ID: 1083791749

View in Genome Browser
Species Human (GRCh38)
Location 11:64990188-64990210
Sequence TCTACCACAGGGAATTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083791749_1083791758 16 Left 1083791749 11:64990188-64990210 CCCACCAAATTCCCTGTGGTAGA 0: 1
1: 1
2: 0
3: 10
4: 144
Right 1083791758 11:64990227-64990249 GTGGCTGCAGCTCAGACCTCCGG 0: 1
1: 1
2: 1
3: 23
4: 349
1083791749_1083791755 -3 Left 1083791749 11:64990188-64990210 CCCACCAAATTCCCTGTGGTAGA 0: 1
1: 1
2: 0
3: 10
4: 144
Right 1083791755 11:64990208-64990230 AGAATTCCAGGCCTGTGTAGTGG 0: 1
1: 0
2: 0
3: 24
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083791749 Original CRISPR TCTACCACAGGGAATTTGGT GGG (reversed) Intronic
902530542 1:17087927-17087949 TCTCCCACAGGGAATGTTGTGGG - Intronic
908740002 1:67317691-67317713 TCTACCACAGGGATGTTTATAGG + Intronic
910633796 1:89384674-89384696 TCTACCTCAGGGTGTTTGGATGG - Intronic
910959027 1:92741224-92741246 TCAAACACAGGCAATCTGGTTGG + Intronic
916197424 1:162237459-162237481 TTTTCCACAGGGATTTTTGTGGG + Intronic
919020535 1:192099648-192099670 TTTAACACAGGAAATTTGGAGGG - Intergenic
922683006 1:227616517-227616539 TCTACCTCAGGGAAATTTGTAGG + Intronic
1064472983 10:15656111-15656133 TCTAACACAGAGAGTTTGGATGG - Intronic
1064742610 10:18449070-18449092 TTTAGCATAAGGAATTTGGTAGG - Intronic
1067582170 10:47452713-47452735 TTTAGCGCAGGGAAGTTGGTGGG - Intergenic
1069914005 10:71776041-71776063 TCTAGCTCAGGGAGTTTGGGAGG - Intronic
1071542056 10:86494537-86494559 TCTACCACTGTGAACTTGATAGG + Intronic
1072223536 10:93347711-93347733 TCGACCACAGGCAGTTTGGGCGG - Exonic
1074388709 10:113038205-113038227 TCTGCGACAGGGTATTAGGTGGG - Intronic
1075115276 10:119620947-119620969 TCCGCCTCAGGGAATTTGCTGGG + Intergenic
1078306555 11:10193901-10193923 TTTTCCACAGGGAATTGAGTTGG - Exonic
1079703556 11:23583154-23583176 TCTACTTCAGAGACTTTGGTAGG - Intergenic
1081091379 11:38870160-38870182 TCTAACACAGGGAATTTTCTTGG + Intergenic
1081678540 11:44985674-44985696 TCCACCACAGGTATTTTTGTTGG + Intergenic
1081755384 11:45540700-45540722 TCTCCCACAGGGAAATGGGAAGG - Intergenic
1082235776 11:49819662-49819684 TCTAACACAGGGATTTTGAGAGG + Intergenic
1082239242 11:49854219-49854241 TCTAACACAGGGATTTTGAGAGG + Intergenic
1082609284 11:55279591-55279613 TCTAACACAGGGATTTTGAGAGG + Intergenic
1082657410 11:55870945-55870967 TCTAACACAGGGATTTTGAGAGG - Intergenic
1083791749 11:64990188-64990210 TCTACCACAGGGAATTTGGTGGG - Intronic
1086691185 11:89789553-89789575 TCTAACACAGGGATTTTGAGAGG + Intergenic
1086714617 11:90050102-90050124 TCTAACACAGGGATTTTGAGAGG - Intergenic
1087135260 11:94710154-94710176 TCCTCCACATGGAATTTGTTAGG + Intronic
1087265128 11:96052328-96052350 TCTACCACATGGAAATTGTCAGG + Intronic
1087271162 11:96113485-96113507 TCTACTTCAGGGAAGCTGGTGGG - Intronic
1088407125 11:109494357-109494379 TCAAGCACAGAGAATTTGGGGGG + Intergenic
