ID: 1083792109

View in Genome Browser
Species Human (GRCh38)
Location 11:64992558-64992580
Sequence CCTTATAAGAAGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1469
Summary {0: 1, 1: 2, 2: 31, 3: 273, 4: 1162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083792101_1083792109 19 Left 1083792101 11:64992516-64992538 CCTAGGATAGAGGATCGGGTTCT 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG 0: 1
1: 2
2: 31
3: 273
4: 1162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083792109 Original CRISPR CCTTATAAGAAGAGGGAAGG AGG Intronic
900607086 1:3528606-3528628 CCTTATAAGAGGGAGGCAGGAGG + Intronic
900761406 1:4473962-4473984 CCTTATAAGAAGAGGAGACTAGG - Intergenic
900847331 1:5114433-5114455 GCTTATAAGATGAGGGAAGCAGG + Intergenic
900848025 1:5119182-5119204 GCTTATAAGATGAGGGAAGCAGG + Intergenic
900901714 1:5521158-5521180 CCTTATAAGAAGAGGAGATTTGG - Intergenic
900909069 1:5581525-5581547 CCTTATAAAAAGAGGAAACGTGG + Intergenic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
901178400 1:7321842-7321864 CCTGATAAGAAAGGAGAAGGAGG - Intronic
901208402 1:7510450-7510472 CCTCTTAACAAGTGGGAAGGTGG - Intronic
901692787 1:10984459-10984481 CTTTATAAGAAGAGGAAAATTGG - Intergenic
901773766 1:11545080-11545102 CCTGATAAAAAGAGGGAATTTGG + Intergenic
902041939 1:13499020-13499042 CCTTATAAAAAGGGGGAATTTGG - Intronic
902167617 1:14585021-14585043 CCTTACAAGAAGAGGAGATGAGG + Intergenic
902246701 1:15125334-15125356 CCTTATAAGAAGAGGCGATTTGG - Intergenic
902666180 1:17940259-17940281 CCTTATAAGAAGGAGGCAGGAGG - Intergenic
902716412 1:18275895-18275917 TCTTAGGAGAAAAGGGAAGGGGG - Intronic
902999181 1:20252552-20252574 CCTTAAAAGAAGAGGAAATTTGG + Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
903072976 1:20736978-20737000 CCTTATAGGAAGAGGAAATTTGG + Intergenic
904195917 1:28785398-28785420 GCTTATAAGAAGAGGCACAGCGG + Intergenic
904292308 1:29495926-29495948 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
904503910 1:30935277-30935299 CCTTTCCAGAAGAGGGAACGTGG - Intronic
904916236 1:33972529-33972551 CCTTATAAGAGGGGGGCAGGAGG + Intronic
904982816 1:34521281-34521303 CCTTATAAGAGGAAGGCAAGAGG - Intergenic
905136795 1:35806754-35806776 CCTTATAAGAAGAGGAAATTTGG + Intergenic
905277850 1:36830504-36830526 CCGTATAAGAAGAGGAAAAGAGG + Intronic
906052350 1:42886294-42886316 TCATATAAGAAGAGGGAAAGAGG - Intergenic
906093006 1:43198765-43198787 GCTTAAAAAAAGGGGGAAGGAGG + Intronic
906301723 1:44687257-44687279 CCTTATAAGAAGAGGTGACTAGG - Intronic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
907153740 1:52312977-52312999 CCTTATAAGAAGGGGAAATATGG + Intronic
907182670 1:52584527-52584549 GCTTATAAGAAGAGGAAATTTGG + Intergenic
907289168 1:53401973-53401995 CTTTATAAAAAGAGGAAATGTGG + Intergenic
907740150 1:57157609-57157631 CTTTGTAAGAAGAGGAAAGGAGG - Intronic
907929581 1:58986925-58986947 TCTTATAAGAAGAAGAAATGTGG + Intergenic
907957527 1:59244395-59244417 CCTTTTAAGAAAAGGGAAATTGG - Intergenic
908061320 1:60352772-60352794 CCTTATATGAAGAGGAAATTTGG + Intergenic
908113276 1:60917829-60917851 CCTTATAAAAAGGGGAAATGTGG - Intronic
908292503 1:62682500-62682522 CAGTATAAAAACAGGGAAGGGGG + Intronic
908339652 1:63163546-63163568 TCCTAGAAGATGAGGGAAGGAGG - Intergenic
908414178 1:63896690-63896712 GCTTATAAGCAGAGGGGAGCAGG + Intronic
908769102 1:67580378-67580400 CCTTACAAGAAGAGGAAATGTGG - Intergenic
908859151 1:68463813-68463835 CCTTATAAGAGGAAAGCAGGAGG - Intergenic
908886165 1:68791369-68791391 CCTTATAAGAAGAGGAGATGAGG + Intergenic
909206037 1:72759045-72759067 CCATTTCAAAAGAGGGAAGGAGG + Intergenic
909471498 1:76033941-76033963 CCTTATAAGAAGAGGAGACATGG + Intergenic
910112904 1:83701297-83701319 CCTTGTAAGAAGAGGAAATCTGG + Intergenic
910119626 1:83772099-83772121 CCTGATTAGAAAAGAGAAGGAGG + Intergenic
910270840 1:85392295-85392317 CTTTATAAGAAGAGGAAATTTGG - Intronic
910301377 1:85710436-85710458 CTTTATAAGAAGAGGAAATTTGG + Intergenic
910406256 1:86893673-86893695 TCTTATAAAAAGAGAGAAAGAGG + Intronic
910551565 1:88481329-88481351 CCTTATAAGAAGAGGAGATGAGG + Intergenic
910816370 1:91295470-91295492 TCTTATAAGAAGAGGAAATTAGG - Intronic
911506373 1:98757466-98757488 CCTTATAAGAAGAGGAAATCTGG - Intronic
