697 TAGGAAGAGTGAAGGGAGGGAGG - Intronic
1079540929 11:21573762-21573784 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1079597496 11:22269067-22269089 AAGAAGGAGGGAAGGAAGGACGG + Intronic
1079722848 11:23841023-23841045 GAGAAGGAATGAAGGAAGGAAGG - Intergenic
1080055883 11:27905968-27905990 AGGAAGGAAGGAAGGGAGGTTGG - Intergenic
1080115945 11:28621754-28621776 AACAAGAAGAGAAGGGAGGTGGG - Intergenic
1080203744 11:29705811-29705833 AAGAGTCAGTGAAGGGAGGTAGG + Intergenic
1080226993 11:29973269-29973291 CAAAAAGAGTGAAAGGAGATAGG + Intergenic
1080303812 11:30815196-30815218 AAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1080413821 11:32051281-32051303 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1080466688 11:32504075-32504097 AAGAAGGAATGAAGGAAGGAAGG + Intergenic
1080555962 11:33417751-33417773 CAGAAGGACAGAAGGAAGGAAGG - Intergenic
1080587837 11:33697483-33697505 CAGGAGGAGTGAGGGGAGAGTGG - Intergenic
1080616260 11:33947418-33947440 CAGCTGGAATGAAGGGAGGGAGG - Intergenic
1080928706 11:36784981-36785003 GAGAAGGAAGGAAGGAAGGTGGG - Intergenic
1081095256 11:38924923-38924945 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1081132938 11:39402816-39402838 GAGAAGGAAGGAAGGAAGGTAGG - Intergenic
1081419358 11:42854599-42854621 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1081692888 11:45089946-45089968 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1081762716 11:45587797-45587819 CAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082210148 11:49490492-49490514 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1082620973 11:55422089-55422111 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1082728246 11:56763590-56763612 CAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1082799832 11:57406365-57406387 CAGGAGGAGAGATGGCAGGTGGG - Intronic
1082837761 11:57664081-57664103 AAGAAAGAGGGAAGGGAGGGAGG - Intergenic
1082837800 11:57664275-57664297 CAGAAGGAGGGAAGGAAAGGGGG - Intergenic
1082849804 11:57754648-57754670 CAGAAAGAAGGAAGGGAGGAAGG - Intronic
1082849830 11:57754742-57754764 CAGAAGGAAGGAAGGGAGCGAGG - Intronic
1082849849 11:57754834-57754856 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1082873848 11:57968720-57968742 AAGAAGGAACGAAGGGAGGGAGG - Intergenic
1083413880 11:62512857-62512879 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1083577276 11:63801198-63801220 GGGAAGGAGTGAAGGAAGGAAGG + Intergenic
1083594076 11:63910815-63910837 CAGGAGGGGGGAAGGGAGGGAGG - Exonic
1083630141 11:64091106-64091128 GAGAAGGAGGGAAGAGAGGGTGG + Intronic
1083762029 11:64823964-64823986 GAGAAGGAGGGAAAGGATGTAGG - Exonic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1083995821 11:66271759-66271781 GGGAAGGCGTGAAGGGAGGCAGG - Intronic
1084047525 11:66578425-66578447 AAGAAGGAATGAAGGAAGGAAGG + Intergenic
1084147057 11:67270553-67270575 CTGCAGGAGTGAAGGAAGGAGGG - Intronic
1084162406 11:67356914-67356936 AAGAAGGTGTGGAGGGTGGTAGG - Intronic
1084215894 11:67646701-67646723 AAGCAGGAGTGAAGGCAGGGAGG + Intronic
1084622469 11:70282291-70282313 AAGAAGGAGGCTAGGGAGGTAGG + Intronic
1084768017 11:71325002-71325024 CAGCAGGAGCGATGGGAGGGTGG + Intergenic
1084919565 11:72458171-72458193 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1084998448 11:73006588-73006610 CAGAAGCAGAGAGGGCAGGTAGG - Intronic
1085012363 11:73150085-73150107 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1085162329 11:74360271-74360293 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1085322575 11:75583803-75583825 AAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1085393054 11:76192360-76192382 GAGAAGGAAGGAAGGGAGGAGGG + Intronic
1085698800 11:78728477-78728499 CAGAAGCAAGGAAGGGAGGGAGG - Intronic
1085853225 11:80145953-80145975 GGGAAGGAGGGAAGGGAGGAAGG + Intergenic
1086004760 11:82025741-82025763 GAGAATCAGTGAAGGGAGATGGG - Intergenic
1086174558 11:83874278-83874300 GAGAAGGAAGGAAGGGAGGAAGG + Intronic
1086639519 11:89135043-89135065 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1087196565 11:95309771-95309793 CAGAGTCAGTGAAGGGAGATAGG - Intergenic
1087237348 11:95734770-95734792 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1087358476 11:97125450-97125472 GAGAAGGAAGGAAGGGAGGCAGG - Intergenic
1087501184 11:98956054-98956076 CAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1087597450 11:100272486-100272508 CAGAAGGAAGGAAGGAAGGAAGG + Intronic
1087630590 11:100646467-100646489 AAGAAGGAAGGAAGGAAGGTAGG + Intergenic
1087678492 11:101190502-101190524 CAGAAGGAATAAACAGAGGTGGG - Intergenic
1087811808 11:102616135-102616157 GGGAAGGAGTGAGGGGAGCTTGG + Intronic
1087872122 11:103308971-103308993 TAGAAGGAAGGCAGGGAGGTTGG - Intronic
1087919118 11:103846280-103846302 CGGAAGGAAGGAAGGGAGGAAGG - Intergenic
1087937356 11:104050319-104050341 TAAAAGAAGTGAAGGGAAGTAGG + Intronic
1088090493 11:106033165-106033187 AAGAGGGGTTGAAGGGAGGTAGG + Intergenic
1088381183 11:109194547-109194569 CGGAAGGAAGGAAGGGAGGGAGG - Intergenic
1088555465 11:111055992-111056014 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
1088735539 11:112724987-112725009 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1088897856 11:114091621-114091643 CAGAAGGAAGGAAGGGAGGAAGG - Intronic
1089074437 11:115727081-115727103 GAGAAGGAGGGAAGGAAGGAGGG + Intergenic
1089196315 11:116695861-116695883 GAGAAGGAGGGAAGGGAGGAGGG - Intergenic
1089196385 11:116696142-116696164 AGGAAGGAGGGAAGGGAGGAAGG - Intergenic
1089739262 11:120571148-120571170 CAAAAGGAGTCTAGGGAGGAGGG - Intronic
1090035755 11:123248201-123248223 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1090203351 11:124871121-124871143 CAGAAGGAGGGGAGTCAGGTGGG + Exonic
1090343265 11:126044740-126044762 CAGAAGGGCAGCAGGGAGGTGGG + Intronic
1090721355 11:129476645-129476667 AAGAAGGAGGGAAAGGAGGGAGG - Intergenic
1090939661 11:131375917-131375939 CAGAAGGAGAGAAGGAGGGAAGG - Intronic
1091086187 11:132724165-132724187 AAGAAGGGGTGGTGGGAGGTGGG - Intronic
1091101094 11:132874413-132874435 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1091142816 11:133250510-133250532 GAGAGGGAGGGAAGGGAGGGAGG + Intronic
1091365543 11:135016496-135016518 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1091538363 12:1435313-1435335 CAGAAGGAGAGAGGGGAGTTAGG + Intronic
1092042269 12:5395365-5395387 AAGAAGGAGTGAAGGGATCAAGG - Intergenic
1092157579 12:6294223-6294245 AAGAAGGAGGGAAGGAAGGAGGG + Intergenic
1092698569 12:11201726-11201748 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1092712343 12:11352533-11352555 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092716079 12:11392253-11392275 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092721654 12:11447169-11447191 AAGAAAGAGAGAAGGGAGGGAGG + Intronic
1092808456 12:12249670-12249692 CAGAAGGAAGGAAGGAAGGAAGG + Intronic
1092927950 12:13289195-13289217 GAGAAGGAGCAAAGGGTGGTGGG + Intergenic
1092937662 12:13379123-13379145 CAGAGGAAATGCAGGGAGGTGGG - Intronic
1093200108 12:16176333-16176355 CAGAAGGAAAGAAGGAAGGAAGG - Intergenic
1093410604 12:18861073-18861095 CAAAAGGAAAGAAGGGAGGAAGG - Intergenic
1093521620 12:20057752-20057774 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1093523338 12:20076078-20076100 AGGAAGGAGAGAAGGGAGGAAGG - Intergenic
1093542910 12:20308987-20309009 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1093772565 12:23034551-23034573 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
1093796779 12:23322130-23322152 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1093989371 12:25572807-25572829 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1094367704 12:29701564-29701586 AAAGAGGAGTGAAAGGAGGTGGG - Intronic
1094704821 12:32904370-32904392 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1095169823 12:39020530-39020552 GGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1095200731 12:39380719-39380741 AAGAAGGAAGGAAGGAAGGTAGG + Intronic
1095444647 12:42271770-42271792 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1095587018 12:43860712-43860734 GAGGAGAAGTGGAGGGAGGTGGG + Intronic
1095725025 12:45442357-45442379 CAGAAGCTGGGAAGGGAGGTAGG + Intergenic
1096311398 12:50524495-50524517 GGGAAGGAGAGAAGGGAGGAAGG - Intronic
1096767033 12:53899505-53899527 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1096817086 12:54208560-54208582 AAGAGGGAGGGAAGGGAGGTGGG + Intergenic
1096972741 12:55681075-55681097 AAGAAGGAAAGAAGGGAGGAAGG + Intergenic
1096996302 12:55840358-55840380 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1096996310 12:55840391-55840413 GAGAAGGAGAGAAGGAAGGGAGG + Intronic
1096996326 12:55840447-55840469 GAGAAGGAGAGAAGGAAGGGAGG + Intronic
1097097132 12:56558548-56558570 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1097472787 12:60016551-60016573 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1097542963 12:60963044-60963066 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1097552835 12:61098069-61098091 CAGAAGAGGTGAGGGGACGTGGG - Intergenic
1097605487 12:61748126-61748148 CAGAAGGAAGGAAAGGAGGAAGG + Intronic
1097918736 12:65048293-65048315 GAGGGGGAGTGAAGAGAGGTTGG + Intergenic
1098058476 12:66534658-66534680 CAGAAGGAAGGAAGGGAGGAAGG - Intronic
1098101409 12:67021276-67021298 AAGAAGGAGGGATGGAAGGTGGG - Intergenic
1098552905 12:71783857-71783879 CAGAAGGAAGGAAGGGAGGGAGG - Intronic
1098565404 12:71929641-71929663 CAGAGGGTGGGAAGGGTGGTGGG + Intergenic
1098573718 12:72016937-72016959 CAGAGGGAGTGAGAGGAGGGAGG + Intronic
1098599529 12:72314328-72314350 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1098716119 12:73830074-73830096 CTGAGGGAGAGAAGGGAGGGTGG - Intergenic
1098959329 12:76722446-76722468 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1099331481 12:81294488-81294510 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1099533162 12:83812471-83812493 CAGAAGGAAGGAAGGAAGGGAGG - Intergenic
1099860019 12:88214752-88214774 CTGAAGGAGGGAAGGAAGGAAGG + Intergenic
1099925169 12:89008319-89008341 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1100034447 12:90234335-90234357 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
1100137096 12:91566952-91566974 GGGAAGGAGGGAAGGGAGGTGGG - Intergenic
1100214008 12:92428686-92428708 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1100263048 12:92950622-92950644 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1100316776 12:93452055-93452077 GAGAATGAGTGAAGGCAGGAAGG - Intergenic
1100367093 12:93931924-93931946 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1100493525 12:95103531-95103553 CAGAAAGAATGGAGGGAGGGCGG - Intronic
1100576174 12:95893434-95893456 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1100601086 12:96111899-96111921 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1100831502 12:98520289-98520311 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
1101225268 12:102681936-102681958 AAGAAAGAATGAAGGGAGGGAGG - Intergenic
1101348177 12:103905320-103905342 CAGAGGGAGGGAAGGAAGGAAGG + Intergenic
1101444816 12:104730162-104730184 CAGAACGAGTGAAGGAATGGTGG - Intronic
1101700738 12:107171498-107171520 CAGAAGGAGTGGATGGGGGATGG - Intergenic
1101732839 12:107440718-107440740 AAGAAGGAAAGAAGGGAGGCAGG + Intronic
1101880919 12:108624982-108625004 AAGAAGGAGTGACATGAGGTCGG - Intronic
1102029665 12:109732670-109732692 CAGAAGGAGGGGAGGTGGGTGGG + Intronic
1102168523 12:110824642-110824664 AAGAAGGATGGAAGGGAGGGAGG + Intergenic
1102194729 12:111016928-111016950 GAGAAGAAGAGAAGGGAGGGAGG - Intergenic
1102353965 12:112216811-112216833 CAGAAGCAGAGAAGCGAGATGGG - Exonic
1102500994 12:113352367-113352389 AGGAAGGAGGGAAGGGAGGGAGG - Intronic
1102598799 12:114013062-114013084 GAGATGGAGTGATGGGAGGGGGG + Intergenic
1102693481 12:114779962-114779984 AAGAAAGAGAGAAGGGAGGGAGG - Intergenic
1102759668 12:115374556-115374578 TAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1102864063 12:116360374-116360396 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1102864088 12:116360461-116360483 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1102868603 12:116394331-116394353 CAGAAGCAGAGATGGGAGGGAGG - Intergenic
1102991989 12:117322287-117322309 CAGAGGGAGGGAAGGAAGGAGGG - Intronic
1102992101 12:117322685-117322707 AAGAAGGAGGGAAGGAAGGAAGG - Intronic
1103017859 12:117509424-117509446 AAGAAAGAGAGCAGGGAGGTAGG + Intronic
1103175646 12:118861022-118861044 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1103204787 12:119120135-119120157 GAGAAGGAGAGAAAGGAGGAAGG - Intronic
1103261578 12:119593618-119593640 GAAAAGGAGTGAGGGGAGGCGGG - Exonic
1103335839 12:120189038-120189060 CAGAAGTTGTGCAGGGAGGGGGG + Intronic
1103495281 12:121357340-121357362 GAGAAGGAGGGAAGGAAGGGAGG + Intronic
1103495316 12:121357584-121357606 CAGAAAGAATGGAGGGAGGGAGG + Intronic
1103688553 12:122752200-122752222 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1103769197 12:123307333-123307355 AAGAAGGAATGAAGGAAGGTGGG + Intronic
1103857595 12:123984271-123984293 CAGAAGGAGCCAAGGGAGTGTGG + Intronic
1103925665 12:124422337-124422359 CAGATGGAAGGAAGGGAGGGAGG + Intronic
1104063475 12:125287171-125287193 CAGAAGCAGAGGAGGGAGGGAGG - Intronic
1104238552 12:126963829-126963851 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1104301711 12:127570496-127570518 AAGAAGGAGTGAAGGGAGGTAGG + Intergenic
1104301752 12:127570710-127570732 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1104508276 12:129353114-129353136 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1104523734 12:129499015-129499037 CTGAAGGAATGAAGGCAGGCTGG - Intronic
1104668898 12:130667133-130667155 GAGAGGGAGGGAAGGGAGGAAGG + Intronic
1104714378 12:131006641-131006663 CAGAAGGAGAGCAAGGAGGGTGG + Intronic
1104755426 12:131266463-131266485 CAGCAGGAGGGAAAGGAGATGGG + Intergenic
1104863583 12:131939138-131939160 CAGAACGGGTGACGGAAGGTGGG - Intronic
1105285102 13:18996950-18996972 CAGAAGGTGTGAAGGCAAGAAGG + Intergenic
1105471401 13:20698233-20698255 CGGAAGGAGGGAAGGAAGGAAGG + Intergenic
1105561030 13:21491044-21491066 CAGAAGGAAAGAAGAGAGGGAGG - Intergenic
1105694408 13:22873592-22873614 CAAAAGGAATGGAGGGAGGGAGG - Intergenic
1105857996 13:24388496-24388518 AAGAAGGAGGGAAGGAAGGAGGG + Intergenic
1105874936 13:24542778-24542800 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
1106076975 13:26468613-26468635 GAGAAGGAGTGAAGGGTCTTGGG + Intergenic
1106357967 13:29002212-29002234 CAGCTGAAGTGAAGGAAGGTAGG - Intronic
1106452132 13:29892178-29892200 CAGAAGAAGAAAAGGGAGTTTGG + Intergenic
1106580839 13:31017040-31017062 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1106842711 13:33702255-33702277 CAGAAGCGGTGAAGGGAAGAGGG - Intergenic
1106953339 13:34908612-34908634 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1107119742 13:36783163-36783185 AAGAAGGAGAGAAGGGAGAGAGG + Intergenic
1107174482 13:37384642-37384664 CAGAAGATGAGAAAGGAGGTTGG + Intergenic
1107360168 13:39608978-39609000 AAAAAGGAATGAAGGGAGGAAGG - Intergenic
1107634761 13:42381064-42381086 CAGAATGAGTAAACTGAGGTAGG - Intergenic
1107655808 13:42591325-42591347 TAGGAGGAGCGAAGGTAGGTAGG - Intronic
1107857433 13:44629919-44629941 CAGAAGAAGACAAGGGATGTAGG + Intergenic
1108229773 13:48324372-48324394 CAGAAGCTGTGAAGGGTAGTGGG - Intronic
1108276979 13:48820938-48820960 CAGAGTGAGTGAGGGGAAGTGGG + Intergenic
1108790289 13:53961622-53961644 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1109099416 13:58161448-58161470 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1109108394 13:58284679-58284701 GAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1109181567 13:59220048-59220070 CGGAAGGAAGGAAGGGAGGAAGG + Intergenic