1088407185 11:109494926-109494948 TCAAGCACAGAGAATTTGGGGGG + Intergenic
1093825332 12:23678564-23678586 TCTACCAAAGGCACTTTGATGGG + Intronic
1094054508 12:26255824-26255846 CCTTCCCCTGGGAATTTGGTAGG - Intronic
1094380653 12:29840048-29840070 ACTACCACTGGGAATGTGCTGGG + Intergenic
1098360348 12:69648331-69648353 TTTACAAGAGGGAATTTGGGGGG + Intronic
1099582599 12:84470374-84470396 TCTACCACAGTGATATTGTTTGG + Intergenic
1099995121 12:89769966-89769988 TCTACCTCAGTGAAATTTGTAGG - Intergenic
1107008354 13:35640865-35640887 TCTAAAACATGGAATTTTGTAGG - Intronic
1110533508 13:76624485-76624507 TCTTCCACAGGTAATTAGATTGG + Intergenic
1114319925 14:21538890-21538912 TCTACCACAGGGGAGTTAATAGG - Intergenic
1117138095 14:52758144-52758166 CCTACCACAAGGGAATTGGTTGG + Intronic
1120075996 14:80159073-80159095 ACTATCACATGGAATTTGGAAGG + Intergenic
1120617031 14:86719634-86719656 TCTTCCTCTGGAAATTTGGTAGG + Intergenic
1125504710 15:40260666-40260688 TCTACCAAAGGAAATATGCTGGG + Intronic
1126714700 15:51502282-51502304 TTTATCACAGGAAATTTTGTGGG + Intronic
1133817286 16:9207808-9207830 TATAGCACAAGGAATTTAGTGGG + Intergenic
1136523849 16:30815050-30815072 TCCAGGACAGGGATTTTGGTTGG + Intergenic
1136532149 16:30876866-30876888 TCTACCATAAGGAACTTGGTGGG + Intronic
1142508945 17:382540-382562 TCGACCACAGTGACTTTGCTGGG + Intronic
1143260688 17:5596214-5596236 TCCATCACAGGGAATTTGATAGG - Intronic
1145943698 17:28758132-28758154 TCTAAGAAAGGGAATTTGGTGGG - Exonic
1148274359 17:46290289-46290311 TCTACAAAAAGGAATTTGCTGGG - Intronic
1148647106 17:49225441-49225463 TCTACCTCAGGGAATGAGGGAGG - Intronic
1149969501 17:61202357-61202379 TCTATCACAGCGAATAAGGTTGG + Intronic
1150408695 17:64924282-64924304 TCTACAAAAAGGAATTTGCTGGG + Intergenic
1151681272 17:75624104-75624126 TCTAGGACTGGGAACTTGGTGGG + Intergenic
1153846958 18:9058696-9058718 TCTACAGCAGGGATTTTTGTGGG - Intergenic
1154004980 18:10519449-10519471 TCTAGCACAGGGCATATGGGTGG - Intergenic
1156091718 18:33479537-33479559 TCTTCCAGAGGGAATGTGGAAGG - Intergenic
1157564206 18:48668711-48668733 CCAAGCACAGGGAATTTGGGAGG - Intronic
1158002864 18:52639130-52639152 TGTATCACAGAGATTTTGGTAGG - Intronic
1159489411 18:69111360-69111382 TCTACCACAGTGAATTTATCTGG + Intergenic
1161806485 19:6446393-6446415 TCTACCACAGGCAGTGTCGTTGG - Intronic
1162621325 19:11846787-11846809 GTTTCCCCAGGGAATTTGGTGGG + Intergenic
1164357360 19:27454532-27454554 TCTACCACGGGATATTTGGAGGG + Intergenic
1164385377 19:27767149-27767171 TCTACCCCAGGCATTTTGATGGG - Intergenic
1165334878 19:35162678-35162700 ACCATCACATGGAATTTGGTGGG + Intronic
1166627108 19:44367789-44367811 TCTACTAAAGGGATTTGGGTGGG - Intronic
927954913 2:27201373-27201395 TCCACCACAGTGATTGTGGTGGG - Exonic
929370870 2:41222745-41222767 CCTCCCACTGGGAGTTTGGTAGG - Intergenic
934588894 2:95528945-95528967 TCTAACACAGGGATTTTGAGAGG + Intergenic
938546391 2:132336738-132336760 TCTACTAAAGGGAAGTGGGTGGG + Intergenic