911889612 1:103351493-103351515 TCTTATAAGAAGGGGGCAAGAGG + Intergenic
912087090 1:106021373-106021395 CCTTACAAGAGAAGGGCAGGAGG - Intergenic
912405084 1:109430906-109430928 TTTTATAAGAAGAGGGAATTTGG + Intergenic
912477130 1:109945971-109945993 CCTTATAAGAGGAAGGCAGGGGG - Intergenic
913066180 1:115257531-115257553 CCTTGTAAGAAGAGGAAATTAGG - Intergenic
914315636 1:146508910-146508932 CCTTATAAGAAGAGGAAATTTGG - Intergenic
914433897 1:147643040-147643062 CCTTATAAGAAGAGGAAATGAGG - Exonic
914498719 1:148224451-148224473 CCTTATAAGAAGAGGAAATTTGG + Intergenic
914739488 1:150451838-150451860 CCATATAAGAAGAGGGAAACTGG + Intronic
914801421 1:150965452-150965474 GCTGAAGAGAAGAGGGAAGGGGG + Exonic
914949973 1:152104703-152104725 CCTTATAAGAAGATGAAATTTGG - Intergenic
914957994 1:152181872-152181894 ACTTATGAGACAAGGGAAGGAGG - Intergenic
915661402 1:157408675-157408697 CCTTATAAAAAGAGGGAATCTGG - Intergenic
915719967 1:157977768-157977790 TCTTATAAGAAGAGGAAATTAGG + Intergenic
915921779 1:159981193-159981215 CCTTATAAGAAAAGGAAACCAGG + Intergenic
916002635 1:160631618-160631640 CCTTATAAGAAGAGGAAATCTGG + Intronic
916002671 1:160631929-160631951 CCTTATGAGAAGAGGAAATTTGG + Intronic
916292760 1:163184649-163184671 CCTTGTAAGAAGAAGGCAGGAGG + Intronic
916632888 1:166636002-166636024 CCTTATAAGAAGGAAGCAGGAGG - Intergenic
916655323 1:166870279-166870301 CCTTATAAGAAGAGGCAATTAGG + Intronic
916822809 1:168416245-168416267 CCTTATAAGAAGAGGCTTGAAGG + Intergenic
916881474 1:169023382-169023404 CCTTATAAGAAGAGAAAATGTGG - Intergenic
916885102 1:169059825-169059847 CCTTATAAGAAGAGGAAATTTGG + Intergenic
917426584 1:174920717-174920739 CCTTGTAAGAAGAGGAAATTTGG + Intronic
917468272 1:175303929-175303951 CCTTATAAGAAGAGAGATCAGGG - Intergenic
917625937 1:176846378-176846400 CCCTAACAGAAGAGGGAAGCTGG + Intergenic
918037839 1:180893095-180893117 CCTTGAAAAAAGAAGGAAGGGGG + Intergenic
918382443 1:183969594-183969616 CATGATAAGAGGAGTGAAGGTGG - Intronic
918484549 1:185015515-185015537 CCTTATAAAAAGAGATAAGAGGG + Intergenic
918706304 1:187667036-187667058 CCTTATAAGAAGAAGAAATTTGG - Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
919119036 1:193315855-193315877 CGTTAAAGGGAGAGGGAAGGAGG - Intergenic
919294573 1:195679674-195679696 CCTTACAAGAGGAAGGAAGAAGG + Intergenic
919410096 1:197232037-197232059 CCTTATAAGAGAAAGGTAGGAGG + Intergenic
919754632 1:201059095-201059117 CCTGATAGGATGAGGGATGGGGG + Intronic
919760215 1:201093272-201093294 CCTTATAAGAAGAGGAACTCTGG + Intronic
920007880 1:202846535-202846557 CCTTATAAGAGGAGGCAATAAGG + Intergenic
920236652 1:204511439-204511461 CCTCATAAGAAGAGGGGATTAGG + Intergenic
920282976 1:204858218-204858240 CCTTATAAGAAGAGGAGATTAGG - Intronic
920446926 1:206024710-206024732 CCTTATAAGAAGAGGAAATGTGG - Intergenic
920718127 1:208360517-208360539 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
920752143 1:208688919-208688941 TCTTAAAAGATGAAGGAAGGGGG + Intergenic
920755192 1:208723349-208723371 CCTTATGAGAAGAGGAAATTAGG + Intergenic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
920869144 1:209779033-209779055 CCTTATAAGAAGGGGAAATATGG - Intronic
920989591 1:210923978-210924000 CCTTATAAGAAGAGAAGAGATGG + Intronic
921125098 1:212170512-212170534 CTTTATAAGAAGAGGAAAAGGGG + Intergenic
921337315 1:214101198-214101220 CTTTATAAGAGGAGGAAATGTGG - Intergenic
921510851 1:216027221-216027243 CCTTATAAGAAGAGAAAATTTGG + Intronic
921891821 1:220361253-220361275 CTTTATAAGAAGAGGCAATTTGG + Intergenic
921892500 1:220367249-220367271 CCTTTTAAGAAGAGGTCAGAAGG - Intergenic
922141334 1:222890896-222890918 CCTTATAAAAAGAGGAAATCTGG - Intronic
922212862 1:223498891-223498913 CCTTGTCAGAAGAGAGCAGGGGG - Intergenic
922597148 1:226822914-226822936 CCTTATAAGAGGGAGGCAGGAGG - Intergenic
922856663 1:228780882-228780904 CCTGGAAAGAGGAGGGAAGGTGG + Intergenic
922858359 1:228794544-228794566 CTTTATAAGAGGGAGGAAGGGGG - Intergenic
922881646 1:228985650-228985672 CCTTATAAGAAGAGGAGATGAGG - Intergenic
923001031 1:230006563-230006585 CCTTATAAAAAGGGGGAATTTGG - Intergenic
923087277 1:230711221-230711243 CCTTATGAGAAGAGGAGATGAGG + Intronic
923492645 1:234498058-234498080 CCTTATAAGAAGAGAAAATTAGG + Intergenic