1109321563 13:60816631-60816653 AAGAAGGACGGAAGGGAGGGAGG - Intergenic
1109454071 13:62560309-62560331 AAGAAGGAGTAAGAGGAGGTGGG + Intergenic
1109493916 13:63143118-63143140 AGGAAGGAGTGAAGGAAGGAAGG + Intergenic
1109552223 13:63918007-63918029 GAGAAGGAAAGAAGGGAGGGAGG - Intergenic
1109842744 13:67941232-67941254 AAGAAGGAATGAAGGAAGGAAGG + Intergenic
1109919346 13:69036059-69036081 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1110171213 13:72502772-72502794 GAGAGGGAGGGAAGGTAGGTAGG + Intergenic
1110290879 13:73805603-73805625 CAGAAGGAAGGGAGGGAGGGAGG + Intronic
1110575641 13:77052143-77052165 GGGAAGGAGGGAAGGAAGGTAGG - Intronic
1110722535 13:78780473-78780495 AAGAAGAAGGGAAGGGAAGTTGG - Intergenic
1110731933 13:78888641-78888663 CAGAATGGGTGAAGGGTGGAGGG + Intergenic
1110843964 13:80173113-80173135 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1110872668 13:80470553-80470575 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1110879357 13:80552453-80552475 AAGAAGGAGAGAAGGAAGGAGGG + Intergenic
1111006332 13:82254790-82254812 AGGAAGGAGAGAAGGGAGGAAGG + Intergenic
1111060315 13:83010074-83010096 CAGAAGCTGTGAAGGGTAGTAGG - Intergenic
1111086364 13:83380511-83380533 CAGAAGGAAAGAAGGAAGGAAGG - Intergenic
1111086381 13:83380565-83380587 CAGAAGGAAAGAAGGAAGGAAGG - Intergenic
1111216641 13:85151943-85151965 AAGAAGGAAGGAAGGAAGGTAGG - Intergenic
1111231419 13:85348664-85348686 AAGAAGGAAGGAAGGAAGGTAGG - Intergenic
1111366927 13:87259757-87259779 AAGAAGGAAGGAAGGAAGGTAGG + Intergenic
1111446164 13:88348013-88348035 AAGAAGGAATGAAGGAAGGAAGG + Intergenic
1111541900 13:89679635-89679657 CAGAAAGAGGGAAGGAAGGAAGG + Intergenic
1112015144 13:95325509-95325531 CAGAAAGAGAGAAGGAAGGAAGG + Intergenic
1112038185 13:95517135-95517157 AAGAAGGAAAGAAGGGAGGAAGG - Intronic
1112050042 13:95635979-95636001 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1112251009 13:97780454-97780476 GAAAAGGAATGGAGGGAGGTTGG + Intergenic
1112359351 13:98703163-98703185 CAGAAGGAAGGAAGGAAGGGAGG + Intronic
1112446797 13:99471755-99471777 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1112643167 13:101300287-101300309 AAGAAGGAGGGAAGGAAGGAAGG - Intronic
1113039436 13:106088744-106088766 CGGAAGGAAGGAAGGGAGGGAGG + Intergenic
1113104357 13:106757256-106757278 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1113334676 13:109366549-109366571 CAGAAAGAGAGAAGAGAGGCAGG + Intergenic
1113345464 13:109473613-109473635 TGGGAGGAGTGAAGAGAGGTTGG - Intergenic
1113508907 13:110836153-110836175 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1113815419 13:113166613-113166635 CAGACGGAGTGATGGAAGGCGGG + Intronic
1114149543 14:20021963-20021985 TGGAAGCAGTGAAGGTAGGTGGG - Intergenic
1114254198 14:20987956-20987978 GAGAAGGAGAGAAGGGAGAAAGG - Intergenic
1114276043 14:21146004-21146026 CAGAAAGAAAGAAGGGAGGGAGG - Intergenic
1114599052 14:23939671-23939693 CAGAGTCAGTGAAGGGAGATGGG + Intergenic
1114773562 14:25455969-25455991 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1114798498 14:25743707-25743729 AAGAAGGAAAGAAGGGAGGGAGG - Intergenic
1114863314 14:26554182-26554204 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1115034874 14:28845105-28845127 AAGAAGGGATGAAGGGAGGAAGG - Intergenic
1115211755 14:30973392-30973414 GAGAAAGAGAGAAGGGAGGGAGG + Intronic
1115780197 14:36760330-36760352 CAGAAGGAAGGAAGGAAGGAAGG + Intronic
1115933636 14:38527176-38527198 AAGAAGGAGAGAAGGAAGGAAGG + Intergenic
1116133292 14:40889157-40889179 AAGAAGGAAGGAAGGAAGGTAGG + Intergenic
1116200034 14:41781489-41781511 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1116470719 14:45282543-45282565 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1116470723 14:45282551-45282573 AAGAAGGAGAGAAGGAAGGAAGG - Intergenic
1116475234 14:45331517-45331539 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1116555319 14:46296212-46296234 CAGAAGCTGGGAAGGGTGGTGGG - Intergenic
1116859701 14:49984012-49984034 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1117701458 14:58417612-58417634 GGGAAGGAGGGAAGGGAGGGAGG + Intronic
1117959663 14:61150185-61150207 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1118060467 14:62132385-62132407 CAGAGGGAGAGAAAGAAGGTGGG - Intergenic
1118139524 14:63064842-63064864 CAGAAGGAAGGAAGGAAGGGAGG + Intronic
1118219315 14:63840480-63840502 AAGGAGGAGGGAAGGGAGGGAGG - Intergenic
1118381220 14:65219187-65219209 CAGAAGGAGGAAGGGGTGGTGGG - Intergenic
1118408434 14:65451160-65451182 CACAAGGAGTTAAGAGTGGTGGG - Intronic
1118820529 14:69342463-69342485 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1119430185 14:74562248-74562270 CATAAGAAGTGCATGGAGGTGGG + Intronic
1119591257 14:75889925-75889947 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1119607928 14:76036798-76036820 CAGAGGGAGGGAAGGAAGGAAGG - Intronic
1119659556 14:76440544-76440566 AGGAAGGAATGAAGGAAGGTCGG - Intronic
1119946747 14:78703323-78703345 CTGAGGGAGAGAAGGGAAGTGGG + Intronic
1120204859 14:81577003-81577025 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1120235827 14:81889857-81889879 AAGAAGGAATAAAGGGAGGGAGG - Intergenic
1120309400 14:82810844-82810866 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1120582553 14:86270813-86270835 GAGAGTGAGTGAAGGGAGATAGG - Intergenic
1120598045 14:86465395-86465417 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1120746907 14:88160366-88160388 CAGAAGAAAGGAAGGGAGGATGG - Intergenic
1120860061 14:89246987-89247009 AAGAGGGAGAGAAGGGAGGAAGG - Intronic
1120974441 14:90236265-90236287 GAGAGAGAGTGGAGGGAGGTAGG - Intergenic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG + Intronic
1121385050 14:93513182-93513204 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1121399993 14:93667184-93667206 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
1121453531 14:94024319-94024341 GAGAAGGGGTGCAGGAAGGTTGG + Intergenic
1121502525 14:94449575-94449597 AAGAAGGAGGGAAGGAAGGAAGG - Intronic
1121557703 14:94850848-94850870 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
1121578715 14:95010357-95010379 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1121600153 14:95197355-95197377 AAGAAGGAGAGAAGGAAGGAAGG + Intronic
1121856238 14:97272723-97272745 AAGAAGGAAGGAAGGGAGGCAGG - Intergenic
1121916734 14:97842393-97842415 CAGAGGGAGGGAAGGAAGGAAGG + Intergenic
1121971069 14:98356382-98356404 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1122216974 14:100211244-100211266 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1122603391 14:102932161-102932183 GGGCAGGAGTGAAGGGAGGAGGG - Intronic
1122868410 14:104621396-104621418 CGGAAGGAAGGAAGGGAGGGAGG + Intergenic
1123042445 14:105495922-105495944 CAGAAGGAGTGCAGGCACTTTGG - Intronic
1202937492 14_KI270725v1_random:104665-104687 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1124196877 15:27639295-27639317 CAGAAGGAGTGATGGGTCTTAGG - Intergenic
1124223655 15:27870722-27870744 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1124425031 15:29556433-29556455 CACAAGGAAGGAAGGGAGGGAGG + Intronic
1124472443 15:30000409-30000431 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1124596511 15:31096133-31096155 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1125087881 15:35752358-35752380 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1125121248 15:36161191-36161213 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1125281210 15:38044304-38044326 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1125638037 15:41205717-41205739 GAGAAGGAGGGAAGAGAGGAAGG + Intronic
1126089413 15:45038175-45038197 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
1126171239 15:45696966-45696988 AGGAAGGAGGGAAGGGAGGGAGG - Intergenic
1126181917 15:45793735-45793757 CAGAAGGAGGGAAGGAGGGAGGG - Intergenic
1126379501 15:48031375-48031397 AAGAAGGAGTGAGGGGAAGTGGG + Intergenic
1126417067 15:48428599-48428621 GAGAGGGAGGGAAGGGAGGAAGG - Intronic
1126520732 15:49591396-49591418 CGGAAGGAGGGAAGGAAGGAAGG - Intronic
1126704933 15:51397807-51397829 CAGAAGGAGGGAAGGGGAGTGGG - Intronic
1126858887 15:52864930-52864952 CAGAAGGAGGTAAGTGAGGCTGG - Intergenic
1127267583 15:57374311-57374333 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1127507376 15:59610270-59610292 AGGAAGGAGTGAAGGAAGGAGGG - Intronic
1127660734 15:61098064-61098086 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
1127788625 15:62378659-62378681 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1127831951 15:62758777-62758799 CAGCAGGAGAGAAGGGAGCCAGG + Intronic
1127961654 15:63894967-63894989 CTGAGGGAGAGAGGGGAGGTGGG - Intergenic
1128613858 15:69094364-69094386 AAGAAGGAAGGAAAGGAGGTAGG + Intergenic
1128632168 15:69278642-69278664 GAGAAGGGGTGGAGAGAGGTGGG + Intergenic
1128783363 15:70377431-70377453 CAGCAGCAGGGAGGGGAGGTTGG - Intergenic
1128877200 15:71212054-71212076 AGGAAGGAGTGGAGGGAGGCTGG + Intronic
1128898599 15:71398505-71398527 CAGAAGGAGTGAAAGGGAGGAGG + Intronic
1128945311 15:71815953-71815975 CAGAAGCAGGGAAGGCAGATGGG + Intronic
1129162595 15:73754888-73754910 GAGGAGGGGTCAAGGGAGGTGGG + Intergenic
1129169793 15:73800657-73800679 CAGAAGGAGGGAGGGCAGGCAGG - Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129364185 15:75044250-75044272 CTGCAGGAGGGAACGGAGGTTGG + Intronic
1129384050 15:75185870-75185892 GGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1129457429 15:75683258-75683280 CAGATGGAGAGCAGGGAGGCTGG - Intronic
1129521508 15:76189343-76189365 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1129521518 15:76189383-76189405 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
1129698516 15:77754297-77754319 GAGAAGGAAGGAAGGGAGGAAGG + Intronic
1129726362 15:77903687-77903709 CAGATGGAGAGCAGGGAGGCTGG + Intergenic
1129737640 15:77974982-77975004 CAGAAGCAATGGAGGGAGGCAGG - Intergenic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1130026029 15:80271255-80271277 CAGAAGGAAGGAAGGGAGAGAGG - Intergenic
1130048057 15:80461382-80461404 CAGAGGGAGTGAAGGGAGGCCGG + Intronic
1130159562 15:81385212-81385234 CTGCAGGCCTGAAGGGAGGTGGG + Intergenic
1130736003 15:86549817-86549839 AAGAAGGAAGGAAGGAAGGTAGG + Intronic
1130951747 15:88596256-88596278 AAGAAGGAAGGAAGGGAGGAGGG - Intergenic
1131021731 15:89104749-89104771 CAGAAGGAGGAAATGGAGATGGG - Intronic
1131030645 15:89183729-89183751 CAGAGGTAGGGAAGGGAGGAGGG - Intronic
1131330644 15:91496052-91496074 CAGATGGAAGGAAGGGAGGGAGG - Intergenic
1131449349 15:92526179-92526201 AGGAAGGAATGAAGGGAGGAAGG - Intergenic
1131460007 15:92611177-92611199 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1131465116 15:92648637-92648659 TACAATGAGTGTAGGGAGGTAGG + Intronic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131627792 15:94142128-94142150 AAGAAGGAATGAAGGGAGGAAGG - Intergenic
1132302800 15:100787020-100787042 GAGAAGACGTGAAGGCAGGTGGG - Intergenic
1132304345 15:100800706-100800728 GAGAAGAAGTGGAGGGATGTGGG + Intergenic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132435945 15:101802815-101802837 CGGAAGGAGGGAAGGAAGGAAGG - Intergenic
1132777666 16:1604720-1604742 CTGGAGGAGGGAAGGGCGGTTGG + Intronic
1132886633 16:2185102-2185124 CTGAAGGCGTCAAGGTAGGTGGG - Exonic
1133158462 16:3892537-3892559 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1133220231 16:4316488-4316510 CAGACGGAGGGAAGGAAGGAGGG - Intronic
1133661239 16:7919842-7919864 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
1133862050 16:9605263-9605285 CGGAAGGAGAGAAGGAAGGAAGG - Intergenic
1134263686 16:12674538-12674560 CAGGTGGAGTGAAAGGAGGCGGG + Intronic
1134351774 16:13444390-13444412 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1134692204 16:16198195-16198217 CAGAAGGAGAGAAGTAAAGTGGG + Intronic
1135159224 16:20078802-20078824 GATAAGTAGTGAAGGGATGTTGG + Intergenic
1135263904 16:21005197-21005219 CAGAAGGAGAGAGGGAAGGAGGG - Intronic
1135263936 16:21005315-21005337 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1135495746 16:22949696-22949718 CAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1135495756 16:22949725-22949747 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1135607657 16:23837172-23837194 CTGCAGGAGTGAAGGCAGATGGG + Intronic
1135637900 16:24094786-24094808 GAGAAGGAATGAAGGAAGGGAGG + Intronic
1135781718 16:25308869-25308891 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1135826132 16:25730501-25730523 CAGAGGGAGGGAAGGAAGGAAGG - Intronic
1135913118 16:26579130-26579152 GAGAGGGAGGGAAGGGAGGAAGG - Intergenic
1135927666 16:26709793-26709815 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1135927713 16:26709907-26709929 AAGAAGGAGTGAAGGAAGGAAGG + Intergenic
1135937263 16:26791968-26791990 CAGAAGAGGTGAAGGGATGAAGG - Intergenic
1135956366 16:26959725-26959747 GAGAAGGAGAGGAGGGAGATAGG - Intergenic
1136072525 16:27796577-27796599 CAGAATGAGTGAACGGTGGAGGG + Intronic
1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG + Intronic
1136237998 16:28926073-28926095 CAGGAGAAGTGATGGGAGCTGGG - Intronic
1136343369 16:29659761-29659783 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1136579763 16:31144133-31144155 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1136795893 16:33019186-33019208 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1136874028 16:33835212-33835234 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1136887350 16:33938318-33938340 CAGACACAGTGAGGGGAGGTCGG - Intergenic
1136901053 16:34038489-34038511 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1137575664 16:49598463-49598485 CAGAAGCAGTGAAGGGAAACAGG + Intronic
1137968253 16:52958281-52958303 GAGAAGGAATGAAGGAAGGAAGG + Intergenic
1138147912 16:54628653-54628675 CAGAAGGAAAGAAGGGAAGCAGG + Intergenic
1138264656 16:55651877-55651899 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1138468249 16:57210054-57210076 AAGAAGGAAGGAAGGGAGGAAGG - Intronic
1138611312 16:58127458-58127480 CAGAAGGCATGAAGAGAGGGGGG - Intronic
1138621268 16:58213088-58213110 GGGAAGGAGAGAAGGGAGGGAGG + Intergenic
1138930513 16:61649743-61649765 CATAAGGACTGAAGGCAAGTAGG - Exonic
1138972047 16:62157284-62157306 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
1139004121 16:62550443-62550465 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1139004205 16:62551270-62551292 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1139110346 16:63882842-63882864 GAGAAAGGGTGAAGGGAGGGAGG - Intergenic
1139278287 16:65748395-65748417 GAGGAGGGGTGAGGGGAGGTGGG - Intergenic
1139328449 16:66169481-66169503 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1139362519 16:66409608-66409630 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1139375828 16:66495647-66495669 TAGAAGGAAGGAAGGGAGGAAGG - Intronic
1139747566 16:69087036-69087058 CAGAAGGGGCGGTGGGAGGTGGG - Intergenic
1140088814 16:71820009-71820031 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1140123281 16:72101176-72101198 CAGAAGGAGCGCAAGAAGGTTGG + Exonic
1140225673 16:73074691-73074713 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1140230456 16:73113240-73113262 CAGAGGAAGTGAAGGGAGGAAGG + Intergenic
1140333051 16:74076386-74076408 CAGGAGGAGGGAATGGAGGATGG + Intergenic
1140338077 16:74130632-74130654 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1140394503 16:74615152-74615174 CAGAGGGAGGGAAGGAAGGACGG + Intergenic
1140771232 16:78205824-78205846 CGGAAGGAAGGAAGGAAGGTAGG - Intronic
1140771249 16:78205884-78205906 CAGGAGGAAGGAAGGGAGGATGG - Intronic
1140773317 16:78226509-78226531 GAGAAGGAGAGAAGGAAGGAAGG - Intronic
1140906686 16:79415313-79415335 CGGAAGGAGAGAAGGAAGGAGGG + Intergenic
1140944625 16:79756464-79756486 CAAAAGAAATGAAGGGAGGAAGG + Intergenic