939101836 2:137903877-137903899 TCTACCCAATAGAATTTGGTAGG + Intergenic
939661218 2:144892396-144892418 TCTACCAAAGAGAATTTGCTAGG + Intergenic
941031167 2:160513095-160513117 TCTACCAAAAGGAATTTAGGTGG + Intergenic
943006834 2:182395452-182395474 TCTACCTCAGGGAAGTTTCTAGG + Intronic
943866942 2:192937712-192937734 ACTACCACTGGGACTTTGCTGGG + Intergenic
1170169042 20:13391240-13391262 TATACAACAGGGAGTTTTGTAGG + Intronic
1171875249 20:30569470-30569492 TCTACTAAAGGGAATTGGGTGGG + Intergenic
1173270639 20:41531647-41531669 TCTACCACAGAAACTTGGGTGGG - Intronic
1176453705 21:6888559-6888581 TCTACCCAATAGAATTTGGTAGG + Intergenic
1176831880 21:13753607-13753629 TCTACCCAATAGAATTTGGTAGG + Intergenic
1177198620 21:17929697-17929719 TCTAACACAGGGAACTTGCCCGG + Intronic
1177921534 21:27158404-27158426 TTTAACACAGGAATTTTGGTAGG + Intergenic
1178063350 21:28875789-28875811 TCTACCTTAGTGAAATTGGTAGG - Exonic
1178392895 21:32213990-32214012 TCTACCACAGGGGGTATGGGAGG + Intergenic
1184419250 22:44370031-44370053 CCTCACACAGGGAATGTGGTGGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955852961 3:63240862-63240884 TCTACCACAGGGCAATTAGCTGG - Intronic
959029036 3:101276175-101276197 TCTAACACAGAGAAGTTTGTGGG + Intronic
960377024 3:116915706-116915728 TCTACCCCTGGGAATTCTGTGGG - Intronic
961073200 3:123956644-123956666 TCTACCCCAGAAAATTAGGTAGG - Intronic
961262786 3:125616066-125616088 TCTACCTCAGGGAAATTTCTAGG + Intergenic
961828212 3:129609683-129609705 TCTTCCAGAGGGAATTTTGGAGG + Intergenic
963157297 3:142112639-142112661 TCTACCTCAGTGAATTTATTTGG - Intronic
967122706 3:186397468-186397490 TCTAACCCAAGGAATTTGATTGG + Intergenic
971817159 4:31504623-31504645 TCTACCTCAGGGAAATTTCTAGG + Intergenic
972303170 4:37805467-37805489 TGTTTCAAAGGGAATTTGGTGGG + Intergenic
974264045 4:59560832-59560854 TCTACCACAGGGAAGCTGTGAGG - Intergenic
978216047 4:106205160-106205182 TCTGCCACTGTGAAATTGGTCGG + Intronic
978884701 4:113753511-113753533 TCTAGCATAGGGAAATTGGTAGG - Intronic
979524442 4:121702546-121702568 TCTAACACATGGACTTTGGAGGG + Intergenic
979808393 4:125003792-125003814 TCTACCAGAGGGAAATTAATAGG - Intergenic
980807974 4:137837951-137837973 TCTGCCACAGAGAATGTGGCAGG - Intergenic
981851330 4:149233821-149233843 CCTACCACATGGAATTTATTGGG - Intergenic
987060658 5:14240285-14240307 TCTACTAAATGCAATTTGGTAGG + Intronic
987834752 5:23146454-23146476 CCTACCCCTGGGAGTTTGGTAGG + Intergenic
990007188 5:50957317-50957339 TCTAACTCAGGGAATTAGGAAGG - Intergenic
990016011 5:51063689-51063711 TCTCCCACAGGGAACTAGGCAGG - Intergenic
990271769 5:54149546-54149568 TCAACCACTGAGAATTTGCTTGG - Intronic
990784857 5:59408131-59408153 TGTACCACTGGGACTGTGGTGGG - Intronic
992050776 5:72938607-72938629 TCTGCCTCATGGGATTTGGTAGG - Intergenic
994857782 5:105146725-105146747 TCTACCCCAGTGAATTTAGATGG - Intergenic
999805827 5:155080365-155080387 TCCAACACAGGAAATTTGGAGGG + Intergenic