923615270 1:235532116-235532138 CATTATAAGAAGAGGAGATGAGG - Intergenic
923617358 1:235548890-235548912 CCATCTAAGAAGAGGGAACTAGG + Exonic
923656480 1:235921557-235921579 CCTTATAAAAAGAGGAAATTTGG + Intergenic
923889507 1:238196815-238196837 CCTTATAAGGAGAGGGGATTTGG + Intergenic
923972298 1:239218096-239218118 CCTTATAACAAGAGGAAATTAGG + Intergenic
924046996 1:240042026-240042048 TCTTACAAGAGGAGGGAAGAGGG - Intronic
924513680 1:244749105-244749127 CCTTATAAGAAGAGGGGATTAGG + Intergenic
1062789662 10:294201-294223 CCTTGGAAGAAGATGGAAGAGGG - Intronic
1062957675 10:1551119-1551141 CCTTATAAGAAGAGGAGATGAGG + Intronic
1062961797 10:1577880-1577902 CCTTATAAAAAGAGGAGATGAGG + Intronic
1063736546 10:8761944-8761966 TCTTATAAGAAGGGGGCAGGAGG - Intergenic
1063768436 10:9169492-9169514 CCTTCATTGAAGAGGGAAGGAGG + Intergenic
1064651677 10:17516001-17516023 CCTTATAAAAAGAGGAAGGGAGG - Intergenic
1064726772 10:18288061-18288083 CCTTATAAAAAGAGGAAAGTTGG - Intronic
1065002802 10:21352444-21352466 CCTTATAAGAAGAGGAGACTAGG - Intergenic
1065228703 10:23574576-23574598 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1066117089 10:32250116-32250138 CCTTATAAGAAGAGACACAGAGG + Intergenic
1067203503 10:44194808-44194830 CCTTATAAGAAGAGGATATTAGG - Intergenic
1067244048 10:44521460-44521482 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1067309837 10:45102449-45102471 CCTCATAAGAGGGAGGAAGGAGG - Intergenic
1067408835 10:46047223-46047245 CCTTATCAGAAGAGGAAATTTGG - Intergenic
1067460209 10:46452607-46452629 CCTTATAAGAAGGGGAAATTTGG - Intergenic
1067548421 10:47214415-47214437 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1067549045 10:47220416-47220438 CCTTATAAGAAGAGGAGACTGGG + Intergenic
1067626981 10:47931996-47932018 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1067658796 10:48218146-48218168 CCTTATAAGAAGAAGAAATTTGG - Intronic
1067834390 10:49629152-49629174 CCTTATAGGCAGTGGGTAGGAGG - Intronic
1068711726 10:60142176-60142198 CTGTATAACAGGAGGGAAGGTGG - Intronic
1068820301 10:61368666-61368688 CCTTATTAGAAGGAGGCAGGAGG - Intergenic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1069268772 10:66497007-66497029 CCTTGCAAGAAGAGGGAATTAGG - Intronic
1069363747 10:67674229-67674251 CCTTCTAAGAAGAGGAAATTAGG + Intronic
1069696975 10:70393788-70393810 CCTTTTAAGAACAGGAAGGGAGG - Intergenic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1069963369 10:72092556-72092578 CTTTATAAGAAGAGGGAATTTGG - Intergenic
1070489039 10:76958628-76958650 CCTTACAAGAAGAGGAAATTTGG + Intronic
1070548081 10:77468502-77468524 CCTTAGAAGAAGAGGAAATTAGG + Intronic
1070629443 10:78074475-78074497 CCTTATAAGAAGGAGGCAGGAGG + Intergenic
1071507199 10:86239957-86239979 CCTCATAAGAAGAGGAGATGAGG + Intronic
1071553253 10:86583714-86583736 ACTGATGAGAGGAGGGAAGGAGG - Intergenic
1071943936 10:90619486-90619508 CCTTATAAGAGCAGGGCAGGAGG - Intergenic
1072326896 10:94307685-94307707 CCTTATGAGAAGAGGGGATTAGG - Intronic
1072798118 10:98372184-98372206 CCTTATAAAATGAGGGAAGTTGG - Intergenic
1072918263 10:99553826-99553848 CCTCATAAGAAGAGGGGATCGGG - Intergenic
1073110775 10:101061893-101061915 CCTTAGAACTAGTGGGAAGGCGG + Exonic
1073191192 10:101651606-101651628 CCTTATAGAGGGAGGGAAGGAGG - Intronic
1073493041 10:103867556-103867578 GCTTATAAGAAGAGGAGATGAGG + Intergenic
1073545993 10:104349456-104349478 CCTTACAAGAAGAGGAAAATTGG - Intergenic
1073570326 10:104575880-104575902 CCTTATAAGAAGAGGATATTTGG + Intergenic
1074044223 10:109821741-109821763 CCTTAGAGGAACAGGGAAGAGGG + Intergenic
1074377835 10:112952874-112952896 GCTTCTTAGAAGAGGGAGGGAGG - Intronic
1074578786 10:114696432-114696454 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1074899907 10:117807031-117807053 CCTTTTAAGAAGAGGGTATTTGG - Intergenic
1075025921 10:118982958-118982980 CCTTATAAGAAGAGAAGATGAGG + Intergenic
1075263971 10:120985144-120985166 GCTTATAAGAAGAGGAAATTTGG - Intergenic
1075448597 10:122531150-122531172 CCTTATAAGACGATGTCAGGAGG + Intergenic
1075533442 10:123250068-123250090 CATTATAGGAAGAGAGAATGTGG + Intergenic
1075851951 10:125596284-125596306 CCTTATAAGAGGAGAGAAGAAGG + Intronic
1076000865 10:126912117-126912139 CCTTGTAAGAAGAGGAAATGAGG - Intronic
