ID: 1083791298

View in Genome Browser
Species Human (GRCh38)
Location 11:64988085-64988107
Sequence CAGGACAAGCACTCTGAGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083791298 Original CRISPR CAGGACAAGCACTCTGAGGC GGG (reversed) Exonic
901443207 1:9292285-9292307 CAGGACAAGTCCCCAGAGGCTGG + Intergenic
901736366 1:11314758-11314780 CAGGACGAGCACACAGAGGGAGG + Intergenic
901803783 1:11724984-11725006 CAGAACAAGCAGTCTGATACAGG + Exonic
902391626 1:16110491-16110513 CAGGAAAACCGCTCTGAGGAGGG + Intergenic
903847562 1:26287545-26287567 CAGGACAAGCAGGCTGCGGCAGG + Intronic
904536008 1:31199857-31199879 CCAGACGAGCTCTCTGAGGCAGG - Intronic
905649509 1:39646971-39646993 CAGGACAAGGACACTGGGGGTGG + Intergenic
909409695 1:75335872-75335894 AAGGACGGGCACTCTGAGGCTGG - Intronic
909949079 1:81697834-81697856 CAGGAAATGCACTCTGAGGAGGG - Intronic
911534961 1:99089248-99089270 CAGCACAAGGACCCTGGGGCTGG - Intergenic
912413189 1:109491610-109491632 AAGGCCAAGCACTGTCAGGCTGG + Exonic
913268376 1:117067429-117067451 CAGGAGAATCACTTTGAGCCGGG + Intronic
915723972 1:158004599-158004621 CTGGAAAAGCACTCTCAGGACGG + Intronic
915928142 1:160040198-160040220 CAGGAGCAGAACTCTGTGGCTGG - Exonic
916052973 1:161049024-161049046 GAGGACAAGCAGGCTGAGCCTGG - Exonic
916579739 1:166096666-166096688 GAGGACAAGAACATTGAGGCAGG - Intronic
917669356 1:177257568-177257590 CAGAGCACCCACTCTGAGGCAGG + Intronic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
920310870 1:205047503-205047525 CAGGACAGGCACTCCCAAGCAGG - Intronic
921445416 1:215241479-215241501 TAGTACAAGTACTCTGAGGAAGG + Intergenic
921986179 1:221315501-221315523 CAGCACAAGCAATCTAAGCCAGG - Intergenic
922599744 1:226840887-226840909 AAGGACAAGCACTCTGCTGGGGG + Intergenic
923216418 1:231852034-231852056 CAGGAACAGCACTGTGAGGGAGG + Intronic
923678271 1:236098677-236098699 AAAGAAAAGGACTCTGAGGCAGG + Intergenic
1064208403 10:13344204-13344226 CAGCACAAGAACCCTAAGGCTGG + Intronic
1064549666 10:16486489-16486511 CAGGACAACCAAGCTGAGCCTGG - Exonic
1070148213 10:73789741-73789763 CGGGACAGGGACTCTGAGACTGG - Exonic
1071088266 10:81889406-81889428 CATGACAGGCACTCTCTGGCAGG - Intronic
1071480938 10:86064505-86064527 CTGGCCCAGCACACTGAGGCAGG - Intronic
1071547640 10:86540371-86540393 CAGGACAGGGATTCTGAGGTTGG + Intergenic
1072675741 10:97464789-97464811 CAGGAGAATCACTTTGAGCCCGG - Intronic
1072944364 10:99796589-99796611 CAGGAGAATCACTTTGAAGCCGG + Intronic
1072982908 10:100114796-100114818 GAGGCCAAGCACACTGCGGCCGG - Intergenic
1073331518 10:102673022-102673044 CAGAAGTAGCACTCAGAGGCTGG + Intergenic
1074115178 10:110451764-110451786 CAGGGCATGCACTGTGAGGCTGG + Intergenic
1074277041 10:112013052-112013074 CAGGACACCCACTCTAAGGGAGG - Intergenic
1075115574 10:119623843-119623865 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076310974 10:129507316-129507338 GAGGACAAGGCCTCTGGGGCAGG + Intronic
1076451739 10:130561206-130561228 GAGGACACGCACTCTGAGAATGG - Intergenic
1077445480 11:2588632-2588654 CTGCACAGGCACTCTGGGGCCGG + Intronic
1078129866 11:8604625-8604647 TAGGAAAAGCTCTCTGAGGAGGG + Intergenic
1078240774 11:9529413-9529435 CAGGACCAGCACTGGGAGGCTGG - Intergenic