1141469374 16:84228353-84228375 CAGCAGGAGGGAGGGGAGGGAGG - Intronic
1141647349 16:85374874-85374896 CAGGAGGAGTGACGAGAGGAAGG - Intergenic
1141734640 16:85844166-85844188 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1141756231 16:85992918-85992940 AAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141756238 16:85992961-85992983 CAGAAGGACAGAAGGGAGGAAGG - Intergenic
1141756249 16:85993025-85993047 CAGAAGGACAGAAAGGAGGAAGG - Intergenic
1141775837 16:86122000-86122022 GAGGAGGATGGAAGGGAGGTGGG - Intergenic
1141967040 16:87452671-87452693 CAGAAGCAGCCAAGGGAGGATGG + Intronic
1142366051 16:89650342-89650364 CAGAAGGAGAGGAGGGATCTAGG - Intronic
1203085103 16_KI270728v1_random:1179520-1179542 CAGACACAGTGAGGGGAGGTCGG + Intergenic
1203098151 16_KI270728v1_random:1280844-1280866 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1142542514 17:671281-671303 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1142864044 17:2779687-2779709 AAGGAGGAGTGGAGGGAGGGTGG + Intronic
1143055452 17:4158763-4158785 TAGGAGGAGGGAAGGGAGGATGG - Intronic
1143254062 17:5542824-5542846 CAGAAAGAAGGAAGGGAGGGAGG - Intronic
1143307983 17:5963043-5963065 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1143325286 17:6094608-6094630 GAGAAGGAAGGAAGGAAGGTAGG + Intronic
1143421121 17:6793152-6793174 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1143515544 17:7417698-7417720 CCGAAGGGATGAAGGGAGGGGGG - Exonic
1143552364 17:7638506-7638528 GAGATGGAGTGAGGGCAGGTGGG + Intergenic
1143628566 17:8124233-8124255 GAGGAGGAGTGAAGGGGGGAGGG + Intergenic
1143747992 17:9007593-9007615 GAGAAGGAAGGAAGGAAGGTAGG - Intergenic
1143748005 17:9007657-9007679 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1143748204 17:9009161-9009183 CAGAATGAGTGAAGTGAGGAAGG - Intergenic
1143748693 17:9012635-9012657 CAGAATGAGTGAAGTGAGGAAGG - Intergenic
1143968355 17:10773728-10773750 CTGAAGGAGTGAAGGTAAGATGG - Intergenic
1144063186 17:11601343-11601365 AGGAAGGAGGGAAGGGAGGGTGG + Intronic
1144242111 17:13322793-13322815 CAGAAGGAAGGAAGGAAGGACGG - Intergenic
1144278767 17:13703272-13703294 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1144288794 17:13805763-13805785 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1144290773 17:13824135-13824157 CAGCATGTCTGAAGGGAGGTGGG + Intergenic
1144959073 17:19034697-19034719 CAGAGGGCCTGAAAGGAGGTCGG - Intronic
1144976086 17:19139827-19139849 CAGAGGGCCTGAAAGGAGGTCGG + Intronic
1144998130 17:19285114-19285136 CAGAGGAAGTCAAGGCAGGTTGG - Intronic
1145072552 17:19823278-19823300 CTGGAGGAGTGAAGAGAGGCAGG - Intronic
1145956095 17:28855771-28855793 CTGAAGGAGGGACGGGAGGAAGG - Intronic
1145963965 17:28903740-28903762 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1146457802 17:33020825-33020847 CAGAAGGAGAGAAGGAGGGAAGG - Intronic
1146501360 17:33367570-33367592 CAGCAGGCATGAAGGGAGGCAGG - Intronic
1146955905 17:36936264-36936286 CAGAAAGAGGGACGGGAGGAGGG + Intergenic
1147058205 17:37850880-37850902 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1147292350 17:39454055-39454077 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1147411841 17:40258711-40258733 CAGAAAGAGAGGAGGGAGGGAGG + Intronic
1147610211 17:41797567-41797589 AAGAAGAAATGAAGGGAGGGAGG - Intergenic
1147736131 17:42639552-42639574 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1147869156 17:43575410-43575432 CAGCAGGAGAGAAGGAAGGGGGG - Intronic
1148051766 17:44773099-44773121 GAGGAGGAGGGAAGGGAGGGAGG - Intronic
1148102190 17:45099047-45099069 CAGAAGGGGAGGAGGGAGGAGGG + Intronic
1148334503 17:46832411-46832433 GTGGAGGAGAGAAGGGAGGTTGG + Intronic
1148370407 17:47095418-47095440 AGGAGGGAGTGAAGGGAGGGAGG + Intergenic
1148875684 17:50685804-50685826 AAGATGGAGGGAAGGGAGGAGGG - Intronic
1149013292 17:51880204-51880226 CAGGAGGAATAAAGGGAGGAGGG - Intronic
1149048241 17:52272786-52272808 GAGAAAGAGAGAAGGGAGGAGGG + Intergenic
1149450787 17:56748409-56748431 CAGCAGGAGGGAAGGCAGGAAGG - Intergenic
1149451347 17:56752256-56752278 CAGAGGGCGAGAAGAGAGGTTGG - Intergenic
1149783984 17:59420430-59420452 CAGCAGGAGTGAATGGTGTTAGG + Intergenic
1149925382 17:60697217-60697239 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
1149939375 17:60846758-60846780 AAGAAGGAATGAAGGGAGGGAGG - Intronic
1149996771 17:61409821-61409843 CAGAAGCATTGAAAGGAGATGGG - Intergenic
1150104867 17:62455293-62455315 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1150293231 17:63993441-63993463 GAGAAGGAGGGAAGGAAGGAGGG + Intergenic
1150636972 17:66919828-66919850 CAGGAGGAATGAAGGGATGTGGG - Intergenic
1150902587 17:69298210-69298232 CGGAAGGAAGGAAGGTAGGTAGG + Intronic
1151535151 17:74735161-74735183 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1151760963 17:76103094-76103116 CAGAAGGAGAGAAGGAAGAATGG + Intronic
1152239020 17:79152033-79152055 CAGGAGGGGTGATGGGAGGCTGG + Intronic
1152726931 17:81952173-81952195 CAGAAGGGTTGAAGGGAAGCAGG + Intergenic
1153246698 18:3079106-3079128 TAAAAGGAATGAAGGGAGTTGGG - Intronic
1153318926 18:3752542-3752564 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1153695213 18:7633527-7633549 CAAGAGGAGTGAAGGGAAGGTGG - Intronic
1153956572 18:10101512-10101534 CAGAAGGAATGAAGGGAGAGGGG - Intergenic
1154123275 18:11668915-11668937 CAGCAGGAAGGAAGGGAGGGAGG + Intergenic
1155277882 18:24206833-24206855 CAGAGGGAATGAATGAAGGTAGG - Intronic
1155555762 18:27017602-27017624 TAGAAGAAGGGTAGGGAGGTAGG + Intronic
1155878660 18:31117491-31117513 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1155922140 18:31614155-31614177 AGAAAGGAGTGAAGGGAGGAAGG + Intergenic
1156485693 18:37464241-37464263 GAAAAGGAGTGAAGGAAGGCAGG + Intronic
1156606400 18:38672026-38672048 CTGAAGGAGAGAAGGCAGGGTGG - Intergenic
1156889848 18:42178268-42178290 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1157028704 18:43878413-43878435 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1157119477 18:44895308-44895330 GAGAGGGAGTGAAGGAAGGAAGG + Intronic
1157126502 18:44961119-44961141 CAGAGGGAATGAAGGAAGGAGGG + Intronic
1157358304 18:46955098-46955120 CAAAAGGAAGGAAGGGAGGGAGG - Intronic
1157377162 18:47177138-47177160 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1157421357 18:47550258-47550280 AAGAAGGAAGGAAGGGAGGTAGG - Intergenic
1157543880 18:48534198-48534220 CAGAAGAAGTGAGTGGAGGGGGG - Intergenic
1157584900 18:48794665-48794687 CAGGATGATTGAAGGCAGGTGGG + Intronic
1157981563 18:52387614-52387636 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
1158528168 18:58234208-58234230 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1158528178 18:58234267-58234289 GAGAAGGGGGGAAGGGAGGGAGG - Intronic
1158669260 18:59460231-59460253 CAGGAGGAGAGAAGGGAGGGTGG - Intronic
1158776720 18:60591199-60591221 AAGAAGGAGGGAAGGGAGAAAGG - Intergenic
1158875041 18:61725472-61725494 CAGAATGAGTGGCCGGAGGTAGG - Intergenic
1159046925 18:63377612-63377634 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1159280253 18:66275584-66275606 AAGAAGGAAAGAAGGGAGGAGGG - Intergenic
1159337448 18:67088349-67088371 AAGAAGGAGGGAAGGGAAGAAGG + Intergenic
1159418804 18:68188101-68188123 CAGAAGGAAGGGAGGGAGGGAGG + Intergenic
1159463173 18:68745719-68745741 CGGGAGGCATGAAGGGAGGTAGG - Intronic
1159553099 18:69917394-69917416 CAGAAGGAGGGAAGGAAAGATGG - Intronic
1159583316 18:70258921-70258943 TAGATGGAGTGAAGGAAGGGAGG - Intergenic
1159793932 18:72819108-72819130 CAGAAGGTGGGAAGGGAGGAGGG - Intronic
1160194106 18:76738911-76738933 CAAAAGGAAGGAAGGGAGGGAGG - Intergenic
1160316403 18:77851790-77851812 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1160356118 18:78229600-78229622 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1160367071 18:78335485-78335507 CAGAAGGAGGGAGGAGAAGTAGG + Intergenic
1160397997 18:78585934-78585956 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1160820910 19:1057390-1057412 CAGCAGGAGAGCAGGCAGGTTGG - Exonic
1160872160 19:1282445-1282467 GGGAAGGAGGGAGGGGAGGTGGG + Intergenic
1160872219 19:1282593-1282615 GTGAAGGTGTGAAGGGAGGAGGG + Intergenic
1161131797 19:2594397-2594419 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
1161259920 19:3332247-3332269 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1161260181 19:3333383-3333405 GAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1161357162 19:3825529-3825551 CAGGAGGAGAGAAGAGAGGGGGG - Intronic
1161362030 19:3855835-3855857 CGGAAGGAATGAGGGGAGATGGG + Intronic
1161510517 19:4668360-4668382 CAGAAGGAGGGAGGGGAGATGGG - Intronic
1161551725 19:4916706-4916728 CGGAGGGAGAGAAGGGAGGAAGG - Intronic
1161599835 19:5174885-5174907 CGGAAGGAGGGAAGGAAGGAAGG - Intronic
1161631327 19:5357788-5357810 CAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1161643815 19:5440375-5440397 GAGAAGGAGGGAAGGAAGGGAGG + Intergenic
1161765790 19:6207862-6207884 AAGAAAGAGGGAAGGGAGGCAGG + Intergenic
1161789278 19:6349367-6349389 CAGAAGGAGGGAGGGAAGGAAGG + Intergenic
1161878096 19:6927312-6927334 AAGAAGGAAAGAAGGGAGGGAGG - Intronic
1161910744 19:7191920-7191942 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
1161910752 19:7191962-7191984 AAGAAGGAGGGAAGGAAGGAGGG + Intronic
1161914686 19:7219593-7219615 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1161920002 19:7258984-7259006 AAGAAGGAGTGAAGGAAGGAAGG - Intronic
1162136960 19:8561369-8561391 AAGAAGGGGGGAAGGGAGGGAGG - Intronic
1162215084 19:9127477-9127499 AAGAAGGAGGGAAGGAAGGGAGG - Intergenic
1162330626 19:10027089-10027111 GAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1162338970 19:10080020-10080042 AAGAAGGAATGGAGGGAGGGAGG + Intergenic
1162514476 19:11139631-11139653 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1162537732 19:11273599-11273621 CAGAAGGAAAGAAGGAAGGAAGG - Intergenic
1162697347 19:12486427-12486449 CAGAAGGAAGGAAGGAAGGAAGG + Intronic
1162841763 19:13361986-13362008 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1162865326 19:13541646-13541668 AAGAAGGAAAGAAGGGAGGGAGG + Intronic
1162875632 19:13618960-13618982 AAGAAGGAAGGAAGGAAGGTAGG + Intronic
1162879642 19:13648799-13648821 AAGAAGGAATGAAGGAAGGAGGG + Intergenic
1163020277 19:14477862-14477884 TGGAAGGAGAGATGGGAGGTGGG + Exonic
1163070067 19:14832386-14832408 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1163171172 19:15532259-15532281 AAGAAGAAGAGAAGGGAGGAGGG - Intronic
1163204864 19:15795090-15795112 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1163500991 19:17676055-17676077 CAGAGATAGGGAAGGGAGGTGGG + Intronic
1163645988 19:18489435-18489457 CAGCAGGAGTGAGTGGTGGTTGG - Intronic
1163658123 19:18559997-18560019 AAGAAGGAAGGAAGGGAGGGAGG - Exonic
1164426049 19:28142694-28142716 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1164547394 19:29179980-29180002 CAGAAGGTGGGAAGGGTGGTGGG + Intergenic
1164576157 19:29406482-29406504 CAGAAGCAGGGAAGGGTGGGAGG + Intergenic
1164744209 19:30599289-30599311 AAAAAGAAATGAAGGGAGGTAGG - Intronic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1164772034 19:30816611-30816633 AAGAAGAAATGGAGGGAGGTAGG - Intergenic
1164839257 19:31380361-31380383 AAGAAGGAGGAAAGGGAGGCTGG - Intergenic
1164932920 19:32189063-32189085 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1165051793 19:33146509-33146531 AAGAAGGAAGGAAGGGAGGAAGG - Intronic
1165054729 19:33167651-33167673 GAGAAGGAAGGAAGGAAGGTTGG - Intronic
1165068956 19:33244349-33244371 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1165367083 19:35374029-35374051 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
1165440718 19:35825312-35825334 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1165670286 19:37672432-37672454 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
1165691568 19:37867735-37867757 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1165836610 19:38760895-38760917 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1165885338 19:39074086-39074108 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1165949909 19:39468557-39468579 GTGGAGGAGTGCAGGGAGGTGGG + Intronic
1165961851 19:39541352-39541374 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
1166120469 19:40683333-40683355 CACAATGACTGAAGGGAGTTAGG + Intronic
1166145184 19:40829440-40829462 GAGAAGGAATGAAGGAAGGAAGG - Intronic
1166389712 19:42402184-42402206 CAGACGGAGTGGACGGAGGCAGG + Intronic
1166548582 19:43649671-43649693 AAGAAGGAAGGAAGGGAGGAAGG + Intronic
1166864800 19:45829311-45829333 GACAAGGAGTGAAGCGAGGAAGG + Intronic
1166871823 19:45875912-45875934 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1167022166 19:46885519-46885541 CAGAGAGAGAGGAGGGAGGTGGG - Intergenic
1167206475 19:48105865-48105887 AAGAAGGAGGGAAGGAAGGAAGG - Intronic
1167286655 19:48602221-48602243 AAGAAGGAGAGGAGGGAGGAGGG + Intronic
1167390958 19:49194664-49194686 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1167619226 19:50551873-50551895 CAGAAGGAGAGAAAGAAGGAGGG - Intronic
1167635784 19:50654622-50654644 CAGAAAGAGAGAAGGAAGGAAGG - Intronic
1167760306 19:51442736-51442758 AAGAAGGAGTTAAGGAAGGAAGG - Intergenic
1167857656 19:52255834-52255856 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1168261870 19:55199837-55199859 AACAAGGAGGGAAGGGAGGAAGG + Intronic
1168348427 19:55661951-55661973 GAGGAGGAGTGTAGGGAGGAGGG - Intronic
1168427861 19:56253312-56253334 CAGAAGGTGGGCAGGGAGGAGGG + Intronic
1168526432 19:57092106-57092128 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1168532085 19:57138069-57138091 AGGAAGGAAAGAAGGGAGGTAGG + Intronic
1168695604 19:58402301-58402323 CAGAAGGAGCAGAGGGTGGTGGG + Intronic
924999268 2:392203-392225 CAGAAACAGCGAAGGGGGGTGGG + Intergenic
925032224 2:659715-659737 AGGAAGGAGGGAAGGTAGGTAGG + Intergenic
925225862 2:2183736-2183758 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
925258739 2:2511658-2511680 GAAAAGGAGGAAAGGGAGGTGGG - Intergenic
925392775 2:3508994-3509016 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
925508454 2:4596969-4596991 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
925636170 2:5943004-5943026 CTGAAGGAGAGATGGGAGGTTGG - Intergenic
925684083 2:6453297-6453319 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
925806175 2:7650936-7650958 CAAAAGGAAGGAAGGGAGGAAGG - Intergenic
925826663 2:7855719-7855741 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
926370437 2:12173271-12173293 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
926623976 2:15074412-15074434 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
926797042 2:16627709-16627731 CAAAAGGAGAGAAGGAAGATAGG + Intronic
927060657 2:19416372-19416394 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
927081328 2:19633749-19633771 CAGGAGGAGGGAAGGGATGCTGG - Intergenic
927769371 2:25845716-25845738 CACAGGTAGTGAAGGGATGTGGG - Intronic
927782224 2:25948731-25948753 GGGAAGGAATGAAGGGAGGGAGG + Intronic
927877193 2:26665752-26665774 GAGAAGGAATGAAGGAAGGTAGG - Intergenic
927877894 2:26670862-26670884 AGGAAGGAGGGAAGGGAGGAGGG + Intergenic
928017684 2:27673467-27673489 GAGAAGGAAGGAAGGGAGGAAGG - Intronic
928183830 2:29091477-29091499 CAGAAGAAGTGTGGGGAGGTGGG - Intergenic
928269315 2:29842071-29842093 GAGAAGGAGGGAAGGAAGGAGGG - Intronic
928309504 2:30197764-30197786 ATGAAGGTGTGAAGTGAGGTGGG - Intergenic
928312624 2:30223157-30223179 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
928424876 2:31169536-31169558 CAGAGTGAGTGGTGGGAGGTGGG - Intergenic
928572931 2:32627091-32627113 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
928610948 2:32992325-32992347 CATCAGGAGGGAAGGGAGATAGG + Intronic
928704524 2:33933511-33933533 AGGAAGGAGGGAAGGGAGGGAGG - Intergenic