1076030553 10:127154180-127154202 CGTTATAAGCACAGGGAATGTGG + Intronic
1076074646 10:127523455-127523477 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1076183119 10:128426111-128426133 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1076303044 10:129442243-129442265 CCTTATAAAAAGAGGGAGACTGG + Intergenic
1076327507 10:129637723-129637745 CCTTATAAGAAGAGGAGATTAGG + Intronic
1077075924 11:702139-702161 CCTGATAACAAGAGGAAGGGTGG - Intronic
1077114846 11:879441-879463 TCTTATAAGAAGAGGAGAAGAGG + Intronic
1077320848 11:1941052-1941074 CCTTATAACAAGAGGAGATGAGG - Intergenic
1077336368 11:2006675-2006697 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1077399059 11:2344223-2344245 CCTTGTAAGAAGAGGAGATGAGG + Intergenic
1077527232 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG + Intergenic
1077542714 11:3154994-3155016 CCTTATAAAAAGAGGAGATGAGG + Intronic
1077582643 11:3426724-3426746 CCTTATAAAAGGAGAGAATGAGG + Intergenic
1078108103 11:8371262-8371284 CCTTAGAGGAAGAGGAGAGGAGG + Intergenic
1078320894 11:10333571-10333593 CCTTATAAGAAGAGGAGATTAGG + Intronic
1078361386 11:10670746-10670768 CCTTATAAGAAGAGGAAATTTGG + Intronic
1078550992 11:12280607-12280629 CTTTCTAAGAAGAGGAAATGTGG - Intronic
1078864512 11:15284481-15284503 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
1079072248 11:17357338-17357360 CCTTATAAGAAGAGGAAATTAGG - Intronic
1079293039 11:19205800-19205822 CCTTGTAAGAAGAGGAAATTAGG - Intronic
1079590299 11:22175359-22175381 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1079656824 11:22995290-22995312 CCTTATCAGAAGTTGGAAAGAGG - Intergenic
1079900087 11:26172409-26172431 CCTTATAAAATGAGTTAAGGAGG - Intergenic
1080051430 11:27862995-27863017 CCTTAGAAGAAGAGGCAATTAGG - Intergenic
1080181912 11:29435680-29435702 CCTTATAAAAAGGAGGCAGGAGG - Intergenic
1080580413 11:33637751-33637773 CCTTCTAAGAAGAGGAAATTTGG - Intronic
1080688400 11:34534836-34534858 CATCATCAGATGAGGGAAGGAGG + Intergenic
1080745685 11:35106581-35106603 CCTTCTAAGAAGAGCACAGGTGG + Intergenic
1081205494 11:40270398-40270420 CCTTTTAAGAAGAGGAAATCTGG - Intronic
1081208978 11:40308559-40308581 CCTTATAAGAGAAAGGCAGGAGG + Intronic
1081222199 11:40475760-40475782 TCTGATAAGAAGAGGAAAGTTGG - Intronic
1081370940 11:42302239-42302261 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1081467471 11:43335286-43335308 TCTTATAAGAAGGAGGAATGTGG - Exonic
1082781057 11:57287681-57287703 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1082784462 11:57309274-57309296 CCTTCTAGCAAGATGGAAGGTGG - Exonic
1082919936 11:58482049-58482071 ACTTATAAGAAGTAGGAAGCTGG + Intergenic
1083396202 11:62393964-62393986 CCTCATAAGAAGAGGGGATTAGG - Intergenic
1083700373 11:64473507-64473529 TCTTATAAGCAGAGGAAATGTGG - Intergenic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1084122249 11:67076502-67076524 CCAAATAAGAGGAGGGAAGTCGG + Intergenic
1084239544 11:67809544-67809566 CCTTATAAAAGGAGAGAATGAGG + Intergenic
1084305344 11:68279072-68279094 CCTCCAAAGAAGTGGGAAGGTGG + Intergenic
1084327627 11:68410972-68410994 TGCTAAAAGAAGAGGGAAGGAGG + Intronic
1084441835 11:69179057-69179079 ATTTAAAAAAAGAGGGAAGGAGG + Intergenic
1084453960 11:69256724-69256746 CCTTATGAGAGGGAGGAAGGGGG + Intergenic
1084509135 11:69592259-69592281 CCTTATAAGAAAAGGAGATGAGG + Intergenic
1084547888 11:69823468-69823490 CCTTATAAGAAGAGGTAATGAGG - Intergenic
1084706983 11:70821243-70821265 CCTTATAAGAAGAGGCGATGAGG + Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1084732254 11:71081113-71081135 CCTTATAAGAAGAGGAGCTGGGG + Intronic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1084832879 11:71783301-71783323 CCTTATAAAAGGAGAGAATGAGG - Intergenic
1084868815 11:72081682-72081704 CCTTGGAAGAAGAAGGAATGAGG - Intronic
1085439925 11:76550905-76550927 TCTTAAAGGAAGAGGGAAAGTGG - Exonic
1086184036 11:83991942-83991964 CCTTATAAGAAGAGGAAATTTGG + Intronic
1086573483 11:88311753-88311775 CCTTATAAGAAGAGGACATTAGG + Intronic
1086738680 11:90340071-90340093 ACTTATAAGAAGAGGAAATTTGG - Intergenic
1086852432 11:91825703-91825725 CCTTCTAAGAAGAGGAAATTTGG - Intergenic
1086858569 11:91897175-91897197 TCTTATAAGAAGAGGAAATTTGG - Intergenic