1079081406 11:17415788-17415810 CAGCACCTGCACTCTGGGGCTGG + Intronic
1079899471 11:26163860-26163882 CAGGACCTGCATTCTGAGTCTGG + Intergenic
1080684923 11:34507331-34507353 CAGAACAACCACTCTGAGATAGG + Intronic
1081929495 11:46858880-46858902 GAGGACAAGCACACAGAAGCGGG + Exonic
1082139408 11:48590475-48590497 CAGGACAACCACAGTGATGCAGG - Intergenic
1082173123 11:49030242-49030264 CAGGAGAATCACTCTGAACCTGG + Intronic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1083823704 11:65186645-65186667 CAGGAGATGAAATCTGAGGCTGG - Intronic
1084062492 11:66685513-66685535 CAGGAGAATGACCCTGAGGCAGG + Exonic
1084231062 11:67753603-67753625 CAGGCCAAGCACACTGCCGCAGG + Intergenic
1085137012 11:74100270-74100292 CTTGACAAACCCTCTGAGGCAGG - Intronic
1085480310 11:76816734-76816756 CAGAAAAAGAATTCTGAGGCTGG - Intergenic
1085521725 11:77143002-77143024 CAGAACAAGTAGCCTGAGGCAGG - Intronic
1086503476 11:87478009-87478031 CAGGGCATGCACTGTGAGGTTGG - Intergenic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089623907 11:119739430-119739452 CAGGACCAGCTGTCTGAGGCTGG - Intergenic
1091020150 11:132092314-132092336 GAGGCCAGGCACTCTGAGGAAGG - Intronic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1096434097 12:51573576-51573598 CAGGAGCTTCACTCTGAGGCAGG + Intergenic
1097072021 12:56362012-56362034 CAGGACAAGGGGTCTGAGGAGGG + Exonic
1100486403 12:95032344-95032366 CAGCACAAGGAGGCTGAGGCAGG + Intronic
1100837215 12:98577854-98577876 TAAGAAATGCACTCTGAGGCCGG + Intergenic
1100977434 12:100137105-100137127 TAGGAAAAGCTATCTGAGGCTGG - Intronic
1103513349 12:121490296-121490318 GAGGACAAGCACCCTGATGGGGG - Intronic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104044388 12:125151564-125151586 GAGGATAAGGGCTCTGAGGCTGG + Intergenic
1104272309 12:127293375-127293397 CAGCACAAATACCCTGAGGCTGG - Intergenic
1105020636 12:132814370-132814392 CGTGCCGAGCACTCTGAGGCAGG + Intronic
1105446866 13:20465115-20465137 CTGTACAAGCACTGTAAGGCTGG + Intronic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1112684096 13:101802946-101802968 CAGTGCATGCACTGTGAGGCTGG + Intronic
1113308484 13:109105072-109105094 CAGGACAGACACTCTGTGCCTGG + Intronic
1113746943 13:112751829-112751851 TAGTCCCAGCACTCTGAGGCGGG - Intronic
1116595247 14:46833684-46833706 GAGCAGAAGCACTCTGAGACAGG + Intergenic
1117273071 14:54164682-54164704 CTGGAGAATAACTCTGAGGCTGG - Intergenic
1117673807 14:58135175-58135197 CAGGACAAACAATGTGAGTCAGG + Intronic
1118923748 14:70173004-70173026 CAAGACATGCAGTGTGAGGCAGG + Intronic
1118976011 14:70677182-70677204 CAGGACAAGTACTTGGAGGTGGG + Intergenic
1121060732 14:90906924-90906946 CCAGACAAGCCCTATGAGGCAGG + Intronic
1121121253 14:91377129-91377151 CAGGGCAGGCAGTCTGAGGTGGG - Intronic
1121501249 14:94440123-94440145 CATGACAAAGACTCAGAGGCAGG - Intergenic
1121599209 14:95190673-95190695 CAAGACATGCATTCTGAGGGAGG + Exonic
1122288908 14:100668955-100668977 AAGGACAAGTAGGCTGAGGCTGG - Intergenic
1122886854 14:104714037-104714059 CAGACCAAGGACGCTGAGGCCGG + Intronic
1125722475 15:41851881-41851903 CAGGACCAGCACCCTCAGGAAGG + Intronic