928746728 2:34424752-34424774 GAGAAGGAGAGAAAGGAGGGGGG + Intergenic
928756040 2:34526808-34526830 GAAAAGGAGTGAAGAGGGGTAGG + Intergenic
928785739 2:34884017-34884039 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
929072655 2:38049255-38049277 TAGAAGGAAGGAAGGGAAGTTGG + Intronic
929089601 2:38201765-38201787 AAGAAGGAGAGAAGGAAGGAAGG + Intergenic
929336698 2:40756647-40756669 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
929669044 2:43854710-43854732 GGGAAGGAATGAAGGGAGGGTGG + Intronic
929803724 2:45126756-45126778 TAGAAGGAGAGAAGGAGGGTGGG - Intergenic
930136261 2:47906178-47906200 GAGAGGGAGAGAAGGGAGGGAGG + Intergenic
930366559 2:50446538-50446560 AAGAAGGAGGGAAGGAAGGGAGG - Intronic
930926644 2:56826281-56826303 AAGAACAAGTGAAGAGAGGTAGG - Intergenic
931581924 2:63785271-63785293 CAGAGGGGGAGAAGGGAGGAAGG - Intronic
931710737 2:64988017-64988039 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
931787504 2:65633369-65633391 GAGAAGGGGAGAAGGGAGGATGG - Intergenic
931996501 2:67844010-67844032 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
932071618 2:68626377-68626399 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
932331105 2:70898942-70898964 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
932411385 2:71549911-71549933 CAGAAGGTGTTGAAGGAGGTGGG + Intronic
932436099 2:71703322-71703344 GAGGAGGAGAGAAGGGAGGAGGG + Intergenic
932498624 2:72160400-72160422 CAGAACGAGTGTAGGTAGGAGGG - Intergenic
932501923 2:72190010-72190032 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
933069301 2:77836936-77836958 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
933069323 2:77837015-77837037 GAGAGGGAGGGAAGGGAGGGAGG + Intergenic
933431520 2:82185981-82186003 CGGAAGGAAGGAAGGGAGGGAGG + Intergenic
934123425 2:88862749-88862771 TCTAAGGAGTGTAGGGAGGTGGG - Intergenic
934124209 2:88870704-88870726 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
934536125 2:95135381-95135403 AAGAAGGAGGGAAGGAAGGAAGG - Intronic
934547144 2:95227141-95227163 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
934713120 2:96528336-96528358 CAGAAGGAGGGAAGGCAAGGGGG + Intergenic
934883055 2:97999931-97999953 GAGAAAGAGAGAAGGGAGTTTGG - Intergenic
934903099 2:98176518-98176540 CAGAAGGAAAGAAGGAAGGAGGG - Intronic
934916924 2:98307908-98307930 CAGAAGGAAGGAAAGGAGGTTGG - Intronic
934996681 2:98968094-98968116 AAGAGGGAATGAAGAGAGGTTGG - Intergenic
935504042 2:103876862-103876884 CAGACGGTGTGCAGGGAGCTGGG - Intergenic
935740421 2:106142665-106142687 CAGAAAGAGTGAAGAGATGGAGG + Intronic
935810563 2:106793179-106793201 CAGAAAGAGTGAAGAGGGGAGGG + Intergenic
936501250 2:113068093-113068115 CAGGAGGAGTGAAGGGATAGAGG - Intronic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
936931305 2:117792004-117792026 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
937025759 2:118695939-118695961 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
937089168 2:119194118-119194140 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
937289535 2:120773873-120773895 GGGAGGGAGGGAAGGGAGGTAGG - Intronic
937363469 2:121244669-121244691 CAGTAGGAGAGAATTGAGGTAGG - Intronic
937677068 2:124603038-124603060 AAGAAGGAAGGAAGGAAGGTAGG - Intronic
937848450 2:126608470-126608492 CAGAAAGAGTGAAGTGAGATGGG + Intergenic
937904618 2:127046832-127046854 AGGAGGGAGTGAAGGAAGGTAGG + Intergenic
938092039 2:128440577-128440599 CAGAAGGGGAGAGGGGAGGCTGG + Intergenic
938145577 2:128832458-128832480 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
938269754 2:129959257-129959279 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
938519116 2:132048624-132048646 AAGAAGGAGAGAAGGAAGGAAGG - Intergenic
938588127 2:132711815-132711837 GAGAAGGAAGGAAGGGAGGCAGG - Intronic
938757897 2:134397491-134397513 CTGGAGGAGAGAAAGGAGGTGGG + Intronic
938761044 2:134426217-134426239 CGGAAGGAATGAAGGAAGGAAGG - Intronic
938837306 2:135119091-135119113 CAGAAGGAAGGAAGGAAGGGAGG - Intronic
939144015 2:138390731-138390753 CAGATGGCGTGGAGGGAGGGCGG - Intergenic
939212734 2:139197790-139197812 AAGAAGGAGTGTAGGGAAGAGGG + Intergenic
939434169 2:142152652-142152674 AAGAAGAAGCGAAGGGAGGAAGG - Intergenic
939475273 2:142678789-142678811 CAGTAGAAGTGCTGGGAGGTTGG + Intergenic
939634261 2:144561873-144561895 CAGAATGATTGAAGTGAAGTGGG + Intergenic
939733899 2:145819456-145819478 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
939733924 2:145819564-145819586 CACAAGGAAGGAAGGGAGGAAGG - Intergenic
939761735 2:146190914-146190936 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
939988866 2:148858740-148858762 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
940068203 2:149653665-149653687 CTCAATGAGGGAAGGGAGGTTGG - Intergenic
940159588 2:150696962-150696984 AAGAAGGAAGGAAGGAAGGTAGG + Intergenic
940242555 2:151578697-151578719 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
940520393 2:154738266-154738288 CAGAGGCTGGGAAGGGAGGTGGG + Intronic
940578449 2:155546147-155546169 AAGAAGGAAAGAAGGGAGGAGGG + Intergenic
940710342 2:157155193-157155215 CAGAAAGAGAGAAGGGGGGTGGG + Intergenic
940983381 2:160027246-160027268 CAGAAGGAAAGAAGGGTGGCAGG + Intronic
941179401 2:162240098-162240120 AAGAAAAAGTGAATGGAGGTAGG + Intronic
941201202 2:162513201-162513223 GGGAAGGAGGGAAGGGAGGAAGG - Intronic
941408796 2:165126603-165126625 CGGAAGGAATGAAGGAAGGAAGG - Intronic
941408812 2:165126661-165126683 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
941446078 2:165601669-165601691 GGGAAGGAGAGAAGGGAGGGAGG - Intronic
941737458 2:168994756-168994778 CAGTTGGAGTGAAGAGAGCTTGG + Intronic
941809244 2:169739009-169739031 CAGAAGGAGGGAGAGGAGATGGG - Intronic
941915463 2:170810259-170810281 CAGAGGGAGAGAATGAAGGTAGG + Intergenic
942135991 2:172925971-172925993 CAGAGGGAGGGAAGGGAGGAAGG + Intronic
942175427 2:173329108-173329130 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
942211761 2:173678259-173678281 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
942328870 2:174800641-174800663 CAGCCAGAGTGAAGGGAGGGTGG - Intronic
942341961 2:174958161-174958183 CAGGAGGAGAGAAGGAAGGGAGG + Intronic
942833636 2:180266050-180266072 AAGAAGGAGGGAAGGGATGAAGG + Intergenic
942914617 2:181289819-181289841 GAGAAGGAAAGTAGGGAGGTAGG - Intergenic
943016459 2:182516679-182516701 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
943180968 2:184540459-184540481 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
943503948 2:188730110-188730132 AAGAAGGAAAGAAGGGAGGAAGG - Intergenic
943660950 2:190558655-190558677 GAGAAGGAGTGAAGAGAAGTAGG + Intergenic
943720080 2:191194798-191194820 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
943888797 2:193258423-193258445 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
944101970 2:196036749-196036771 CAGCAATAGTGAAGGCAGGTTGG - Intronic
944775570 2:202960745-202960767 GAGAAGGAGGGAAGGCAGGAAGG - Intronic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945057494 2:205881277-205881299 GAGAGGGAGGGAAGGGAGGGAGG + Intergenic
945317337 2:208383940-208383962 CGGGAGGAGTGAATGGAGGATGG + Intronic
946012899 2:216580693-216580715 CAGGAGGAAGGAAGGGAGGAAGG - Intergenic
946730766 2:222707273-222707295 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
946770123 2:223080267-223080289 GAGAAGGAAGGAAGGGAGGAAGG - Intronic
947062495 2:226182165-226182187 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
947544272 2:231000334-231000356 CAGAAGGAGAGAGGTGAGGGAGG - Intronic
947671110 2:231936034-231936056 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
947713021 2:232326487-232326509 GAGTAGGAGTGAATGAAGGTGGG - Intronic
947730512 2:232427134-232427156 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
947807399 2:232977973-232977995 AAGCAGGAGTGAAGCCAGGTTGG + Intronic
947926900 2:233929371-233929393 CAGAAGGTGAGAAGGGAAGGGGG + Intronic
947948694 2:234128944-234128966 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
948175823 2:235942011-235942033 CAAGAGGAGTGCAGGGAGGATGG - Intronic
948282725 2:236760318-236760340 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948582635 2:238998274-238998296 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
948612028 2:239176117-239176139 CAGAAGGAGTGAGTGCAGGAGGG - Intronic
948650327 2:239439792-239439814 CAGGAGGAGAGAAGGGACGCCGG + Intergenic
948774515 2:240276642-240276664 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
948786952 2:240357665-240357687 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
948879653 2:240850340-240850362 CAGGAGCAGTGAAGGGCGGTGGG + Intergenic
1168805784 20:671636-671658 CAGAGGGAGTGAGAGGAAGTGGG + Intronic
1168983999 20:2032052-2032074 CAGCAGGAGAGAAGGCAGGGGGG - Intergenic
1169001483 20:2171089-2171111 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1169246355 20:4028247-4028269 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1169314657 20:4580190-4580212 AAGAAGGAAGGAAGGAAGGTAGG - Intergenic
1169507888 20:6232951-6232973 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1169597875 20:7221169-7221191 CAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1169598412 20:7227398-7227420 CAGAAGGAAGGAAGGAAGGGAGG + Intergenic
1169611285 20:7382788-7382810 GAGCAAGAGTGAAGGGAGGAAGG - Intergenic
1169766755 20:9154947-9154969 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
1169787182 20:9371487-9371509 CAAAAGGAAGGAAGGGAGGAAGG - Intronic
1169996241 20:11560216-11560238 GAGAAGGAATGAAGAGACGTTGG + Intergenic
1170034017 20:11971159-11971181 GAGAAGGAGGGAAGAGAGGAGGG - Intergenic
1170140934 20:13124336-13124358 AAGAAGGAAGGAAGGGAGGAAGG + Intronic
1170272153 20:14539372-14539394 AAGCAGGAGTCAAGGGAGGATGG - Intronic
1170384321 20:15799426-15799448 GAGGAGGAATGAAGGGAGGTTGG - Intronic
1170430204 20:16268593-16268615 CAGAAGGAAGGAAGGAGGGTGGG - Intergenic
1170501808 20:16982422-16982444 AAGCAGGAGGGAAGGGAGGGAGG - Intergenic
1170501820 20:16982458-16982480 AAGAAGGAGGGAAGGAAGGGAGG - Intergenic
1170631777 20:18072397-18072419 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1170631796 20:18072462-18072484 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1171007028 20:21476393-21476415 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1171085881 20:22237990-22238012 CAGAGGGAGGGAAGGAAGGAAGG - Intergenic
1171199016 20:23226239-23226261 AAGAAAGAATGAAGGGAGGAAGG + Intergenic
1171364506 20:24614604-24614626 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1172180682 20:33001658-33001680 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1172246125 20:33446194-33446216 AGGAAGGAGAGAAGGGAGGCAGG + Intergenic
1172693213 20:36804515-36804537 CAGAGGAAGGGAAGGAAGGTGGG - Intronic
1172843604 20:37916362-37916384 CACAAGGAGTGAGAGCAGGTGGG - Intronic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1172937394 20:38630028-38630050 GAGGAGGAGGGAAGGGAGGGAGG - Intronic
1172974555 20:38896154-38896176 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1173201657 20:40959490-40959512 GAGAAGGAGAGAAGGAAGGAAGG + Intergenic
1173201661 20:40959498-40959520 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1173201671 20:40959542-40959564 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1173201677 20:40959566-40959588 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1173465960 20:43281630-43281652 CAGTAGGAGAGAGGGGAAGTGGG - Intergenic
1173563562 20:44023105-44023127 AAGAAGGAAGGAAGTGAGGTAGG + Intronic
1173600618 20:44292451-44292473 CAGAGAGAGAGAAGGGAGGGAGG + Intergenic
1173695248 20:45005065-45005087 CAGAAGGAAAGAAAGGAGGCTGG - Intronic
1173722032 20:45267849-45267871 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1173844843 20:46181620-46181642 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1174140875 20:48412752-48412774 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1174164558 20:48575658-48575680 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1174474648 20:50787762-50787784 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1174589461 20:51633845-51633867 CAGAAAGAGGGAAGGAAGGGAGG + Intronic
1174613563 20:51818831-51818853 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1174682532 20:52422649-52422671 CAGAGGCTGGGAAGGGAGGTAGG - Intergenic
1174779183 20:53372510-53372532 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1174790018 20:53469547-53469569 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
1174829970 20:53803591-53803613 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
1175076888 20:56382882-56382904 AAGAGGGAGTGAAGGGACCTGGG + Intronic
1175120989 20:56716241-56716263 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1175157255 20:56979445-56979467 CAGAAGGACTGAAGGCAGTGTGG + Intergenic
1175423046 20:58847749-58847771 TAGAGAGAGGGAAGGGAGGTGGG - Intronic
1175474924 20:59265440-59265462 GGGAAGGAATGAAGGGAGGAAGG - Intergenic
1175474946 20:59265548-59265570 GAGAAGGAATGAAGGGAGGAAGG - Intergenic
1175474961 20:59265619-59265641 AAGAAGGAGGGAAGGGAGGGAGG - Intergenic
1175495145 20:59409205-59409227 CAGAATGAATCAAGGGAGGAAGG + Intergenic
1175551618 20:59821586-59821608 AAGAAGGGGAGAAGGGAGATGGG + Intronic
1175791448 20:61742794-61742816 CTGGAGCCGTGAAGGGAGGTTGG + Intronic
1175927332 20:62477330-62477352 CAAAAGGAAGGAAGGGAGGGAGG - Intergenic
1176184595 20:63771381-63771403 CAGAAGGAGGGGAGGGAGAGAGG + Intronic
1176513709 21:7767469-7767491 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1176882384 21:14213318-14213340 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1177121182 21:17138812-17138834 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
1177148645 21:17432729-17432751 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1177169725 21:17641662-17641684 CAGAAGGAGGCTAGAGAGGTGGG + Intergenic
1177237351 21:18409882-18409904 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1177347981 21:19898860-19898882 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
1177376305 21:20274561-20274583 CGGAAGGAGGGAAGGAAGGAAGG + Intergenic
1177565175 21:22810968-22810990 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1178002127 21:28174284-28174306 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1178132604 21:29590517-29590539 CAAAGGGAGCCAAGGGAGGTGGG + Intronic
1178170016 21:30030159-30030181 AAGAAGAATAGAAGGGAGGTTGG + Intergenic
1178647822 21:34397993-34398015 GAGAAGGAAGGAAGGGAGGGAGG - Intronic
1178791566 21:35705045-35705067 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
1178900469 21:36593979-36594001 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1179073161 21:38092074-38092096 AAGAAGGATAGAAGGGAGGGAGG - Intronic
1179166528 21:38939392-38939414 GAGAAGGAATGAAGGGAAGGGGG + Intergenic
1179176564 21:39011979-39012001 GAGAAGCAGTGTGGGGAGGTGGG + Intergenic
1179226592 21:39459191-39459213 AAGAAGGAAGGAAGGTAGGTAGG - Intronic
1179286693 21:39983780-39983802 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1179296840 21:40070318-40070340 TAGAAGGAAAGAAGGAAGGTAGG + Intronic
1179508377 21:41856284-41856306 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1179711466 21:43265885-43265907 CAGACGGAGTGAGCGGAGGCTGG - Intergenic
1179953284 21:44723765-44723787 CAGAACTAGGGAAGGGAGGCGGG + Intergenic
1180700889 22:17780975-17780997 CAGAAGGAATGAGGGGTGGAGGG + Intergenic
1180888844 22:19270429-19270451 GAGAAGGAGTGAATGTTGGTCGG + Intronic
1180938557 22:19641897-19641919 GAGAAGGAGAGGAGGGAGGAGGG + Intergenic
1181165504 22:20980969-20980991 CTGCAGGAGTGAGGGGAGGAGGG - Intronic
1181295007 22:21830741-21830763 CAGAAGGAATGAAGGAAATTGGG + Intronic
1181374841 22:22449087-22449109 CATAAGAAGTGAAGGGCTGTTGG - Intergenic