1086932074 11:92704576-92704598 CCTTATAAGAAGAGGAAATTTGG + Intronic
1087157790 11:94921848-94921870 CATTATAAGGAGAAGGCAGGAGG - Intergenic
1087608563 11:100406722-100406744 CCTTATAAGAAGAAGAAATGTGG + Intergenic
1087715111 11:101599597-101599619 CCTTAGAATAAGTGGGAATGTGG + Intronic
1088141805 11:106625826-106625848 TCTTATAAGAGGAAGGCAGGAGG - Intergenic
1088230951 11:107672700-107672722 CCTTATAAGAAGAGTCAAAGAGG - Intergenic
1088363073 11:109011436-109011458 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088433093 11:109779918-109779940 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088556931 11:111071265-111071287 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1088698376 11:112389805-112389827 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1088747388 11:112815600-112815622 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1088755559 11:112882411-112882433 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1088838425 11:113600634-113600656 CCTAATAAGAATAGAGAGGGGGG + Intergenic
1089013990 11:115152024-115152046 CCTTATAAGAAGAGGACATTTGG + Intergenic
1089576742 11:119449765-119449787 CCTTATAAGAAGAGGAGATTTGG + Intergenic
1089579477 11:119472486-119472508 TCTTATGAGAAGAGGAAACGAGG + Intergenic
1089616623 11:119698461-119698483 CCTTATAATAAGAGGAATTGAGG - Intronic
1089882071 11:121783932-121783954 CCTCACAAGAAGAGTTAAGGAGG + Intergenic
1090036187 11:123251753-123251775 CCTTATAAGGAGGGGGAAATTGG + Intergenic
1090212763 11:124934484-124934506 CCTTATAAAAAGGGGAAATGTGG + Intronic
1090246028 11:125216540-125216562 CTTTTGAAGAAGAGGGAAAGGGG - Intronic
1090285983 11:125499798-125499820 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1090634412 11:128681697-128681719 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1090644443 11:128756368-128756390 TCTTATAAGAAGAGGGAATTTGG - Intronic
1091071585 11:132569256-132569278 CCTCATAAGAAGAGGAAATTAGG + Intronic
1091118332 11:133035774-133035796 CCTTATAAGAAGAGGACATTTGG + Intronic
1091269829 11:134300268-134300290 CCTTATAAGAAGAGGAGATTAGG - Intronic
1202819352 11_KI270721v1_random:61857-61879 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1091899142 12:4129843-4129865 CCTTGTAAGAAGAGGAGAAGAGG - Intergenic
1093120359 12:15264027-15264049 CCTTATAAAAAGAGGAAATATGG + Intronic
1093388892 12:18593112-18593134 CTTTATAAAAAGAGGAAATGTGG - Intronic
1093404888 12:18792273-18792295 CCTTCTAAGAGGAAGGCAGGAGG - Intergenic
1093558235 12:20504783-20504805 ACTTATAAGAAGAGGCAGGAGGG - Intronic
1093830055 12:23744970-23744992 CTTTATAAGAAGAGGAAATTTGG - Intronic
1094080841 12:26533642-26533664 CCCTATAAGAAGAGGAAATTTGG + Intronic
1094083288 12:26561105-26561127 CCTTATAAGAAGAAGGGATTAGG + Intronic
1094277901 12:28699612-28699634 CCTTAAAAGAAGAGAGAACTTGG + Intergenic
1094310127 12:29071157-29071179 CCTTATAAGAACAGTGAAACTGG - Intergenic
1094620145 12:32073084-32073106 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1095482159 12:42647968-42647990 CCTTCAAAGACGAAGGAAGGGGG - Intergenic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1096792916 12:54056161-54056183 CCTTAGAAGAACAAGCAAGGGGG + Intergenic
1096794846 12:54070091-54070113 CCTTATAAGAAGAGATCAGCAGG - Intergenic
1097206368 12:57324934-57324956 CATTATAAGAAGAGGAAATTTGG + Intronic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1097432658 12:59528967-59528989 CCTTATATCCAGAGGGAAAGAGG + Intergenic
1097432851 12:59530162-59530184 GCTAATATGAAGAGGGAAAGAGG + Intergenic
1097583938 12:61492671-61492693 CCTTATAAAATAAAGGAAGGAGG + Intergenic
1098217228 12:68233568-68233590 CCTTATTAGAAGAGGAGATGAGG + Intergenic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098692797 12:73510310-73510332 CACTATGAAAAGAGGGAAGGTGG + Intergenic
1098815798 12:75160181-75160203 CCTTATAAGAAGAAGAAATTTGG + Intronic
1098936089 12:76480976-76480998 CCTTATAAGAGGAAGCAAGAGGG + Intronic
1098938077 12:76503357-76503379 CCTTATAAGAAGAGGAAATTTGG - Intronic
1099230552 12:80019021-80019043 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1099450279 12:82799727-82799749 CCTTATAAAAAGGGGAAATGTGG - Intronic
1099533408 12:83816202-83816224 CCTTATAAGAAAAGGAAGAGAGG - Intergenic