1126534579 15:49747521-49747543 CAGTACAAAGGCTCTGAGGCAGG + Intergenic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1127118634 15:55751821-55751843 AAGGACAAAAACTCTGAGTCAGG - Intergenic
1128210543 15:65897929-65897951 CAGGACAAGCAATCTTAAGAGGG - Exonic
1128337656 15:66797745-66797767 GAAGCCAAGCACACTGAGGCTGG + Intergenic
1128584181 15:68833411-68833433 CAGAACCTGCACTGTGAGGCTGG - Intronic
1129153732 15:73704664-73704686 CACGAAAAGCACTCTTAGGAAGG - Intronic
1129182674 15:73886973-73886995 CAGGAGCAGCACTCTGGGGAAGG - Intronic
1130020899 15:80230809-80230831 CAGTCCAAGGACGCTGAGGCAGG + Intergenic
1131101788 15:89696866-89696888 CAGGACAGCCACTCTGAGAAAGG - Intronic
1131850856 15:96541872-96541894 CAGGACATGCACTCTGCAGTTGG - Intergenic
1132113285 15:99117711-99117733 CAGGCCCCGGACTCTGAGGCAGG - Intronic
1132498353 16:274232-274254 CTGGACAAGTACCCTGAGGCCGG - Exonic
1132642530 16:984352-984374 CCAGCCAAGCACTCTGAGGCTGG - Intronic
1132715696 16:1288934-1288956 CAGGGCTGGCACTCTGAGCCCGG + Intergenic
1133346753 16:5076213-5076235 CTGGACATGCACACGGAGGCTGG - Intronic
1135039554 16:19107539-19107561 CAGAACAAGCCCAATGAGGCAGG - Intergenic
1136290503 16:29268610-29268632 CAGGAAAGGCACTCAGAGCCCGG + Intergenic
1138507168 16:57484156-57484178 CAGAACAAACGCGCTGAGGCTGG + Intronic
1141344137 16:83229859-83229881 CAGACCAAACACTCTGAAGCTGG + Intronic
1144102281 17:11952384-11952406 CAGGAGGAGCACTTTGAGCCCGG - Intronic
1144664695 17:17094218-17094240 CAGGACAGGCATCCTGAGACAGG - Intronic
1144673551 17:17146599-17146621 CAGGAAGAGCCATCTGAGGCTGG + Intronic
1148644406 17:49210923-49210945 CAGGACAAGCACTGTCAGGATGG - Intronic
1152437225 17:80283738-80283760 CAGGAGGAGCCCACTGAGGCAGG - Intronic
1152603395 17:81276824-81276846 CAGGACCAGCCCTGTGAGCCTGG - Intronic
1154247995 18:12716891-12716913 CAGGACCAGCACTCTAACCCAGG + Intronic
1155012333 18:21792251-21792273 CAGGACAGGAACTGAGAGGCTGG - Intronic
1155362318 18:25015795-25015817 CAGGACAAGCCCACTGAGGCTGG - Intergenic
1155807666 18:30192431-30192453 CAGGACAAGCAAGCTCAGCCTGG - Intergenic
1156246290 18:35302413-35302435 CAGGACAGGAACCCTGAGGCAGG - Intergenic
1157587445 18:48813791-48813813 CAGGCAAAGCCCTCTGGGGCAGG - Intronic
1158413120 18:57225208-57225230 CATGACAAGCATTTTGGGGCTGG + Intergenic
1159081652 18:63742228-63742250 CAGGACATTGACTCTGAAGCTGG - Intergenic
1159084031 18:63767238-63767260 CAGGAGAAGCCCTCTGGTGCTGG - Intronic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1162544981 19:11323835-11323857 CAGGACCAGCACTGTTAGGATGG - Exonic
1163550252 19:17962511-17962533 CAGGACTTGTACTCTAAGGCAGG - Intronic
1165321691 19:35089324-35089346 CAGGTCAGGCATTCTGAGGGTGG - Intergenic
1165486653 19:36100713-36100735 CAGCACAGCCATTCTGAGGCAGG - Intronic
1165520987 19:36313649-36313671 CAGGAGAATCACTCTGAACCTGG + Intergenic
1165623085 19:37264937-37264959 CAGGAGAATCACTCTGAACCTGG - Intergenic
1166566070 19:43766434-43766456 CAGGAGAAGGCCTCTGAGACAGG + Intergenic
1166663963 19:44665978-44666000 CAGGACCTGCCCTCTGGGGCTGG + Intronic
1166795037 19:45420731-45420753 CAGGACACGCAGACTGGGGCTGG - Intronic
926131000 2:10303070-10303092 CGGGACAAGCGCGCCGAGGCCGG - Intronic