1181583356 22:23839734-23839756 GGGAAGGAGGGAAGGAAGGTGGG - Intergenic
1181733675 22:24865770-24865792 GAGAAGGAAGGAAGGAAGGTTGG + Intronic
1181979035 22:26752963-26752985 CTGGAGGAGTGAAGGGTGGGGGG + Intergenic
1182009781 22:26990744-26990766 CAGAAGGGGTGGAGAGCGGTTGG - Intergenic
1182033168 22:27176079-27176101 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
1182083220 22:27543652-27543674 AAGGAGGAGGGAAGGGAGGAGGG - Intergenic
1182086701 22:27565778-27565800 CAGAAGGAAGGAAGGGAGAAAGG + Intergenic
1182087009 22:27568299-27568321 CAGAAAGAGAGAAGGAAGGAAGG + Intergenic
1182711789 22:32327833-32327855 CAGAGGGTGTGCAGGGAGGCCGG - Intergenic
1182754575 22:32668491-32668513 GGAAAGGAGTGAAGGGAGGAGGG - Intronic
1182783740 22:32889181-32889203 CAAAAGGAGTGTAGGGATCTTGG + Intronic
1182815604 22:33160836-33160858 CAGGCTGAGTGAAGGGAAGTTGG + Intergenic
1182860630 22:33556505-33556527 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1182916429 22:34037003-34037025 GAGAAGAAGTGAATGGAGGGTGG - Intergenic
1182957678 22:34442574-34442596 CAGAAGGAGAGAGTGGAGTTAGG - Intergenic
1183085395 22:35483753-35483775 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1183209729 22:36443404-36443426 GGGAAGGAGTGAAGGGAGGGAGG - Intergenic
1183304638 22:37075948-37075970 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1183613063 22:38923717-38923739 GGGAAGGAGAGAAGGGAGGGAGG - Intergenic
1183613078 22:38923766-38923788 GGGAAGGAGAGAAGGGAGGGAGG - Intergenic
1183661422 22:39223841-39223863 CAGTAGGTGGGAAGGGAGGTGGG + Exonic
1183799699 22:40151937-40151959 CAGAAGGAGAGAACAGAAGTTGG + Intronic
1183877260 22:40793990-40794012 TGTAAGGAGAGAAGGGAGGTGGG + Intronic
1184067303 22:42128102-42128124 CAGGAGGAATGAGGGGAGGCTGG - Intronic
1184070030 22:42141796-42141818 CAGGAGGAATGAGGGGAGGCTGG - Intergenic
1184149751 22:42631161-42631183 CAGCAGGAGTGAAGGCATGGAGG - Intronic
1184219751 22:43092094-43092116 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1184463770 22:44657330-44657352 AAGAAGGAGAGAAGGAAGGAAGG + Intergenic
1184505637 22:44900087-44900109 GAGAAGGAGGGAAAGAAGGTGGG - Intronic
1184596309 22:45516228-45516250 GAGAAGGGGTGAAGGGAGTGTGG + Intronic
1184762474 22:46552341-46552363 CAGAAGGCGTGAAGGCAGGAAGG - Intergenic
1185006792 22:48282778-48282800 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1185031135 22:48443586-48443608 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1185135788 22:49071387-49071409 AAGAAGGAAGGAAGGGAGGTGGG - Intergenic
1203237723 22_KI270732v1_random:21974-21996 GAGAAGGAGGGAAGGAAGGATGG + Intergenic
1203290094 22_KI270735v1_random:28269-28291 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
949148220 3:730489-730511 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
949167891 3:962734-962756 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
949459317 3:4273674-4273696 CAGAAAGAAGGAAGGGAGGGAGG + Intronic
949647191 3:6109529-6109551 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
949837526 3:8285523-8285545 CAGAAGGTGGAAAGGGAGGTAGG - Intergenic
950153196 3:10704045-10704067 CAGAGGGAGTGAGGGGAAGATGG - Intronic
950284243 3:11732335-11732357 CAGAAGGAAGGAAGGCAGGGAGG - Intergenic
950582054 3:13868870-13868892 CAGAGGGAGAGAAGGAAGGAGGG + Intronic
950651719 3:14411360-14411382 AATAAGGAGTGATGGGAGGAAGG - Intronic
951477818 3:23127002-23127024 CAGAAGGAGAGAAGAGAGAATGG - Intergenic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951587851 3:24233508-24233530 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
951851719 3:27148730-27148752 TGGTAGGAGTAAAGGGAGGTAGG - Intronic
951900927 3:27656826-27656848 AAGAAGGAGTCTAGGGAGGAGGG + Intergenic
952018942 3:28993673-28993695 CAGAAGGAATAAAGGGAGAGAGG - Intergenic
952075048 3:29685844-29685866 CAGAAGGTGTGGGGAGAGGTGGG - Intronic
952215043 3:31270058-31270080 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
952370774 3:32720852-32720874 AGGAAGGAGGGAAGGGAGGAAGG - Intronic
952417443 3:33102200-33102222 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
952585793 3:34890235-34890257 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
952965179 3:38616721-38616743 CAGAAAGAGCAAAGGGTGGTGGG + Intronic
953072452 3:39534897-39534919 AGGAAGGAGGGAAGGGAGGAAGG - Intergenic
953434248 3:42865967-42865989 CAGAAGGAAGGAAGGAAAGTAGG - Exonic
953482396 3:43262678-43262700 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
953640316 3:44701019-44701041 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
953771317 3:45780296-45780318 CAGAAGGTGAGGAGGGAGGTTGG - Intronic
953814578 3:46144046-46144068 CCAAAGCAGTGGAGGGAGGTAGG - Intergenic
954315164 3:49797264-49797286 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
954336694 3:49922553-49922575 AAGAAGGAGGGAAGGAAGGAGGG + Intronic
954338057 3:49931590-49931612 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
954368307 3:50157394-50157416 GAGAAGGAGGGAAGGAAGGCTGG - Intronic
954535819 3:51358560-51358582 CAGAGGGAGAAAAGGGAGTTGGG - Intronic
954793232 3:53148051-53148073 CAGAGGGTGTGAAGAGAGCTTGG - Intergenic
954802324 3:53194369-53194391 CAGAGGCAGTGGAGGGTGGTGGG + Intergenic
954903918 3:54043677-54043699 AAGAAGGAGGGAAGAGAGGCAGG + Intergenic
955166397 3:56518459-56518481 AGGAAGGAGTGAAGGAAGGAAGG + Intergenic
955184317 3:56700655-56700677 GAGAAGGAATGAAGGAAGGAAGG - Intergenic
955467698 3:59253816-59253838 AGGAAGGAGGGAAGGGAGGGAGG - Intergenic
955622931 3:60885054-60885076 CAAGAGGGGTGAAGAGAGGTTGG + Intronic
955823768 3:62923596-62923618 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
955870939 3:63437624-63437646 GAAAGGAAGTGAAGGGAGGTAGG + Intronic
955874651 3:63476387-63476409 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
956048500 3:65222119-65222141 CAGCAGGAGTAAAGGCATGTCGG + Intergenic
956057759 3:65318574-65318596 CATGTGGAGTGAAGTGAGGTAGG - Intergenic
956171965 3:66440027-66440049 AAAAAGGAGTGGAGGGAGGTGGG + Intronic
956191536 3:66612829-66612851 AAGAAGGAAGGAAGGAAGGTAGG - Intergenic
956474108 3:69601034-69601056 CAGAGGAAGTGAAGGCAGTTTGG + Intergenic
956679651 3:71766483-71766505 CAGAAGGGGTGGAGGTAGGTGGG + Intergenic
956799228 3:72741598-72741620 AAGAAGGAGTGAGAGGAGATAGG + Intergenic
956994070 3:74803416-74803438 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
957059413 3:75470001-75470023 CAGAGTCAGTGAAGGGAGATAGG + Intergenic
957121446 3:76099772-76099794 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
957569276 3:81925283-81925305 CAGAAGGTGTGAAGGTTCGTGGG + Intergenic
958094893 3:88931289-88931311 AGGAAGGAGGGAAGGGAGGGTGG - Intergenic
958111979 3:89159928-89159950 AAGAAGGAAGGAAGGGAGGAAGG - Intronic
958117132 3:89234849-89234871 GAGAAGGAAAGAAGGGAGGAAGG - Intronic
958117139 3:89234882-89234904 GAGAAGGAAAGAAGGGAGGAAGG - Intronic
958253586 3:91298876-91298898 GAGAGGGAGGGAAGGGAGGAGGG - Intergenic
958729473 3:97946394-97946416 CATGGGGAGTGAAGGGAGATAGG - Intronic
958829735 3:99072811-99072833 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
959305099 3:104653337-104653359 GAGAAGGGGTGAAGAGAGGTTGG - Intergenic
959345849 3:105193336-105193358 CAGAAGGAGGGAAAGCATGTTGG + Intergenic
959368102 3:105488725-105488747 GAGAAGGAGGGAGGGGAGGAAGG + Intronic
959416292 3:106079158-106079180 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
959773162 3:110124347-110124369 AAGAAGGTGAAAAGGGAGGTAGG + Intergenic
960110028 3:113837072-113837094 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
960256343 3:115515411-115515433 CAGAAGGAAGCAAGAGAGGTGGG + Intergenic
960309644 3:116105454-116105476 CAGAGTCAGCGAAGGGAGGTAGG + Intronic
960902419 3:122565534-122565556 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
961064444 3:123862788-123862810 AAGTAGGGGAGAAGGGAGGTGGG - Intronic
961337133 3:126187319-126187341 CAGAAGGAAGGAAGGGAGGGTGG + Intronic
961522755 3:127476713-127476735 AGGAAGGAGAGAAGGGAGGAAGG + Intergenic
961532368 3:127547474-127547496 CAGGAGGGGTCAAGGGAGGAGGG + Intergenic
961812064 3:129527700-129527722 AAGATGGAGTGGAGGGAGGGAGG - Intergenic
961861465 3:129919592-129919614 AGGAAGGAGAGAAGGGAGGGAGG - Intergenic
961911915 3:130326571-130326593 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
961961541 3:130860737-130860759 AGGAAGGAGTGAAGGGAAGAAGG - Intronic
961966005 3:130903618-130903640 CAGAAGGAAAGAAGGGAGGGAGG - Intronic
962198373 3:133381706-133381728 CAGAAGGAGAGAAGAGGGGCAGG - Intronic
962404939 3:135092626-135092648 CAGAAGGAAAGAAGGAAGGAAGG - Intronic
962437789 3:135382660-135382682 AGGAAGGAGGGAAGGGAGGAAGG + Intergenic
962503953 3:136027178-136027200 AAGAGGCAGTGAAGGGGGGTGGG - Intronic
962712977 3:138102923-138102945 AAGCAGGAGTGGAGGCAGGTGGG + Intronic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
962914649 3:139888901-139888923 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
962949516 3:140205000-140205022 CAGGAGGGGTGAGGGGAGGTGGG + Intronic
962987590 3:140549712-140549734 CATGAGGAGTAAAGGGAGGGAGG - Intronic
962987753 3:140551167-140551189 CATGAGGAGTAAAGGGAGGGAGG - Intronic
963110209 3:141682319-141682341 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
963299346 3:143581503-143581525 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
963359228 3:144249157-144249179 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
963471827 3:145750621-145750643 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964629275 3:158792158-158792180 CACAAGAAGTGAAGGGAGTCAGG - Intronic
964677843 3:159303522-159303544 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
964746812 3:160020287-160020309 AAGAAGGAGGGAAGGCAGGCAGG + Intronic
965171036 3:165265420-165265442 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
965171111 3:165265665-165265687 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
965171123 3:165265695-165265717 CGGGAGGGGTGAAGGGAGGGGGG - Intergenic
965186932 3:165476621-165476643 GAGAGGGAGGGAAGGGAGGAAGG + Intergenic
965189890 3:165514676-165514698 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
965276941 3:166696030-166696052 CTGAAGGGGTGAATGGAGCTAGG - Intergenic
965351321 3:167614994-167615016 CAGAAGGAGGAAAGGCAGGATGG - Intronic
965355427 3:167667298-167667320 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
965490843 3:169333904-169333926 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
965814731 3:172624669-172624691 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
966140486 3:176751654-176751676 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
966142193 3:176769086-176769108 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
966192530 3:177284444-177284466 CAGAAAGAGGGAAGGGTGGGAGG - Intergenic
966273876 3:178141525-178141547 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
966508879 3:180737935-180737957 GAGGAGGAGAGAAGGGAGATGGG + Intronic
966936486 3:184712963-184712985 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
967109475 3:186280993-186281015 CAGAATAAGGGAAGGAAGGTGGG - Intronic
967299866 3:188002327-188002349 AAGAAGGAGTGAAGGAAGCCTGG - Intergenic
967390350 3:188948513-188948535 CAGGAGGAGTTAAGGGAGTGGGG + Intronic
967482678 3:189991937-189991959 CAAAAGGGGTGGAGGGAGTTAGG + Intronic
967543614 3:190697783-190697805 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
967627069 3:191699481-191699503 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
967716281 3:192765572-192765594 GAGAAGCAGAGAAGAGAGGTTGG - Intronic
967726745 3:192869328-192869350 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
967746833 3:193065696-193065718 CAGGAGGAAAGAAGGGAGGGAGG + Intergenic
967829965 3:193910132-193910154 CCGAAGGAGTGAAGGTGGATGGG - Intergenic
967861832 3:194157987-194158009 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
967862687 3:194163923-194163945 CAGGAGGAGGAAAGGGAGGAGGG - Intergenic
967864545 3:194179506-194179528 CAGATCGGGTGAAGGGATGTGGG - Intergenic
967898239 3:194418033-194418055 AAGAAGGAATGAAGGAAGGAAGG + Intronic
967964730 3:194951979-194952001 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
968074609 3:195809626-195809648 GAGAAGGAGTGAAGGACTGTTGG - Intronic
968468854 4:767467-767489 CCCAAGGAGTGGAGGGAGGAGGG - Exonic
968797739 4:2719787-2719809 CAGAAGGAAGGAAGGGAGGGAGG - Intronic
968831740 4:2935607-2935629 TAGAAGGTGGGAGGGGAGGTGGG - Intergenic
968921375 4:3523904-3523926 CAGGAGGAGGAAACGGAGGTGGG + Intronic
969004101 4:4005508-4005530 AAGAGTGAGTGAAGGGAGATGGG + Intergenic
969207180 4:5655752-5655774 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
969222413 4:5769881-5769903 CAGAAGAAGTGAAGGTGGTTTGG - Intronic
969329429 4:6464898-6464920 GAGAAGGAAGGAAGGGAGGAAGG + Intronic
969440914 4:7216247-7216269 AAGCAGCAGTGAGGGGAGGTGGG + Intronic
969467422 4:7366085-7366107 CAGGAGGAGTGCCGGGGGGTGGG + Intronic
969504297 4:7574622-7574644 AGGAAGGAGAGAAGGGAGGAAGG + Intronic
969505348 4:7583344-7583366 TAGCAGGAGTGTAGGGGGGTTGG - Intronic
969616055 4:8253151-8253173 TAGAAGGAGAGAAGAGAGGCAGG - Intergenic
970137852 4:12945742-12945764 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
970155976 4:13142236-13142258 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
970346006 4:15152788-15152810 GAAAAGGAGTGAAGGGAGAATGG - Intergenic
970404379 4:15748310-15748332 TAGAAGCAGTGAAGGGAGACAGG + Intergenic
970488198 4:16545217-16545239 CAGAAGGAAGGGAGGGAGGGGGG - Intronic
970499306 4:16661098-16661120 CAGGGTGAGTGTAGGGAGGTGGG - Intronic
970690293 4:18612516-18612538 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
970810785 4:20091633-20091655 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
970915025 4:21322151-21322173 CAGAAGGAAGGAAGGAAGGAAGG + Intronic
971103622 4:23497532-23497554 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
971188673 4:24405905-24405927 AAGAAGGAGGGAAGGAAGGAGGG - Intergenic
971357941 4:25911974-25911996 CAGAAGGAGGGCTGAGAGGTGGG - Intronic
971360579 4:25934517-25934539 AAGAATGAGTGAATGGAGGAAGG + Intergenic
971584214 4:28384485-28384507 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
971663389 4:29449980-29450002 AGGAAGGAAGGAAGGGAGGTAGG + Intergenic
971843182 4:31881067-31881089 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
971915689 4:32867545-32867567 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
972004528 4:34083164-34083186 AACAAGGAATGAAGGGAGGGAGG - Intergenic
972055518 4:34797169-34797191 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
972090035 4:35269979-35270001 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
972103149 4:35447504-35447526 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
972378597 4:38497821-38497843 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
972415742 4:38838902-38838924 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
973016292 4:45142860-45142882 AAGAAGGAAAGAAGGGAGGGAGG - Intergenic
973016303 4:45142911-45142933 AAGAAGGAAAGAAGGGAGGGAGG - Intergenic
973016320 4:45142963-45142985 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
973016328 4:45143008-45143030 TGGAAGGAAAGAAGGGAGGTAGG - Intergenic
973124445 4:46566917-46566939 AAGAAGAAGAGAAGGGAGGAAGG + Intergenic
973792306 4:54389813-54389835 GAGAAGGAGTGAATGGAGGGTGG - Intergenic
973886303 4:55325445-55325467 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
973953758 4:56042503-56042525 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
974222346 4:58991809-58991831 AAGAAGGAATGAAGGAAGGTAGG + Intergenic
974444443 4:61961253-61961275 CAGAAGGAGGGAAAGCAAGTGGG - Intronic
974757243 4:66225645-66225667 CAGAAGGAGGGAAGGAAGGGAGG + Intergenic
975029632 4:69599590-69599612 AAGAAGGAAGGAAGGGAGGAAGG + Intronic
975383330 4:73727522-73727544 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