1099563010 12:84202895-84202917 CCTTATAAGAAGAGGCACCTTGG - Intergenic
1100068293 12:90678703-90678725 CCTTATAAAAAGAGGAAATTTGG + Intergenic
1100216549 12:92455965-92455987 CCTTATAAGAAAAGGGAATTTGG - Intergenic
1100325097 12:93532794-93532816 CCTTATAAGAAGGGGAGATGAGG + Intergenic
1100365088 12:93912936-93912958 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1100366614 12:93927083-93927105 CCTTATAACAAGAGGAAATTGGG + Intergenic
1100442741 12:94631430-94631452 CCTTATAAGAAGAGAAAATCTGG + Intronic
1100566502 12:95799542-95799564 CCCTATAGGAAGGGTGAAGGAGG + Intergenic
1100606310 12:96154681-96154703 CCTTATAAGAAGAAAGAGAGAGG + Intergenic
1100615662 12:96229828-96229850 CCTCATAAGAAGAGGAAAATCGG - Intronic
1100660075 12:96687174-96687196 CCTTATAAGAGAAAGGCAGGAGG - Intronic
1100857643 12:98772307-98772329 CCTTACAAGAAGAGGAAATTTGG + Intronic
1101071642 12:101081863-101081885 CTTTATAAGAAGAGGAAATTTGG - Intronic
1101214472 12:102566838-102566860 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1101282519 12:103273247-103273269 CCATAAAAGAAGAAGGAATGTGG + Intronic
1101319807 12:103663647-103663669 CCTTATAAAAAGAGGAGAGGTGG - Intronic
1101429145 12:104612428-104612450 CCTTATAACAAGGGGAAATGTGG - Intronic
1101552378 12:105774688-105774710 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1101607248 12:106256998-106257020 CCTTATGAGAAGAGGAAATTTGG - Intronic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102448180 12:113019816-113019838 CCTTATAAGAGGGAGGAAGTGGG - Intergenic
1102598387 12:114010796-114010818 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1102659405 12:114512903-114512925 CCTTTTATGAAGGGGGAAGTAGG - Intergenic
1102663042 12:114546273-114546295 CCTTACAAGAAGAGGAAATCTGG + Intergenic
1102665010 12:114564357-114564379 CCTTACAAGAAGAGGAAATCTGG - Intergenic
1102749322 12:115278448-115278470 CCTTATAAGAAGAGGCAACTAGG - Intergenic
1102912432 12:116727563-116727585 CCTCAGAAAAAGAGGGGAGGGGG + Intronic
1102919558 12:116781645-116781667 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1102934495 12:116885012-116885034 CCTCATAAGAAGAGGAAATTAGG + Intergenic
1102970526 12:117162491-117162513 GCTGCTAAGAAGATGGAAGGAGG + Intronic
1103027712 12:117587308-117587330 CCTTATAAGATGGAGGGAGGAGG + Intronic
1103849495 12:123922779-123922801 CCTTATAAGAGGAGGAAATTTGG - Intronic
1103951359 12:124553205-124553227 CTTTATAAGAAGGAGGCAGGAGG - Intronic
1103963759 12:124625227-124625249 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1104004588 12:124883040-124883062 CCTTATAAGAAGAGGGACATCGG + Intergenic
1104211927 12:126697272-126697294 CCTCATAAGAAGAGGAAATTTGG + Intergenic
1104252064 12:127104622-127104644 CCTTATAAAAAGGGGGAATTTGG - Intergenic
1104288286 12:127445389-127445411 ACTTATAAGAAGAGGAGAGTAGG - Intergenic
1104337786 12:127916556-127916578 CCTTATTAGAAGGAGGAAGGAGG + Intergenic
1104485490 12:129148416-129148438 CCTTAAAAGAAGGAGGCAGGAGG + Intronic
1105067876 12:133216190-133216212 CCTTATAAAAAGGGGGAATTTGG + Intergenic
1105673577 13:22645812-22645834 CCTTATACAAAGAGGAAATGAGG - Intergenic
1106031803 13:26011341-26011363 CCTAATAAGAAGAGGAGATGAGG - Intronic
1106047764 13:26160890-26160912 CCTTATAAGAAGAGGATCTGAGG - Intronic
1106219649 13:27735030-27735052 CCTTATAAGAAGAGGAAATGGGG + Intergenic
1106454556 13:29915854-29915876 CCTTATAAGAAGAGGACATTTGG + Intergenic
1106507261 13:30381978-30382000 CCTCATAAGAAGAGGCAATTAGG - Intergenic
1106531749 13:30599693-30599715 CTTTATAAGAAGAGGAAATTTGG - Intronic
1106588839 13:31080757-31080779 CCTTATAAGAATAGGCAATGTGG + Intergenic
1106625781 13:31419459-31419481 CCTTATAAGAAGAGAGAATTTGG + Intergenic
1106760466 13:32862586-32862608 CCTGATAAGAAAAGGGAGGCTGG + Intergenic
1106818501 13:33436953-33436975 CCATATACAAAGATGGAAGGCGG - Intergenic
1107651135 13:42546385-42546407 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1107879601 13:44821535-44821557 CCTTATAAGAAAGATGAAGGAGG + Intergenic
1107917727 13:45169276-45169298 CCTTATAAGAAAAGGAAATTTGG + Intronic
1108064343 13:46562475-46562497 CCTTATAAGAAGAGGAAATTTGG - Intronic
1108203362 13:48063447-48063469 CCTTATAAGAAGAGAAAATCTGG + Intronic
1108258444 13:48632849-48632871 CCTTAAAAGAAGAGGAAATTTGG + Intergenic