926784476 2:16507015-16507037 AAGGACATGTACTCTGGGGCCGG - Intergenic
927195325 2:20542653-20542675 CAGGCCAAGGAGTCAGAGGCAGG - Intergenic
929642267 2:43593927-43593949 CAAGACAAGAAGTCTAAGGCTGG - Intronic
931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG + Intergenic
933068749 2:77832611-77832633 CAGGACAATCACTTTGTTGCAGG - Intergenic
933767650 2:85721236-85721258 GAGAACAGGCACTTTGAGGCTGG + Intergenic
936115356 2:109698104-109698126 CAGCACAAGGAGGCTGAGGCAGG - Intergenic
937484506 2:122300621-122300643 CAGAACAATCAGTCTGAGGTGGG - Intergenic
937863938 2:126733714-126733736 CAGGACAGGCATTCTGGGGCAGG + Intergenic
938314428 2:130316122-130316144 AAGGAAAGGCAGTCTGAGGCCGG + Intergenic
942589513 2:177527019-177527041 GAGGACAAGGATACTGAGGCAGG - Intronic
943745642 2:191460204-191460226 CAGGACTAACACTCTGAGGTAGG - Intergenic
945555439 2:211269892-211269914 CAGGACCAGCAAACTGAGGTGGG - Intergenic
945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG + Intergenic
946191719 2:218011070-218011092 CTGGACCAGCACTCTAGGGCTGG + Intergenic
1168994871 20:2125636-2125658 CAGCACAGGCACACTGTGGCAGG + Intronic
1169144629 20:3244400-3244422 CAGGACAACCAGTCTCATGCTGG - Intergenic
1169743069 20:8916110-8916132 CAGAATAAGCTTTCTGAGGCTGG + Intronic
1172002396 20:31789315-31789337 CAGCACAAGCACTCTGATATCGG + Intronic
1172563250 20:35907633-35907655 CAGAACAAACCCTCTGAGGTGGG + Intronic
1172963319 20:38814218-38814240 CAGTACAAGGACTTTGAAGCCGG - Intronic
1174147188 20:48460125-48460147 CAGGGCACGAACTCTGAGACCGG - Intergenic
1174543052 20:51304726-51304748 AAGTACAAGTGCTCTGAGGCAGG + Intergenic
1174775681 20:53341165-53341187 AAGGACAAGCAAACTGAGGCAGG - Intronic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1176425131 21:6544044-6544066 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1177714424 21:24821024-24821046 CAGAACAGGCACTCTCAGGCAGG - Intergenic
1178428645 21:32499795-32499817 CAGGCCAAGCACACTGCCGCAGG - Intronic
1179491309 21:41743265-41743287 CAGGTCCAGCACCCTGGGGCAGG + Intronic
1179700622 21:43152361-43152383 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1180970759 22:19814021-19814043 AAGGACACGGACTCTGAAGCTGG + Intronic
1183366033 22:37407425-37407447 CAGTGAAAGCACTGTGAGGCTGG - Intronic
1184510543 22:44930716-44930738 CAGGCAGAGCACTCTGGGGCAGG + Intronic
1185418817 22:50723834-50723856 CAGGACCAGACCCCTGAGGCTGG + Intergenic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
950161657 3:10764965-10764987 CAGGACAAGGACACTAAGCCCGG + Intergenic
950528612 3:13539549-13539571 CAGGACACCCACTCTGTGCCAGG - Intergenic
952416097 3:33092760-33092782 CAGGCAAACCACTCTGAAGCAGG + Exonic
953136640 3:40187714-40187736 GAGGACAAGGTCCCTGAGGCAGG - Intronic
954237073 3:49265104-49265126 CAGAAGTACCACTCTGAGGCTGG + Intergenic
955074690 3:55602553-55602575 CAGGAGAAGCGCTCTGCCGCTGG + Intronic
955392336 3:58530798-58530820 CAGGAGAGGCACTGTGAAGCAGG - Intronic
956000074 3:64720449-64720471 CAGGCCCATCACTCTGAGGTTGG - Intergenic
958672883 3:97227593-97227615 CAAGACATGCACTTTGAGGGTGG + Intronic
961426421 3:126851933-126851955 CAGGGCAAGCAACCTGAGGCTGG - Intronic
961744035 3:129052202-129052224 CAGGCCAAGTCCTCTGATGCTGG + Intergenic