975455922 4:74589531-74589553 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
975952939 4:79796407-79796429 AAGAAGGAGGGAAGGAAGGGAGG - Intergenic
976019731 4:80606997-80607019 CAGAAGGAAGGAAGGGAGAGAGG + Intronic
976326520 4:83777882-83777904 CAGAACAAGGGAAGGGAGGATGG + Intergenic
976595321 4:86890168-86890190 AAGAAGGAAAGAAGGGAGGGAGG + Intronic
976718369 4:88146924-88146946 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
976878292 4:89885134-89885156 AAGAAGGAAGGAAGGGAGGAAGG - Intronic
976958767 4:90940279-90940301 AAGAAGGAAGGAAGGGAGGAAGG - Intronic
977293929 4:95191786-95191808 GAGAAGGTGAGAAGGGAGGAAGG - Intronic
977370415 4:96127179-96127201 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
977711259 4:100128718-100128740 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
977740581 4:100476217-100476239 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
977919501 4:102627345-102627367 CAGAAGAAATCTAGGGAGGTGGG - Intergenic
977956322 4:103031119-103031141 CAGAAGGAGTAGCGGGAGATGGG + Intronic
977990973 4:103442288-103442310 GGGAAGGAGGGAAGGGAGGGAGG - Intergenic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
978399086 4:108312247-108312269 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
978399097 4:108312286-108312308 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
978532175 4:109726557-109726579 CAGAAGGGGTCAAGGGAGTGGGG - Intronic
978598341 4:110402430-110402452 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
979101136 4:116615630-116615652 GAGAAGGAAGGAAGGGAGGGTGG + Intergenic
979204212 4:118015744-118015766 AAGAAGGAAGGAAGGAAGGTAGG + Intergenic
979269780 4:118746204-118746226 AGGAAGGAGGGAGGGGAGGTTGG + Intronic
979538454 4:121851425-121851447 GGGAAGGAGGGAAGGGAGGGAGG + Intronic
979649787 4:123115499-123115521 CGCACAGAGTGAAGGGAGGTGGG - Intronic
979768164 4:124488479-124488501 CGGAAGGAGGGGAGGGAGGGAGG + Intergenic
979849540 4:125559519-125559541 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
980202336 4:129671580-129671602 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
980280587 4:130714314-130714336 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
980605877 4:135088079-135088101 CTGAAGGAGTAAAGGGAGACGGG + Intergenic
980742496 4:136970697-136970719 CAGAAGGAAAGAAGAGAGGAAGG - Intergenic
980971662 4:139572836-139572858 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
981043286 4:140242893-140242915 AGGAAGGAGTGGAGGGAGGAAGG + Intergenic
981183250 4:141770116-141770138 CAAAAGGAAAGAAGGGAGGGAGG - Intergenic
981982016 4:150805197-150805219 CAGAAGGAAGGAAGGAAGGAAGG + Intronic
982159473 4:152553425-152553447 TAGAAGAAATGAAGAGAGGTAGG + Intergenic
982223125 4:153141628-153141650 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
982439403 4:155417542-155417564 CAGAGGGTGTGAAGGGTGGGTGG - Intergenic
982623306 4:157732621-157732643 CTGAAGGAGAGAAGGCAGGGTGG + Intergenic
982708604 4:158737305-158737327 GAGAAGGAGGGAAGGAAGGGAGG + Intergenic
982824203 4:159981823-159981845 AAGAAGGAAAGAAGGGAGGGAGG - Intergenic
982919949 4:161260488-161260510 CAAAAGGAGAGAAGTGAAGTGGG - Intergenic
983197795 4:164826639-164826661 AAGAAGGAAGGAAGGAAGGTAGG + Intergenic
983497495 4:168459810-168459832 AGGAAGGAGGGAAGGGAGGGAGG + Intronic
983676765 4:170303589-170303611 CAGAAGTACTGATGGGAGGAAGG + Intergenic
983927500 4:173417618-173417640 AAGAAGGAATGAAGGAAGGGAGG - Intergenic
984021470 4:174488804-174488826 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
984120724 4:175738841-175738863 CAGATGGTGTGTAGGGAGGGTGG - Intronic
984165638 4:176300090-176300112 CGAAAAGAGTGAAGGGAGATAGG + Intergenic
984168726 4:176335198-176335220 CAGAAGAAGTATAGGGAGGGAGG - Intergenic
984310349 4:178050395-178050417 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
984497032 4:180511488-180511510 AGGAAGGAGGGAAGGGAGGAGGG - Intergenic
984612363 4:181855985-181856007 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
984908845 4:184653100-184653122 AAGAAGGAAGGAAGGAAGGTAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985022470 4:185706525-185706547 CAGAAGGAAGGAAAGGAGGGAGG - Intronic
985196214 4:187432486-187432508 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985196228 4:187432555-187432577 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985249115 4:188005452-188005474 CAGGCAGAGTGAAGGGATGTGGG - Intergenic
985365703 4:189229846-189229868 CAGAAGTCGGGAAGGGTGGTGGG + Intergenic
985546000 5:509493-509515 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
985561070 5:586110-586132 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
985817613 5:2138235-2138257 GAGAAGGAGGGAAGGAAGGAAGG - Intergenic
986017449 5:3770122-3770144 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
986063675 5:4215334-4215356 GAGAAGGAGAGAAGGAAGGAAGG - Intergenic
986764595 5:10913445-10913467 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
986957109 5:13165885-13165907 GAGAAGGTGGAAAGGGAGGTAGG + Intergenic
989007073 5:36826854-36826876 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
989331378 5:40263057-40263079 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
989331388 5:40263156-40263178 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
989427395 5:41312614-41312636 CAGAAGGAAGGACGGGAGGAAGG - Exonic
989427424 5:41312716-41312738 CAGAAGGAAGGAAGGAAGGAAGG - Exonic
989449831 5:41573534-41573556 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
989630028 5:43472785-43472807 CAGAGGCTGTGAAGGGTGGTGGG + Intronic
989793787 5:45441399-45441421 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
990403821 5:55467868-55467890 CAGAAAGAGTTAAGGAAGGCAGG - Exonic
990495023 5:56338575-56338597 CAGAAGCAGTGACGATAGGTTGG + Intergenic
990507500 5:56458979-56459001 CAGAAAGAGGGAAGGAAGGAAGG - Intronic
990527329 5:56640834-56640856 CACAAGGAAAGAGGGGAGGTGGG + Intergenic
990631384 5:57674292-57674314 CAGAGGGAGAGAAGGAAGGAGGG - Intergenic
990874835 5:60473042-60473064 CAGAAGGAAGGAAGGAAGGAAGG + Intronic
991009428 5:61867621-61867643 CGGAAGGAAAGAAGGGAGGGAGG - Intergenic
991172300 5:63642596-63642618 CAGAAGGAAGGAAGGAAGGGAGG - Intergenic
991185506 5:63801763-63801785 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
991942037 5:71862607-71862629 CAAAAGGAGGGAAGAGAGGAGGG + Intergenic
991962148 5:72055694-72055716 TAGAAGGAGAGAAGGAAGGAAGG - Intergenic
991974823 5:72175327-72175349 CACATGGAGTGAAGGGTGATGGG - Intronic
991975163 5:72177957-72177979 GAGAAGGAGGGAAGGGAGGAAGG - Intronic
992211704 5:74486313-74486335 CAGATGGAGTGAAGACAGGCAGG - Intergenic
992334379 5:75750160-75750182 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
992655248 5:78902753-78902775 CAGAGGGAGGAAAGGGAGTTGGG + Intronic
992752309 5:79872585-79872607 TAGAGGGAGTGAGGGTAGGTAGG + Intergenic
993042185 5:82826858-82826880 AAGAAAGAAAGAAGGGAGGTAGG + Intergenic
993121097 5:83775030-83775052 CAGAAGAAGAGAAGAGCGGTAGG - Intergenic
993130068 5:83885681-83885703 CACAGGGAGAGAAAGGAGGTCGG - Intergenic
993187510 5:84637963-84637985 AGGAAGGAGGGAAGGGAGGAAGG - Intergenic
993359861 5:86960884-86960906 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
993436278 5:87899612-87899634 CAAAAGGAGCCAAGGGGGGTTGG + Intergenic
993536963 5:89098550-89098572 AGGAAGGAATGAAGGGAGGGAGG - Intergenic
993795749 5:92265746-92265768 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
993824189 5:92660961-92660983 TACAAGGAGTGAAGGGACTTTGG - Intergenic
994390737 5:99190076-99190098 CAGAAGGTGGGAAGGGTAGTGGG - Intergenic
994489905 5:100427828-100427850 CACAAGGAAGGAAGGGAGGAAGG - Intergenic
994668507 5:102737280-102737302 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
994971913 5:106750060-106750082 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
995353152 5:111205466-111205488 TTGAAGGAGTGAAGGGATGCAGG - Intergenic
995947696 5:117669662-117669684 AAGAAGGACTGAAGGGAGAATGG - Intergenic
996257219 5:121419026-121419048 CAGAAGCAGGGAAGGGTAGTGGG - Intergenic
996502639 5:124233441-124233463 AAGAAGGAAGGAAGGAAGGTAGG + Intergenic
996546005 5:124679439-124679461 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
996887206 5:128371515-128371537 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
997065643 5:130555895-130555917 CAGACGGAGTGCAGCGAGGGTGG - Intergenic
997401623 5:133607901-133607923 TAGAAGGAAAGAAGGGAGGGAGG + Intronic
998206035 5:140157453-140157475 GAGAAAGAGTGAAGGGTGGATGG + Intergenic
998411132 5:141912366-141912388 AAGAAGGAGAGAATGGATGTTGG + Intergenic
998638961 5:143987634-143987656 AGGAAGGAGGGAAGGGAGGAAGG - Intergenic
998704331 5:144741223-144741245 TAGAAGGAAGGAAGGGAGGGAGG - Intergenic
998899527 5:146838281-146838303 TAGAAGGAAGGAAGGGAGGCCGG + Intronic
999236214 5:150097326-150097348 GAGAAGGGAGGAAGGGAGGTAGG + Intronic
999623059 5:153491452-153491474 AAGAAGGAGTGAGGGGTGCTGGG + Intronic
999692669 5:154162296-154162318 AAGAAGGAAGGAAGGGAGGAGGG + Intronic
999751684 5:154632267-154632289 AGGAAGGAGGGAAGGGAGGGAGG - Intergenic
999819518 5:155211927-155211949 CAGAAGGCAGGAAGAGAGGTAGG - Intergenic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000095679 5:157969000-157969022 CAGAGTCAGTGAAGGGAGATGGG - Intergenic
1000232637 5:159330391-159330413 CACAGGGAGGGGAGGGAGGTAGG + Intronic
1000236236 5:159363542-159363564 CAGAAGGATAGAAGGTTGGTGGG - Intergenic
1000346751 5:160320935-160320957 GAGAAGGAGGGAAGGAAGGAAGG - Intronic
1000348844 5:160336969-160336991 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1000416999 5:160994163-160994185 CAGGAGGAGAGAAGGCAGGGTGG - Intergenic
1000538799 5:162512908-162512930 AAGAAAGAGGGAAGGAAGGTAGG - Intergenic
1000602163 5:163287820-163287842 AGGAAGGGATGAAGGGAGGTGGG + Intergenic
1000712510 5:164599037-164599059 AAGAAGGAAGGAAGGTAGGTAGG - Intergenic
1000767434 5:165309436-165309458 CAGAAGGAGGGAGGGAAGGAGGG + Intergenic
1000789891 5:165592650-165592672 AAGAAGGAAAGAAGGAAGGTGGG + Intergenic
1000789905 5:165592733-165592755 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1000789919 5:165592783-165592805 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1000789937 5:165592833-165592855 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1000912915 5:167044035-167044057 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
1000984861 5:167855748-167855770 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1001195318 5:169668255-169668277 CAGAAGGAAGAAAGGGAGGTTGG - Intronic
1001335151 5:170790631-170790653 GAGAGGGAAGGAAGGGAGGTTGG + Intronic
1001368178 5:171166170-171166192 AAGAAGGAAAGAAGGGAGGAGGG + Intronic
1001514348 5:172345007-172345029 GAGAAGGAGGGAAAGGAGGGAGG + Intronic
1001572747 5:172741270-172741292 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1001683435 5:173575512-173575534 GAAAAGGAGTGCAGGGAGGGCGG + Intergenic
1001854161 5:174996230-174996252 CATCAGGGTTGAAGGGAGGTTGG + Intergenic
1001996498 5:176164587-176164609 CTGAAGCCGTGAAGGGAGGCAGG - Intergenic
1002133577 5:177095507-177095529 CAGAGGGAGTGGAGGGAGCGTGG - Intronic
1002356537 5:178633917-178633939 CAGAAGGAAAGAAGGAAGGAAGG - Intergenic
1002473473 5:179451229-179451251 CAGAAGCAGTGATGGGAGAGTGG + Intergenic
1002555215 5:180032365-180032387 AAGAAGGAAAGAAGGGAGGGAGG - Intronic
1002772747 6:303545-303567 CAGTGGGAGTGAAGGAAGATAGG + Intronic
1003457181 6:6293716-6293738 AAGAAGGAAAGAAGGGAGGAAGG + Intronic
1003672908 6:8176414-8176436 AAGAAGGAATGAAGGGAGGGAGG - Intergenic
1003673448 6:8181286-8181308 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1003687792 6:8322241-8322263 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1003858259 6:10297739-10297761 TAGAGGGAGAGAAGGGAAGTAGG + Intergenic
1003945537 6:11072103-11072125 CAGAGAAAGGGAAGGGAGGTGGG + Intergenic
1004015435 6:11727940-11727962 AAGAAGGAAGGAAGGGAGGCAGG + Intronic
1004026334 6:11822993-11823015 TGGAAGGAGGGAAGGGTGGTTGG - Intergenic
1004114288 6:12750530-12750552 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
1004139271 6:13000599-13000621 GGGAAGGAGGGAAGGGAGGAAGG + Intronic
1004330221 6:14714419-14714441 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1004341818 6:14814438-14814460 AAGAAGGAGAGAAGGAAGGAAGG + Intergenic
1004511204 6:16285855-16285877 CAGAGGGAGGGAAGGAAGGAAGG + Intronic
1004582988 6:16972422-16972444 CAGAAGGAAAGAAGGAAGGAAGG + Intergenic
1004626875 6:17385138-17385160 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1004842850 6:19606629-19606651 AGGAAGGAATGAAGGGAGGGAGG + Intergenic
1004921999 6:20384428-20384450 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1004979721 6:21009830-21009852 CAGAAAGTGGAAAGGGAGGTAGG + Intronic
1005008294 6:21311961-21311983 CAGAAGGGGAGTAGGGAGGTGGG - Intergenic
1005018793 6:21398464-21398486 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1005608548 6:27500387-27500409 CAGAGGGAGGGAAGGAAGGGAGG + Intergenic
1005918257 6:30373922-30373944 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1006000681 6:30962808-30962830 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1006195953 6:32242489-32242511 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
1006336839 6:33425414-33425436 GAGAAGGGGGTAAGGGAGGTGGG + Intronic
1006818213 6:36868015-36868037 CAGAAGGACAGAAAGGAGGAGGG + Intronic
1006850115 6:37092414-37092436 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1007236247 6:40392930-40392952 CAGAAATAGTGAGGGGTGGTGGG + Intronic
1007252042 6:40502328-40502350 AAGGAGGATTGAAGGGAGGGAGG + Intronic
1007303419 6:40886165-40886187 GAGAGAGAGAGAAGGGAGGTAGG + Intergenic
1007374069 6:41444299-41444321 AAGAAAGAGTCATGGGAGGTGGG + Intergenic
1007398918 6:41592696-41592718 CAGAAGGAAGGAAGGAAGGTAGG - Intronic
1007423486 6:41733590-41733612 CAGACGGAGAGAAGGGAGCCAGG + Intronic
1007575454 6:42922831-42922853 CAGATGGAGGGAAGGAAGGGTGG + Intronic
1007720989 6:43885414-43885436 AATAAGGAGTGAAGGGAGTGGGG - Intergenic
1007938911 6:45758472-45758494 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1008418660 6:51271906-51271928 AGGAAGGAGGGAAGGGAGGGGGG + Intergenic
1008689936 6:53966627-53966649 CAGAAAGAGAGAAGGGAGCGTGG + Intronic
1008729655 6:54465977-54465999 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1008927263 6:56900029-56900051 GAGAAGCAGTGAAGGAAGGTGGG - Intronic
1009190885 6:60628152-60628174 GAGAGGGAGGGAAGGGAGGAGGG + Intergenic
1009296426 6:61956572-61956594 AAGAGGGAGGGAAGGGAGATTGG - Intronic
1009856753 6:69274614-69274636 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1010177846 6:73050317-73050339 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1010248816 6:73687340-73687362 AAGAAAGACTGAAGGGAGGAAGG - Intergenic
1010403958 6:75481484-75481506 AGGAAGGAGAGCAGGGAGGTGGG - Intronic
1011300856 6:85872223-85872245 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1011410674 6:87062894-87062916 CAGAAGGAAAGAAGGAAGGAAGG + Intergenic
1011640977 6:89415539-89415561 AAGAAGGAGAGAAGGAAGGGAGG + Intergenic
1011708056 6:90023393-90023415 CAGGAGGAGGGAAGAGAGGAGGG - Intronic
1012329094 6:97961835-97961857 CAGAAGGAAGGAAGGAAGGGAGG - Intergenic
1012582832 6:100889854-100889876 CAGAAGGAGTAAAGGGTGCTGGG - Intergenic
1012806369 6:103898757-103898779 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1013037725 6:106402834-106402856 CAGGATGAGTGAGGGGAGGGTGG + Intergenic
1013309665 6:108881305-108881327 AGGAAGGAGTGAAGGAAGGAAGG - Intronic
1013341518 6:109220414-109220436 AAGAAAGAGTGAGGAGAGGTCGG + Intergenic
1013520466 6:110928184-110928206 AAGAAGGAATGAAGGGAAGGAGG - Intergenic