1108297487 13:49038418-49038440 CCTTATAAGAACAGGAAATTAGG + Intronic
1108299337 13:49058513-49058535 CCTTGTAAGAAGAGGAAATTTGG + Intronic
1108529605 13:51316652-51316674 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1109152522 13:58861341-58861363 CCTTAAAATGATAGGGAAGGGGG - Intergenic
1109376026 13:61494309-61494331 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1109894365 13:68664794-68664816 CCTTATAAGAAGAGGAGAATAGG - Intergenic
1110067984 13:71133128-71133150 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1110605528 13:77427569-77427591 CCTTATAAGAAGAGGAGAATAGG - Intergenic
1111820616 13:93209346-93209368 CCTTATAAGAAGGAAGTAGGAGG - Intergenic
1111922932 13:94431317-94431339 CCTTGTGAGAAGAGGAAAGTTGG + Intergenic
1112099009 13:96166723-96166745 CTTTCAAAGAAGAGGCAAGGGGG + Intronic
1112105328 13:96233721-96233743 CTTGATAGGAAGAGGGAATGTGG + Intronic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1112584795 13:100708773-100708795 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1112766661 13:102752945-102752967 CCTTGTAAGAAGAGGAAATTTGG + Intronic
1112829216 13:103428087-103428109 CCTGATAGGAAGAGGGAATTTGG + Intergenic
1112975678 13:105314604-105314626 CCTTACAAGAAGAGGAAATTTGG + Intergenic
1113285230 13:108839176-108839198 CTTTATAAGAAGAGGAAGAGAGG - Intronic
1113613505 13:111664698-111664720 CCTTATAAAAAGAGGGAGTTTGG + Intronic
1114187516 14:20413893-20413915 CCTTAAAAGGAGACGGAAAGCGG + Intergenic
1114404518 14:22443605-22443627 CCTTATAAGAGGAGGAAATTTGG - Intergenic
1114478817 14:23018087-23018109 CCTTATAAGAAGAGGGAATTTGG + Intronic
1114509780 14:23248738-23248760 CCTTATAAAAAGAGGCTTGGGGG - Intronic
1115049209 14:29035869-29035891 CCTTGTAAGAAGAGGAAATTCGG + Intergenic
1115268749 14:31527982-31528004 TCTTATAAGAAGAGGAAATCTGG - Intronic
1115306533 14:31939259-31939281 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1115936156 14:38555059-38555081 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1116037852 14:39649777-39649799 CCTAATGAGAAGAGGAAATGAGG + Intergenic
1116062354 14:39939765-39939787 TCTTATAAGAAGAGGAAATTTGG + Intergenic
1116421314 14:44736083-44736105 CCTTAAAAGAAGAGGAAATCAGG - Intergenic
1116427125 14:44804990-44805012 CCTTATAAAAAGAGGAAATGTGG + Intergenic
1116539529 14:46082169-46082191 CCTTATAAGAGGGAGGTAGGAGG + Intergenic
1116589804 14:46757570-46757592 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1116870530 14:50065624-50065646 CCTTATAGGAAGAGGAAAATGGG - Intergenic
1117332741 14:54729347-54729369 TCTTTTAAGAAAAGGGTAGGAGG + Intronic
1117626861 14:57649456-57649478 CTTTATAAGAAGCAGGCAGGAGG - Intronic
1117680296 14:58197025-58197047 CCTCAGAAGAAGAGGGAGGCCGG + Intronic
1117868244 14:60171479-60171501 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1117873545 14:60225612-60225634 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1118017293 14:61673047-61673069 CCTTCCAAAAAGATGGAAGGTGG + Intergenic
1118387492 14:65268383-65268405 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1118421156 14:65605478-65605500 CCTTATAAGAAGGGGTAATTTGG + Intronic
1118742775 14:68752478-68752500 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1118926289 14:70192696-70192718 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1118949490 14:70421257-70421279 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1119677673 14:76568001-76568023 CCTTATAAGAGAAAGGCAGGAGG + Intergenic
1119684799 14:76623058-76623080 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
1119925321 14:78488152-78488174 CCTTATAACAAGAGGAAATTTGG - Intronic
1119966062 14:78916948-78916970 CCTTATAAGAAGAGGAAACTTGG - Intronic
1120219822 14:81719547-81719569 CCTTATAAGAGGAAGGCGGGTGG - Intergenic
1120324404 14:83007034-83007056 CCTTATAAGAGGAGGAAGAGAGG - Intergenic
1120552799 14:85891865-85891887 CTTTATAAGAAGAGGAAGAGGGG - Intergenic
1120667044 14:87318662-87318684 CCCCATAAGAAGAGGAAATGTGG - Intergenic
1120715633 14:87838081-87838103 CCTTATAAGAAGAGAAAATTAGG + Intronic
1120839082 14:89067365-89067387 CCTTATAAGAAGAGGACATGAGG + Intergenic
1120920852 14:89754261-89754283 CCTTATAAGAAGGGGCGATGAGG + Intergenic