961751922 3:129101622-129101644 CAGGACAAAGGCTCAGAGGCAGG + Intronic
961879687 3:130052619-130052641 CAGGCCAAGCACACTGCCGCAGG + Intergenic
962432192 3:135329812-135329834 ATGGACAAGCACTCATAGGCAGG - Intergenic
962961127 3:140312038-140312060 AAGGGAAAGCACTCTGAGTCTGG - Intronic
963280090 3:143375915-143375937 CAAGACAAGGGCCCTGAGGCAGG - Intronic
963312050 3:143720412-143720434 CAGAACTAGGACTATGAGGCTGG + Intronic
963391646 3:144672601-144672623 CAGGACAAGTGCTTTGAAGCAGG - Intergenic
963749977 3:149167110-149167132 CAGAACATGGACACTGAGGCCGG - Exonic
963835582 3:150055209-150055231 CAGGATATGCTCACTGAGGCTGG + Intergenic
968821976 4:2861124-2861146 AAGTACAAAGACTCTGAGGCAGG + Intronic
969262559 4:6043212-6043234 CAGGAAAAGCACTCTACAGCGGG - Intronic
969823445 4:9737951-9737973 CAGGCCAAGCACACTGCCGCAGG - Intergenic
970060701 4:12030200-12030222 CAGAACAAAGACTTTGAGGCAGG - Intergenic
970459525 4:16258911-16258933 CAGGGCAAGGACTCTGATCCAGG - Intergenic
973861041 4:55065069-55065091 GAGGCCAAGCGCTCTGAGTCAGG + Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
977675286 4:99740557-99740579 CCGGACAGGAACTGTGAGGCTGG + Intergenic
978653693 4:111040695-111040717 CATGAGAAGCACTCAGATGCTGG - Intergenic
978781281 4:112557661-112557683 TAGGGCAAGAACACTGAGGCTGG + Intronic
979722930 4:123923899-123923921 CAGAACAATTACACTGAGGCAGG - Intergenic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
980548468 4:134301912-134301934 CAGGAAAAGCACTCTGTTCCAGG - Intergenic
986488852 5:8269104-8269126 CAGGACAAGCTCTCGAAAGCTGG - Intergenic
990314736 5:54573463-54573485 CAGAACATGCAATTTGAGGCCGG - Intergenic
992357438 5:76000440-76000462 CAGGCCCAGCATTATGAGGCAGG - Intergenic
992477401 5:77117213-77117235 CAGGACAAGCGCTCTGTCTCTGG + Intergenic
992610486 5:78504321-78504343 CAGGAGAAAAATTCTGAGGCAGG + Intronic
993421430 5:87706162-87706184 CATGACATGGACTCTGAGGATGG + Intergenic
993793686 5:92238786-92238808 AAAGACAAGCAATCTGATGCTGG - Intergenic
995192560 5:109333652-109333674 CAGGAGAATCACTCTGAAGGTGG + Intergenic
995466261 5:112452187-112452209 CAGGGCATGCACTGTGAGGCTGG - Intergenic
996445565 5:123545605-123545627 CAAGACAAGCACACTGAAACAGG - Intronic
998722051 5:144963618-144963640 AAGTACAAGTACCCTGAGGCAGG - Intergenic
998860657 5:146440368-146440390 CAGCACAAGCAATCTCAGGATGG - Intergenic
999326750 5:150648822-150648844 CTGGACATGAAATCTGAGGCTGG - Exonic
999645325 5:153711960-153711982 CAGGAGAAGAAGTCTAAGGCGGG + Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1001669848 5:173464401-173464423 CAGGAGCAGGGCTCTGAGGCAGG + Intergenic
1002071671 5:176682195-176682217 CAGGACAAGAAGGCTGGGGCAGG - Intergenic
1002189465 5:177471210-177471232 CAGGACCATCACTCTCAGGATGG + Intronic
1002424744 5:179168325-179168347 CAGGACAAGGAGCCTGAAGCTGG + Intronic
1002560717 5:180080204-180080226 CAGCACCAGCACTCAGATGCAGG - Intergenic
1002711700 5:181198809-181198831 CAGGACAAGGGCTCTGAGAAGGG + Intronic
1004761488 6:18671539-18671561 AAGGGCAAGGACTCTGAGGCAGG - Intergenic
1006599213 6:35214438-35214460 CAGGACAAGCAGGCAGAGCCCGG - Exonic
1011614618 6:89186448-89186470 CAGGAGGGGCACTCTGGGGCAGG - Intronic