1013627198 6:111950109-111950131 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1013676203 6:112465924-112465946 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1014138201 6:117911434-117911456 CAGAAGGATGGAAGGAAGGAAGG - Intronic
1014188801 6:118467571-118467593 TAGAAGGAGTATTGGGAGGTGGG + Intronic
1014297842 6:119642329-119642351 CAAAAGGAGAGAGGGGAGGAAGG - Intergenic
1014626554 6:123733256-123733278 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014884842 6:126767128-126767150 CAGAAGGAAGGAGGGGAGGAAGG - Intergenic
1015163965 6:130182621-130182643 AAGAAGGAGGGAGGGGAGGGAGG + Intronic
1015424408 6:133049309-133049331 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1015805825 6:137107330-137107352 CAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1015820214 6:137252835-137252857 AAGAAGGAATGAAGGGAGAGAGG - Intergenic
1015867196 6:137739490-137739512 CAGAAGGGGTAAAGGGAGTGTGG - Intergenic
1016094105 6:140014954-140014976 CAGAGGGAGGGAAGGAAGGAAGG - Intergenic
1016231336 6:141808727-141808749 AAGAAGGAGAGAAGGAAGGAAGG - Intergenic
1016316428 6:142793602-142793624 GAGAAGGAAGGATGGGAGGTGGG - Intronic
1016510473 6:144837159-144837181 CAGAAGGAAGAAAGGGAGGGAGG - Intronic
1016547318 6:145238996-145239018 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1016722862 6:147323052-147323074 CAGAAGGAAGGGAGGGAGGGAGG - Intronic
1016744004 6:147558738-147558760 CAGAAGGAATGAAGACAGATGGG - Intronic
1016815410 6:148298636-148298658 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1016974137 6:149790681-149790703 CAGAAGGGGAGAAGGAAGGCTGG + Intronic
1016990768 6:149926146-149926168 AAGAAGGATTGGAGGGAGGGCGG + Intergenic
1016998168 6:149975642-149975664 AAGAAGGAATGAAGGTAGGAAGG + Intergenic
1017007687 6:150039640-150039662 CAGGAGGAGGGACAGGAGGTGGG - Intergenic
1017041060 6:150309022-150309044 GAGAAAGAGGGAAGGGAGGCAGG + Intergenic
1017447272 6:154518139-154518161 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1017507884 6:155085071-155085093 CAGGAGGGGTTAAGGGAGATGGG + Intronic
1017769832 6:157636496-157636518 CAGCAGGAGGGAAGTGAGGATGG - Intronic
1017809960 6:157977481-157977503 CAGAGGGAGGGAGAGGAGGTTGG - Intergenic
1017891163 6:158640524-158640546 GTGAGGGAGTGAAAGGAGGTGGG - Intronic
1017891924 6:158645759-158645781 CAGAATGGGTGAGGGGAGGGAGG - Intergenic
1018211048 6:161481898-161481920 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1018285867 6:162236890-162236912 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
1018326176 6:162671871-162671893 GAGGAGGAGAGAGGGGAGGTAGG + Intronic
1018405106 6:163472395-163472417 CAGAAGGAGGTGATGGAGGTGGG + Intronic
1018619737 6:165718579-165718601 CAGGAAGAGAGCAGGGAGGTTGG - Intronic
1019039019 6:169087582-169087604 CAGCAGGAGTGAAAGAAGCTGGG + Intergenic
1019313493 7:374117-374139 CAGAGGGAAGGAAGGGAGGGAGG + Intergenic
1019697291 7:2452679-2452701 AAGAAGGGGGGAAGGGAGGGAGG - Intergenic
1019730650 7:2627613-2627635 GGGAAGGAGAGAAGGGAGGGAGG + Intergenic
1019908573 7:4083576-4083598 AAGAAGGAAAGAAGGGAGGAGGG - Intronic
1019919997 7:4157379-4157401 GAGAAGGAATGAGGGGAGGGAGG + Intronic
1019931996 7:4230038-4230060 CAGAAGGAAGGAAGGAAGGAAGG + Intronic
1019989172 7:4680587-4680609 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1020026520 7:4903719-4903741 CAGGATGAGTGAAGGCAGGTGGG - Intergenic
1020164342 7:5796414-5796436 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1020677494 7:11198644-11198666 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1020832601 7:13110304-13110326 GAGAAGCACTGGAGGGAGGTTGG - Intergenic
1020952513 7:14697851-14697873 GAGAAGGAAGGAAGGAAGGTAGG + Intronic
1020989973 7:15184424-15184446 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1020989996 7:15184504-15184526 TAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1020990096 7:15184849-15184871 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1020990110 7:15184903-15184925 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1021510633 7:21428508-21428530 GAGAAGGAGGGAAGGGAGGAGGG - Intronic
1021910202 7:25378158-25378180 AGGAAGGAGGGAAGGGAGGAAGG - Intergenic
1021959807 7:25859902-25859924 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1021982449 7:26067943-26067965 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1022004354 7:26253815-26253837 GAGAAGGAGAAAAGGGAGGTGGG + Intergenic
1022073486 7:26941475-26941497 CAGAAGGATGGAAGGAAGGAAGG + Intronic
1022135646 7:27445489-27445511 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1022149468 7:27586384-27586406 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1022216068 7:28262811-28262833 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1022452594 7:30528846-30528868 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1022723735 7:32962868-32962890 CAGTAGGAGTGAGGGGTGGGAGG + Intronic
1022828478 7:34040829-34040851 GAGAAGGAAAGAAGGGAGGTGGG + Intronic
1022838927 7:34144148-34144170 CTGAAGGAGTGAAGGGAGTGAGG + Intronic
1023168026 7:37362586-37362608 AGGAAGGAATGAAGGAAGGTTGG - Intronic
1023350234 7:39313195-39313217 CAGGAGGAGGGAAGTGAGGCTGG - Intronic
1023575497 7:41622064-41622086 GAGAAGGAATGGAGGGAGGGAGG + Intergenic
1023761142 7:43466167-43466189 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1023873653 7:44275809-44275831 CAGAAGGAGTTAGGGGAGCTGGG - Intronic
1023910074 7:44547578-44547600 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1023922143 7:44637991-44638013 CAGAAGGAGTGAGGGGTCCTGGG - Intronic
1024010394 7:45261357-45261379 AAGAGGGAGTGAAGGGAGTGGGG + Intergenic
1024233098 7:47377758-47377780 GAGAAGGAGGGAGGGGAGGAGGG - Intronic
1024283198 7:47736272-47736294 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1024300287 7:47882309-47882331 CAGAAGGAAGGAAGGAAGATAGG - Intronic
1024325673 7:48107537-48107559 GAGCAGAAGTGAAGGGAGGAGGG - Intronic
1024327153 7:48117836-48117858 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1024439762 7:49403710-49403732 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1024515345 7:50248209-50248231 GAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1024722946 7:52158493-52158515 CACAAGCACTGAAGGGGGGTAGG - Intergenic
1025607674 7:63051149-63051171 AAGAAAGAAAGAAGGGAGGTAGG - Intergenic
1026218921 7:68374608-68374630 AAGAAGGAAGGAAGGAAGGTAGG - Intergenic
1026506693 7:70990625-70990647 CAGAAGGAAGGAAGGAAGGGAGG - Intergenic
1026621942 7:71957234-71957256 CAGAAAGATTGATAGGAGGTGGG + Intronic
1026632370 7:72048657-72048679 AGGAAGGAGGGAAGGGAGGGAGG - Intronic
1026642579 7:72140329-72140351 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1026675338 7:72423888-72423910 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1026677194 7:72437839-72437861 AAGAAGGAAGGAAGGGAGGATGG - Intronic
1026927414 7:74204092-74204114 GAGAGGGAGGGAAGGGAGGGAGG + Intronic
1027182382 7:75949968-75949990 CAGGAGGAGGGAGGTGAGGTGGG - Intronic
1027215074 7:76178446-76178468 CAGACGGCGAGAAGGGAGGCCGG + Intergenic
1027347604 7:77277092-77277114 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1027573957 7:79908065-79908087 CAGAAGGAAAGAAGGAAGGAAGG + Intergenic
1027624141 7:80527317-80527339 AAGAAGGAGGGAAGGGAGGGAGG + Intronic
1028449661 7:90967092-90967114 CAGAAGGAAGGAAAGGAGGGAGG + Intronic
1028520849 7:91729045-91729067 CAGAGGGAAGGAAGGGAGGAAGG + Intronic
1028618905 7:92801999-92802021 AGGAAGGAGGGAAGGGAGGGAGG - Intronic
1028636778 7:92997973-92997995 GGGAAGGAGGGAAGGGAGGAAGG - Intergenic
1028864002 7:95686821-95686843 GAGAAAGAGTGAAGGGAGAGAGG + Intergenic
1029084923 7:98003996-98004018 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1029084951 7:98004079-98004101 CAGAAGGAAGGAAGGGGGGAGGG - Intergenic
1029300791 7:99580895-99580917 CAGAAGGAAAGAAGGAAGGAAGG - Intronic
1029503795 7:100950032-100950054 CAGAAGGAGTCAAGACAGGAAGG - Intronic
1029525229 7:101089778-101089800 CAGAAGCAGAGGAGGCAGGTGGG + Exonic
1029566374 7:101341035-101341057 GAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1029628847 7:101737753-101737775 AAGAAGGAGGGAAGGGAGGGAGG + Intergenic
1029628860 7:101737785-101737807 AAGAAGGAGGGAAGGGAGGGAGG + Intergenic
1030070296 7:105692437-105692459 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1030219227 7:107079688-107079710 CGGAAGGAAGGAAGGGAGGGAGG - Intronic
1030480142 7:110092955-110092977 CAGAAATAGTGAAGGGTGCTTGG + Intergenic
1030683908 7:112463478-112463500 CAAAAGGAGTGTAGGGGAGTTGG - Intronic
1030916543 7:115321407-115321429 CGGAAGGAAGGAAGGGAGGGAGG - Intergenic
1030942515 7:115671372-115671394 CACAAGGAAGGAAGGGAGGGAGG - Intergenic
1031143470 7:117971952-117971974 GAGAAAGAGAGAAGGGAGGGAGG - Intergenic
1031150666 7:118050350-118050372 CAGAAGCAGGGAAAGGAGATTGG - Intergenic
1031323687 7:120365200-120365222 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1031345779 7:120664456-120664478 GAGAAGAAATGAAGGGAGGAAGG + Intronic
1031438227 7:121759830-121759852 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1031750679 7:125569273-125569295 AAGAAGGAACGAAGGGAGGGAGG - Intergenic
1032081345 7:128860022-128860044 CAGAGGTAATGAAGGGGGGTTGG - Intergenic
1032226079 7:130032763-130032785 GGGAAGGAGGGAAGGGAGGGAGG + Intronic
1032234187 7:130105666-130105688 CTCTAGAAGTGAAGGGAGGTTGG + Intronic
1032573508 7:133027419-133027441 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1032702864 7:134397577-134397599 GGGAAGGAGTGAAGCCAGGTGGG + Intergenic
1032774474 7:135096381-135096403 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1032878065 7:136059063-136059085 CAGGAGTAGTGAAGGGTAGTAGG + Intergenic
1033037253 7:137886314-137886336 CAGAAGGAGTGGCCAGAGGTGGG + Intronic
1033120375 7:138662788-138662810 CAGAAGGATTAAAGGAAGGAAGG - Intronic
1033124234 7:138693686-138693708 AAGAAGGAAGGAAGGGAGGCAGG + Intronic
1033137646 7:138798230-138798252 GGGAAGGAGGGAAGAGAGGTGGG + Intronic
1033235263 7:139633249-139633271 GAGTGGGAGTGAAGGGAGCTGGG + Intronic
1033263648 7:139865802-139865824 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1033462911 7:141563559-141563581 CAGAAGAAGTCAAGGAAAGTGGG - Intronic
1033629040 7:143139296-143139318 CAGAAGGACAGAAGGGAGGGAGG + Intronic
1034032878 7:147786970-147786992 AAGAAGGAAAGAAGGGAGGGAGG + Intronic
1034160245 7:148988689-148988711 CAGAGGCAGGGAAGGGGGGTTGG + Intergenic
1034371810 7:150605377-150605399 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
1034442687 7:151094825-151094847 GGGAAGGAGGGAAGGGAGGGAGG - Intronic
1034815949 7:154172125-154172147 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1034889762 7:154829486-154829508 CAGAAGGAGGGAAGGAAGGAAGG + Intronic
1034895696 7:154875151-154875173 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1034973246 7:155432195-155432217 AAGAAGGAGAGAAGGAAGGGAGG + Intergenic
1035078735 7:156199000-156199022 GAGAAGGAAGGAAGGGAGGAGGG + Intergenic
1036117152 8:5971031-5971053 CAGAGGGAGAGAGGGGAGGCCGG + Intergenic
1036163151 8:6407077-6407099 CAGCAGGGGTGAAAGCAGGTAGG - Intronic
1036192256 8:6680813-6680835 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1036779319 8:11634735-11634757 CAGGTGGGGTGAAGGGAGGTGGG - Intergenic
1036943332 8:13071669-13071691 CAGAAGGAGGCAGGGGAGATGGG - Intergenic
1037019125 8:13946323-13946345 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1037195255 8:16180906-16180928 GAAAGGGAATGAAGGGAGGTAGG + Intronic
1037368229 8:18145505-18145527 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1037654202 8:20868889-20868911 GGGAGGGAGTGGAGGGAGGTGGG - Intergenic
1037774409 8:21823409-21823431 CAGAAGGAGAGAAGGAGGGAAGG - Intergenic
1037911918 8:22748664-22748686 CAGAGGGAGGGTGGGGAGGTGGG + Intronic
1038157672 8:25006053-25006075 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1038239191 8:25792509-25792531 CTGATGGAGTGAAGAGAGGAAGG + Intergenic
1038425295 8:27460671-27460693 AAGGAGGGGTGAAGGGAGGGAGG + Exonic
1038476930 8:27875186-27875208 AGGGAGGAGTGAAGGGAGGGAGG - Intronic
1038540994 8:28389956-28389978 ATGAAGCAGGGAAGGGAGGTGGG - Intronic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1038951189 8:32416318-32416340 CAGAAGGAATTAAGGAAGGAAGG - Intronic
1038951203 8:32416373-32416395 CAGAAGGAAAGAAGGAAGGAAGG - Intronic
1039151532 8:34512186-34512208 CAGAAGGAAAGAAAGGGGGTTGG - Intergenic
1039169719 8:34729383-34729405 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1039182063 8:34878068-34878090 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1039228491 8:35417238-35417260 CAGAAGGTGAGAAGGGTAGTGGG - Intronic
1039396636 8:37231541-37231563 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1039397670 8:37240940-37240962 AAGCAGGAGGGAAGGGAGGAGGG + Intergenic
1039472844 8:37824900-37824922 CAGAAGCAATGAAAGGAGGAGGG - Intronic
1039717291 8:40123506-40123528 AGGAAGGAATGAAGGGAGGGAGG + Intergenic
1039776909 8:40746195-40746217 GGGAAGGAGGGAAGGAAGGTGGG - Intronic
1039800167 8:40947434-40947456 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1040656933 8:49521432-49521454 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1040691037 8:49938667-49938689 AAGAAGGAGGGAAGGAAGGAAGG - Intronic
1040777013 8:51057507-51057529 CACTAGGAAGGAAGGGAGGTTGG + Intergenic
1040869359 8:52084233-52084255 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1041080417 8:54210060-54210082 AAGAAGGAGTGCAGGAAGGGAGG - Intergenic
1041148122 8:54900948-54900970 TAGAAGGAATGAAGGAAAGTAGG + Intergenic
1041183103 8:55269571-55269593 GAGAAAGAATGAAGGGAGGAGGG + Intronic
1041474284 8:58246676-58246698 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1041674087 8:60520695-60520717 CAGAATGAGGGAAGAGAGGAGGG - Intronic
1041726835 8:61026018-61026040 CAGGGGGAGGGAAGGGGGGTGGG - Intergenic
1041989513 8:63968750-63968772 CAGAAGGTGGGAAGGGAGACGGG - Intergenic
1042114349 8:65414783-65414805 CAGGAGGGGAGAAGGGAGGCAGG - Intergenic
1042215287 8:66425047-66425069 CAGAAGGCGTGAAGAGAGTGAGG - Intergenic
1042687537 8:71459010-71459032 GATAGGGAGGGAAGGGAGGTTGG + Intronic
1042972238 8:74422377-74422399 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
1043267686 8:78286873-78286895 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1043417266 8:80063969-80063991 AAGAAGGAGGGGAGGGAGGGAGG + Intronic
1043826125 8:84930753-84930775 AGGAAGGAGAGAAGGGAGGAAGG + Intergenic
1043859212 8:85296505-85296527 CAGCAGGAGAGAAGGGGGGCAGG - Intergenic
1044003839 8:86917555-86917577 CAGTAGGACTGATGGGTGGTAGG + Intronic
1044291215 8:90472549-90472571 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1044299997 8:90572788-90572810 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1044551071 8:93512989-93513011 CAGAGGGTGGGAAGGGAGGAGGG + Intergenic
1044600605 8:94000178-94000200 GAAAAGGAAGGAAGGGAGGTGGG + Intergenic
1044763120 8:95543431-95543453 AAGAAGGAAGGAAGGGAAGTTGG - Intergenic
1044878996 8:96702763-96702785 CAGAAGGAGAAAGGGGAGGGAGG - Intronic
1045236397 8:100356255-100356277 CAGAAGGAAGGAAGAGAGGAAGG + Intronic
1045236416 8:100356315-100356337 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
1045377423 8:101588530-101588552 CAGAATGAGTTAAGTGACGTAGG - Intronic
1045412052 8:101929468-101929490 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1045487168 8:102640580-102640602 AGGAAGGAGAGAAGGGAGGGAGG + Intergenic
1045541896 8:103094460-103094482 AGGAAGGAGTGAAGGAAGGAAGG - Intergenic
1045608692 8:103809485-103809507 AAAAAGGAGTGGAGGGAGGAGGG - Intronic
1045662257 8:104450106-104450128 GAGAAGGAAGGAAGGGAGGGAGG + Intronic
1045789391 8:105964147-105964169 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1045830202 8:106450163-106450185 CAGAAAGAGTGAAATGAGCTAGG + Intronic
1046088030 8:109463273-109463295 CAGAAGGAAGGAAGGGAGGGAGG + Intronic
1046117785 8:109804845-109804867 AAGAGGGAGAGAAGAGAGGTTGG + Intergenic