1001201173 5:169718176-169718198 GATGCCACAGGGAGTTTGGTGGG + Intronic
1001265252 5:170269401-170269423 TCTTCCACAGGGAAAAGGGTAGG + Intronic
1001788778 5:174436907-174436929 CCTCCCACTGGGAGTTTGGTAGG - Intergenic
1004006384 6:11641130-11641152 TCTATCATTGGGAATTTGGGAGG + Intergenic
1004416084 6:15425447-15425469 TCTAACACATGAAATTTGGGGGG - Intronic
1005066913 6:21827254-21827276 TCTCCCACACGGTATATGGTGGG + Intergenic
1006485636 6:34338837-34338859 TCATTCACAGGGAATCTGGTTGG + Intronic
1007507162 6:42344593-42344615 TCTACCACAAGGCATCTGGGCGG + Intronic
1009409857 6:63353448-63353470 TCTATCACAGAGTATTTTGTAGG + Intergenic
1009881208 6:69568378-69568400 TCTGGCACAAGGAATTTAGTGGG - Intergenic
1011771330 6:90676683-90676705 GCTCCAACAGGGAATTTGGGAGG - Intergenic
1012635766 6:101538898-101538920 ACTACCACATAAAATTTGGTTGG - Intronic
1013461466 6:110378699-110378721 CCTCCCTCAGGGAGTTTGGTAGG - Intergenic
1014369331 6:120584634-120584656 CCTCCCACAAGGAGTTTGGTAGG + Intergenic
1015519813 6:134118852-134118874 TCTATCACAGGGGATTTATTGGG + Intergenic
1024055572 7:45658034-45658056 CCCACCACAGGGAGTCTGGTTGG - Intronic
1030120334 7:106104134-106104156 TCTACCACAGGGAATTGGGTAGG - Intronic
1030891543 7:115005053-115005075 TCTAGCACAGGGTATTTTCTTGG - Intronic
1034387653 7:150753790-150753812 TCTCACACATGGAATATGGTTGG + Intergenic
1038723321 8:30057606-30057628 TCTACCTCAGGGAAATTTCTAGG - Intergenic
1040088660 8:43371956-43371978 TCAAACTCAGGGAATCTGGTGGG + Intergenic
1042655526 8:71091502-71091524 ATCACCAGAGGGAATTTGGTGGG + Intergenic
1042745094 8:72098640-72098662 TCTGCCACAGGGCTTTTGGCTGG + Intronic
1043247119 8:78018108-78018130 TCTACTACAATAAATTTGGTTGG + Intergenic
1045248984 8:100467523-100467545 TCCCCCACAGGTAATTTGATTGG - Intergenic
1046343343 8:112888383-112888405 TCTAAGACAGGTAATTTTGTGGG - Intronic
1048409821 8:134161278-134161300 TTTATCACACTGAATTTGGTGGG + Intergenic
1048799041 8:138179406-138179428 TCTACCAAAGGGTATCTGGCAGG - Intronic
1052696220 9:31882441-31882463 TTTACAACAGGTATTTTGGTAGG + Intergenic
1052857897 9:33418361-33418383 TCTACCACAGGGCACTGGCTGGG - Intergenic
1054781402 9:69169235-69169257 GCTACCCCAGGGTATATGGTAGG + Intronic
1054883765 9:70173673-70173695 ACTACTACAGGGAATTCTGTGGG + Intronic
1058734764 9:107884062-107884084 TCTGCACCAGGGAATTTGTTTGG + Intergenic
1187579232 X:20591223-20591245 ACCACCACTGGGACTTTGGTGGG + Intergenic
1193041270 X:77006360-77006382 TCTAGAAAAGGGAACTTGGTGGG - Intergenic
1194290985 X:92071843-92071865 ACTACCACTGGGACTTTGCTAGG + Intronic
1195471538 X:105235682-105235704 TAGACTACAGGTAATTTGGTGGG + Intronic
1197772141 X:130095961-130095983 TCTACCACAGAGAATAGGGTGGG - Intronic
1198198487 X:134389513-134389535 TCTACCACAAGGCACCTGGTTGG - Intronic
1199816199 X:151398747-151398769 GCTACAAAAGGGAATGTGGTAGG + Intronic
1200608494 Y:5296418-5296440 ACTACCACTGGGACTTTGCTAGG + Intronic