1014645536 6:123968161-123968183 CAGTATAATCACTGTGAGGCAGG + Intronic
1016813134 6:148280246-148280268 CAGGGCAACCACCCAGAGGCAGG - Intronic
1018469668 6:164084235-164084257 GAGGACATGGACTCTGAGGCGGG - Intergenic
1019408841 7:897976-897998 CTGGACAAGCCCTCATAGGCAGG - Exonic
1020314708 7:6897298-6897320 CAGGCCAAGCACACTGCCGCAGG + Intergenic
1020360658 7:7323539-7323561 AAGTACAAACACTCTGAGGTGGG + Intergenic
1020724969 7:11800622-11800644 CAGTAAATGCCCTCTGAGGCTGG - Intronic
1021033222 7:15764364-15764386 CAAGGCAAGCTCTCTGAAGCTGG + Intergenic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1022077066 7:26982250-26982272 CAGGATATGCACTGTGAGGCTGG - Intronic
1022218085 7:28284415-28284437 CAGGACAAGCATTCTGAGAGAGG - Intergenic
1022315148 7:29238810-29238832 CAGGACAAAGACCCTGAGGTGGG + Intronic
1025194039 7:56918738-56918760 CAGGACGTGCTCTCAGAGGCTGG + Intergenic
1026033037 7:66811727-66811749 GAGGACATGAACTCTGAAGCTGG + Intergenic
1026467604 7:70668070-70668092 CAGGACAACCACTTGGACGCAGG - Intronic
1026791269 7:73333622-73333644 CAGGACAAGAGCTGTGTGGCGGG - Intronic
1027216523 7:76187293-76187315 CAGGAGAAGCACTTTGGGGTAGG - Intergenic
1029390172 7:100269804-100269826 CACCCCAAGCACTCTGAGCCCGG - Intronic
1029672039 7:102039993-102040015 CAGGACGTGCTCTCGGAGGCTGG + Intronic
1033093356 7:138407127-138407149 CAGGAAAAGCACCCTGAGCTTGG + Intergenic
1033579191 7:142716091-142716113 CAGGACAAGCTCACTGAGTTAGG + Intergenic
1034263367 7:149770599-149770621 CAGAACAAGTAATCAGAGGCGGG + Intronic
1034677977 7:152905424-152905446 GAGGACAAGCTCCCTGAGGATGG + Intergenic
1035891879 8:3353951-3353973 CAGGCCAAGCAGACTGAGACAGG - Intronic
1037504274 8:19515107-19515129 CAGGAAAGGCACTCTGAGGCTGG - Intronic
1037515378 8:19625778-19625800 CAGAACAAGGAGTTTGAGGCTGG + Intronic
1043772870 8:84226516-84226538 CAGGAGAATCACTCAGAGGCAGG - Intronic
1044743727 8:95352566-95352588 CAGGACAGGGATCCTGAGGCAGG + Intergenic
1047090148 8:121565494-121565516 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1048459000 8:134604369-134604391 CAGTACAGTCACTCTGGGGCAGG - Intronic
1049206634 8:141366646-141366668 CAGGACGGGCACTCTGAAGAGGG + Intronic
1049505502 8:142994293-142994315 CAGGACCAGGAGTGTGAGGCTGG + Intergenic
1050039195 9:1471001-1471023 CAGGACAAGCAGGTTAAGGCAGG + Intergenic
1056894031 9:90524079-90524101 CAGGAGAGGCACGCTGGGGCTGG + Intergenic
1058644047 9:107114143-107114165 CTGAAGAAGCACTCTGGGGCTGG - Intergenic
1059411477 9:114135063-114135085 CAGGACAAGAAGCCAGAGGCAGG + Intergenic
1061870068 9:133515754-133515776 CAGCAGAAGCCATCTGAGGCTGG - Intronic
1062695482 9:137873687-137873709 CAGCAGAAGGACTCTGAGGTTGG + Intergenic
1189004637 X:36983022-36983044 AAGAACAAACACACTGAGGCAGG + Intergenic
1189198068 X:39168285-39168307 CAGGTCCAGGACACTGAGGCAGG - Intergenic
1198487848 X:137106312-137106334 CAGTACATGCACTAGGAGGCAGG + Intergenic
1198691911 X:139293716-139293738 CAGAACAAAAACACTGAGGCAGG - Intergenic
1199773243 X:150988411-150988433 CAGGGCGTGCACTGTGAGGCTGG + Exonic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic
1202032480 Y:20592366-20592388 CATGACAAGTTCTCTGAGGATGG + Exonic