1046153944 8:110263239-110263261 AGGAAGGAGTGAAGGAAGGAAGG - Intergenic
1046205507 8:110990345-110990367 CAGGTGGAGGGAGGGGAGGTGGG - Intergenic
1046227886 8:111309020-111309042 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1046236281 8:111427958-111427980 AAGAAGGAGAGAAGGAAGGAAGG - Intergenic
1046236287 8:111427994-111428016 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1046555513 8:115768549-115768571 GGGAAGAAGTGAAGGGAGGGAGG - Intronic
1046555585 8:115768787-115768809 GGGAAGAAGGGAAGGGAGGTAGG - Intronic
1046704855 8:117438482-117438504 CAGATGTAGTGAAGGGGGGATGG + Intergenic
1047017449 8:120738524-120738546 AAGAAGGAAGGAAGGGAGGTAGG - Intronic
1047032165 8:120894151-120894173 AGGAAGGAGGGAAGGTAGGTTGG - Intergenic
1047061790 8:121235588-121235610 AAGAAGGAAAGAAGGGAGGAAGG - Intergenic
1047066674 8:121291929-121291951 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1047081417 8:121465535-121465557 GAGAAGGAAGGGAGGGAGGTGGG + Intergenic
1047096974 8:121636386-121636408 CAGAAGGGGAGAAGGGAGGTTGG - Intronic
1047218728 8:122901272-122901294 CAGAAGCAGGGGAGGTAGGTTGG - Intronic
1047244346 8:123126593-123126615 CAGAAGGAAGGAAGGATGGTTGG - Exonic
1047501651 8:125446380-125446402 AAGAAGGGAAGAAGGGAGGTAGG - Intergenic
1047552423 8:125889544-125889566 AAGAAGGATGGAAGGAAGGTAGG - Intergenic
1047579353 8:126195761-126195783 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
1047595980 8:126378358-126378380 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1047806943 8:128370904-128370926 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1047855328 8:128903002-128903024 TAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1047952542 8:129946977-129946999 GGGAATGAGTGAAGGTAGGTGGG - Intronic
1048764564 8:137830262-137830284 CAGAGTCAGTGAAGGGAGATGGG + Intergenic
1048841274 8:138568626-138568648 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1048842973 8:138581285-138581307 CAGCAGGGGTGGAGTGAGGTGGG - Intergenic
1048952296 8:139506370-139506392 GAGAAGGAGTGGGGAGAGGTGGG + Intergenic
1049162510 8:141106265-141106287 CTGCAGGAGTGAGGGGATGTGGG + Intergenic
1049640273 8:143712165-143712187 CAGAGGGAGTGCAGAGAAGTGGG - Intronic
1049799280 8:144510291-144510313 CAGGTGGGGAGAAGGGAGGTGGG + Intronic
1050174556 9:2855978-2856000 GAGAAGGAAGGAAGGGAGGCAGG + Intergenic
1050507962 9:6366852-6366874 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1050707910 9:8424723-8424745 AAGAATGAGTGAAGGGAGGAGGG + Intronic
1051145778 9:14025926-14025948 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1051312103 9:15786936-15786958 GAGAATCAGTGAAGGGAGATAGG - Intronic
1051426754 9:16940025-16940047 AAGAAGGAATGAAGGAAGGAAGG - Intergenic
1051617871 9:19023778-19023800 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1052143387 9:25017501-25017523 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1052359040 9:27534607-27534629 AAGAAGGAAGGAAGGGAGGGTGG + Intergenic
1052475915 9:28958730-28958752 GAGAAGAAGGGAAGGGAGGGGGG + Intergenic
1052520462 9:29541487-29541509 GAGAAGGAGAAAAGGGAGGGAGG - Intergenic
1052655399 9:31352721-31352743 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1052987656 9:34499947-34499969 GAGAAGGAGTTACTGGAGGTAGG + Intronic
1053273733 9:36767686-36767708 GAGAAGGAGTGGAGGGAGGGGGG + Intergenic
1053277258 9:36792562-36792584 ATGAAGGAATGAAGGGAGGGAGG + Intergenic
1053562362 9:39209695-39209717 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
1053828167 9:42047687-42047709 CAGAAGGAAGGAAGGAAGGAAGG - Intronic
1054134791 9:61409344-61409366 CAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1054330410 9:63748508-63748530 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1054602392 9:67139767-67139789 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
1055268831 9:74532358-74532380 CAGGAGGAGTGAAGGAGAGTGGG - Intronic
1055348059 9:75357259-75357281 GAGAATCAGTGAAGGGAGATAGG + Intergenic
1055713091 9:79086889-79086911 GAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1055738685 9:79361821-79361843 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1055966411 9:81869302-81869324 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1055978912 9:81981522-81981544 TAGATGGAGTGGAGGGAGGTAGG - Intergenic
1056120132 9:83479430-83479452 AAGAAGGAAGGAAGGGAGGGAGG + Intronic
1056368230 9:85928026-85928048 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1056724072 9:89096927-89096949 GAGAATGTGTGATGGGAGGTAGG + Intronic
1056851365 9:90087228-90087250 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1056948962 9:91026628-91026650 CAGAAGAACTTAAGGGAGGTGGG + Intergenic
1057292777 9:93818090-93818112 GGGAAGGAGTGAAGGGAAGGAGG + Intergenic
1057501944 9:95603093-95603115 GAGAAGGAGAGAAGGAAGGAGGG - Intergenic
1057546695 9:96024315-96024337 CAGAGTGAATGAAGGGAAGTAGG + Intergenic
1057612512 9:96558163-96558185 CAGGGGGAGTGAAGAGAGGTTGG + Intronic
1057829321 9:98394855-98394877 CAGAATGAGGGAAGGGATGGTGG - Intronic
1057875657 9:98752407-98752429 GGGAAGGAGGGAAGGAAGGTTGG - Intronic
1057901213 9:98950467-98950489 AGGAAGGAGGGAAGGGAGGGAGG - Intronic
1057942421 9:99296626-99296648 CAGAAGGGGTGCGGGGAGGCCGG + Intergenic
1058798012 9:108517202-108517224 GAGAAGGTTTGAAGTGAGGTGGG - Intergenic
1058920308 9:109608240-109608262 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1058984731 9:110200169-110200191 AAGAAGGAAAGAAGGGAGGAAGG + Exonic
1058984743 9:110200210-110200232 CAGAAGGAAGGAAGGAAGGAAGG + Exonic
1059055774 9:110977778-110977800 CAGAAGGAAAGAAGGAAGGAAGG + Intronic
1059300216 9:113306601-113306623 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1059383001 9:113943097-113943119 CAGGAGGAGTGAAGAGTTGTTGG - Intronic
1059451224 9:114372548-114372570 CAGGAGGAAGGAAGGGAGGAGGG + Intronic
1059502454 9:114766705-114766727 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1059534681 9:115069827-115069849 AAGAAGGAAGGAAGGGAGGAAGG - Intronic
1059633792 9:116153706-116153728 AAGAAGGAGGGAGGGGAGGGGGG + Intergenic
1059917982 9:119125073-119125095 CACATGGAGTGAGAGGAGGTTGG + Intergenic
1059929456 9:119246708-119246730 CAGTATGAGAGAAGGGAGGTGGG - Intronic
1059994035 9:119892402-119892424 AGGAAGGAAGGAAGGGAGGTAGG + Intergenic
1059994072 9:119892510-119892532 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1060124174 9:121025979-121026001 CACAATGAGTAAAGGGATGTGGG + Intronic
1060199156 9:121641795-121641817 AAGAAGGAAAGAAGGAAGGTAGG - Intronic
1060206441 9:121685275-121685297 CAGAGGGAGTGTTGGAAGGTGGG + Intronic
1060832631 9:126726908-126726930 CAGAAGGAAAGAAGGAAGGAAGG - Intergenic
1061271542 9:129546575-129546597 AAGAAGGAGTGGAGAAAGGTGGG - Intergenic
1061440967 9:130603048-130603070 AAGAAACAGTGAAGGGAGGCTGG + Intronic
1061613411 9:131763462-131763484 CTGAAGATGTGAAGGCAGGTGGG + Intergenic
1061942611 9:133891579-133891601 GGGAAGGAGGGAAGGGAGGGAGG + Intronic
1062181440 9:135193243-135193265 CAGGAGCACTGAAGGGAGGGAGG - Intergenic
1062480921 9:136750977-136750999 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1062530453 9:136997261-136997283 CAGTGGGAGGGATGGGAGGTGGG - Intergenic
1062695090 9:137870700-137870722 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1202797797 9_KI270719v1_random:141445-141467 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1185485997 X:482029-482051 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1185486013 X:482074-482096 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1185492531 X:528774-528796 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1185574907 X:1163646-1163668 AGGAAGGAGGGAAGGGAGGGAGG + Intergenic
1185574946 X:1163836-1163858 AAGAAAGAGAGAAGGGAGGGAGG + Intergenic
1185582007 X:1216985-1217007 CAGAGAGAGAGAAAGGAGGTTGG + Intergenic
1185680078 X:1881280-1881302 AAGAAGGAGTGAAGGAGGGAGGG + Intergenic
1185740185 X:2525842-2525864 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1185809540 X:3093407-3093429 CAAAAGGGGAGAAGGAAGGTGGG - Intronic
1185843676 X:3417113-3417135 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1185954595 X:4475671-4475693 GAAAAGGAGAGAAGGGAGGGAGG + Intergenic
1185972584 X:4681826-4681848 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1185989849 X:4881488-4881510 CAGCAGGAGAGAAGGGAGCCTGG - Intergenic
1185999193 X:4989233-4989255 GAGACGGAGGGAGGGGAGGTAGG - Intergenic
1185999226 X:4989366-4989388 CAGAAGGAGGGAGGGGAGGTAGG - Intergenic
1186053609 X:5626511-5626533 AAGAAGGAATGTTGGGAGGTAGG + Intergenic
1186117212 X:6317628-6317650 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1186134348 X:6503746-6503768 CAGAAGGAAGGAAGGAAGGAAGG + Intergenic
1186156479 X:6731731-6731753 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1186246634 X:7622533-7622555 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1186405178 X:9295596-9295618 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1186423121 X:9442765-9442787 AAGAAGGGGAGAAGGGAGGGTGG - Intergenic
1187034351 X:15522226-15522248 AGGAAGGAGAGAAGGGAGGGAGG - Intronic
1187132231 X:16514120-16514142 GAGAAGGAGGGAAGGAAGGGAGG + Intergenic
1187264476 X:17718644-17718666 AAGAAGGAAGGAAGGGAAGTAGG + Intronic
1187264546 X:17718946-17718968 AAGAAGGAGGGAAGGAAGGAGGG + Intronic
1187480199 X:19648341-19648363 GAGAAGGAGGGAAGGAAGGAAGG + Intronic
1187623409 X:21084462-21084484 AAGAAGGGGAGAAGGAAGGTTGG - Intergenic
1187744654 X:22395316-22395338 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1187768840 X:22672543-22672565 AAGAAGGGCTGAAGGGAGGTTGG + Intergenic
1187772390 X:22714590-22714612 AAGAAGGAAAGAAGGGAGGGAGG + Intergenic
1187795043 X:22994490-22994512 AAGAAGGGCCGAAGGGAGGTTGG - Intergenic
1187882874 X:23862847-23862869 GAGAAGGAGGGAGGGGAGGGAGG + Intronic
1188802004 X:34543860-34543882 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1189122302 X:38407745-38407767 CAGAAGCAGAGGATGGAGGTGGG + Intronic
1189154306 X:38741380-38741402 AGGAAGGAGGGAAGGGAGGGAGG - Intergenic
1189159258 X:38793879-38793901 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1189249952 X:39593110-39593132 GAGAAAGACTGAAGGGAGGTTGG - Intergenic
1189532080 X:41895505-41895527 GAGAAGGTGTCAAGGGAGGGAGG + Intronic
1189676224 X:43463432-43463454 CAGAGAGAGTGAAGGAAGGAAGG + Intergenic
1189777387 X:44482673-44482695 CAGAAGGAGTGATGTGGGGGTGG - Intergenic
1189858093 X:45243762-45243784 CAGAAGCTGGGAAGGGTGGTGGG - Intergenic
1189931595 X:46017823-46017845 AAGAAGGAAGGAAGGGAGGGTGG - Intergenic
1190547930 X:51549222-51549244 AAGAAGGAAGGAAGGGAGGAAGG - Intergenic
1190735775 X:53255293-53255315 GAGAAGGAAGGAAGGAAGGTAGG + Intronic
1190772175 X:53524313-53524335 CAGAAGGATTTAAGGCAGGAAGG + Intergenic
1190781190 X:53597386-53597408 CAGAAGGATTTAAGGCAGGAAGG + Intronic
1190868112 X:54401611-54401633 CAGAAGCTGGGAAGGGAGGGGGG - Intergenic
1191220602 X:57984658-57984680 AAGCAGGAGTGGAGGCAGGTGGG - Intergenic
1191904904 X:66077254-66077276 GAGAAGGAGAGAAGGGAAGGAGG - Intergenic
1192169049 X:68843196-68843218 CAGGCGGAGGGAAGGAAGGTTGG + Intergenic
1192191005 X:68991126-68991148 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1192368246 X:70492944-70492966 CAGGTGGTCTGAAGGGAGGTGGG - Intronic
1192833822 X:74778416-74778438 AAGAAGGAAGGAAGGGAGGAAGG - Intronic
1193119412 X:77807806-77807828 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193765286 X:85521341-85521363 CAGAAGGTGGGAAGGGTAGTGGG - Intergenic
1194000073 X:88417287-88417309 AAGAAAGAGTGAAGGGAGGAAGG + Intergenic
1194140543 X:90203726-90203748 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1194177868 X:90673661-90673683 AAGAAGGAAGGAAGGAAGGTAGG + Intergenic
1194204033 X:90989118-90989140 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1194223198 X:91222736-91222758 CGGAAGGAGTGAAGGAAGGATGG + Intergenic
1194291469 X:92077607-92077629 AAGAAGGAAGGAAGGGAGGAAGG + Intronic
1194670863 X:96730884-96730906 GAGAGTCAGTGAAGGGAGGTAGG + Intronic
1194690279 X:96976016-96976038 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1194721557 X:97346409-97346431 GAGAAGGAGGGAAGGGGGGAGGG - Intronic
1195042351 X:101026019-101026041 GAGAAGGACAGAAGGGAGGGAGG + Intronic
1195642316 X:107189820-107189842 AAGAAGGAGGGAAGGAAGGAAGG + Intronic
1195658796 X:107358702-107358724 CAGAGGGAGAGAAGGAAGGAGGG + Intergenic
1195671181 X:107471313-107471335 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1195908054 X:109864849-109864871 CAGAAGGAAGGGAGGGAGGGAGG - Intergenic
1195915822 X:109934561-109934583 CAGAAGGAAACAAGGGAGGAAGG - Intergenic
1196186618 X:112751073-112751095 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1196398223 X:115288631-115288653 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1196562137 X:117162563-117162585 CAGAAAGTGTGAAGTGAGATAGG + Intergenic
1196604173 X:117637167-117637189 CGGAAGGAAAGAAGGGAGGGAGG + Intergenic
1196642712 X:118081723-118081745 CAGGAGGAATGAAGAGAGGTTGG - Intronic
1197146928 X:123182164-123182186 GAGAAAGAGGGAAGGGAGTTTGG + Intergenic
1197267385 X:124389618-124389640 AAGAAGGAAGGAAGGGAGGGAGG - Intronic
1197365426 X:125560041-125560063 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1197582221 X:128297753-128297775 GAAGAGGGGTGAAGGGAGGTTGG + Intergenic
1197808107 X:130416474-130416496 AGGAAGGAATGAAGGGAAGTGGG - Intergenic
1198019473 X:132644186-132644208 CAGAAAGAGGGAAGGAAGGGAGG + Intronic
1198112053 X:133510333-133510355 CAGAAGGAAGGAAGGAAGGAAGG - Intergenic
1198114906 X:133535603-133535625 CAGAAGGAAGGCAGGGAGGTGGG + Intergenic
1198133984 X:133728373-133728395 AAGAAGGAGTGAAGGAAAGAAGG + Intronic
1198191795 X:134314793-134314815 AAAAAGGAATGAAGTGAGGTGGG + Intergenic
1198302435 X:135344962-135344984 CGGAAGGAGTGGTGGGCGGTGGG + Intronic
1198323424 X:135542531-135542553 GAGAAGGAGAGAAGGGAGGGAGG + Intronic
1198383406 X:136105180-136105202 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1198478558 X:137018984-137019006 CGGAAGGAAGGAAGGGAGGGAGG + Intergenic
1199575504 X:149310203-149310225 CAGAAGGATCTCAGGGAGGTAGG + Intergenic
1199767881 X:150953906-150953928 AGAAAGGAGGGAAGGGAGGTGGG - Intergenic
1200217224 X:154373343-154373365 CAGAAAGAGTGTCAGGAGGTGGG + Intronic
1200231771 X:154447337-154447359 CAGAGGGAGAGAAGCGAGGCAGG + Intronic
1200428342 Y:3046832-3046854 GAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1200559678 Y:4686148-4686170 CAGAAGGAGTGAAGGAAGGATGG + Intergenic
1200608989 Y:5302192-5302214 AAGAAGGAAGGAAGGGAGGAAGG + Intronic
1201058066 Y:10015541-10015563 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1201458879 Y:14201116-14201138 AAGAAGGAGTAAATGGAGGGAGG + Intergenic
1201480440 Y:14432775-14432797 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1201581860 Y:15518085-15518107 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
1201690539 Y:16759913-16759935 GAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1201697409 Y:16841047-16841069 AAGAAGGAAGGAAGGGAGGAAGG + Intergenic
1201741113 Y:17325497-17325519 AAGAAGGAGGGAAGGGAGGGAGG + Intergenic
1202193750 Y:22273863-22273885 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1202201745 Y:22359223-22359245 AAGAAGGAGTGAAGGAAGGAAGG + Intronic
1202234120 Y:22690579-22690601 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1202234142 Y:22690679-22690701 CAGAAGGAAGGAAGGGAGAGAGG + Intergenic
1202309016 Y:23505487-23505509 CAGAAGGAAGGAAGGGAGAGAGG - Intergenic
1202309036 Y:23505579-23505601 AAGAAGGAGGGAAGGAAGGAAGG - Intergenic
1202359974 Y:24097333-24097355 AAGAAGGAAGGAAGGGAGGGAGG + Intergenic
1202510803 Y:25572781-25572803 AAGAAGGAAGGAAGGGAGGGAGG - Intergenic
1202561765 Y:26165013-26165035 AAGAAGGAGGGAAGGAAGGAAGG + Intergenic
1202561784 Y:26165101-26165123 CAGAAGGAAGGAAGGGAGAGAGG + Intergenic