1121306277 14:92909671-92909693 CCTTGGAGGAAGAGGAAAGGAGG - Intergenic
1121454468 14:94029523-94029545 CCTTATAAAAAGAGGAAATTAGG - Intronic
1121561958 14:94882501-94882523 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1121615358 14:95310385-95310407 CCTTATAAGAAGGAAGCAGGAGG - Intronic
1121716145 14:96077466-96077488 CCTTATAAGAATAGGAAATTAGG + Intronic
1121800417 14:96769693-96769715 CCTTATAAAAAGAGGAAACGTGG - Intergenic
1121900601 14:97690263-97690285 CCTTATAAAAAGGGAGAATGTGG - Intergenic
1121902223 14:97704081-97704103 CCTTATAAGAGGAAAGCAGGAGG - Intergenic
1122161522 14:99787812-99787834 CCTTATAAGAAGGGGAAATTTGG - Intronic
1122186049 14:99996948-99996970 CCCTATAAAAAGAGGGCAGTAGG - Intronic
1122665257 14:103325401-103325423 CCTTATAAGAAGAGACACAGAGG + Intergenic
1122837806 14:104438607-104438629 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1122907731 14:104809862-104809884 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1123948920 15:25252154-25252176 CATGAGAAGAAGTGGGAAGGGGG - Intergenic
1123993621 15:25703055-25703077 CCTTATAAAAAGAGGCACTGGGG + Intronic
1124015937 15:25875787-25875809 CCTTACAAAAAGGGGGAACGTGG - Intergenic
1124028863 15:25991067-25991089 CCTTACAAGAAGAGGAAATTTGG - Intergenic
1124242365 15:28039732-28039754 CCTTATAAGAAGAGGAAGTTTGG + Intronic
1124263273 15:28211472-28211494 TCTTAGAAGAAGAGTGAAAGCGG - Intronic
1125033597 15:35097637-35097659 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1125059333 15:35400352-35400374 CAATATAGGAAGATGGAAGGAGG + Intronic
1125071850 15:35564283-35564305 CTTTATAAGAAGAGAAAATGTGG - Intergenic
1125283104 15:38064171-38064193 CCTTATAAGAAGAGGAAATCTGG + Intergenic
1125408995 15:39385010-39385032 CCTTATAAGAAGAAGGGACTAGG + Intergenic
1125427941 15:39568329-39568351 CCTTATAAGATGAGGGGATTTGG - Intergenic
1125517440 15:40330265-40330287 GCTTATAAGAAAAGGGAAAAAGG + Intergenic
1125563520 15:40657731-40657753 CCTTATAAAAAGGGGAAATGTGG - Intronic
1126113023 15:45186766-45186788 CCTGAGAGGACGAGGGAAGGAGG + Intronic
1126157628 15:45580262-45580284 CCTTATATAAAGGAGGAAGGAGG + Intergenic
1126176650 15:45742187-45742209 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127263457 15:57343097-57343119 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1127344738 15:58083149-58083171 CCTTATAAGAAGAAGAAATCTGG - Intronic
1127375015 15:58376368-58376390 CCTTACAAGAAGAGAAGAGGAGG + Intronic
1127646746 15:60966167-60966189 CCTTATAAGAAGAGGAAATGTGG - Intronic
1127845602 15:62867899-62867921 CCTTATAAAAAGGGGAAATGTGG + Intergenic
1127962586 15:63900756-63900778 CCTTCTAAGAAGAGGAAATATGG + Intergenic
1128458738 15:67850017-67850039 CCTTATTAGAAGAGGAAATCTGG + Intergenic
1128633532 15:69288284-69288306 CCTTTTAAGAAGGAGGCAGGAGG - Intergenic
1130159497 15:81384631-81384653 CCTTATAAGAGGGATGAAGGAGG + Intergenic
1130189721 15:81722171-81722193 CCTTATAAGGAGAGGAAATATGG + Intergenic
1130222294 15:82029902-82029924 CCTTATAAGAAGTGGAAATCTGG + Intergenic
1130303224 15:82696079-82696101 CTTTATAAGAAGAGGAAATTTGG - Intronic
1130698600 15:86156379-86156401 CCTTATAAGAAGGGAGAATTTGG - Intronic
1130832148 15:87611888-87611910 TCTTATAAGAAGAGGCATGTTGG - Intergenic
1130905524 15:88238033-88238055 CCTTATAAGAAGAGGAGATTAGG + Intronic
1131327261 15:91459883-91459905 CCTTATAAGAGGAGGGGATCAGG - Intergenic
1132179792 15:99743656-99743678 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1132224912 15:100133021-100133043 TCTTATAAGAAAAAGGAATGAGG + Intronic
1132331420 15:101014708-101014730 CCTTATAAGAAGAGGAGATTAGG - Intronic
1133361349 16:5176352-5176374 CCTTATAGGAAGAGGAGAGTAGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133519872 16:6546613-6546635 CCTTATAAGAAGGAGAAATGTGG - Intronic
1133849512 16:9488883-9488905 CCTTATGAGAAGAGGAAATCTGG + Intergenic
1133856106 16:9550719-9550741 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1133977180 16:10607551-10607573 CCTTATGAGAAGAGGAAATCTGG + Intergenic
1134077340 16:11301059-11301081 CCTTCTAAGAAGAGGTAATGGGG - Intronic
1134299951 16:12981805-12981827 CCTTATAAGAAGAGGAGATTAGG + Intronic
1134527583 16:14956308-14956330 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1134775853 16:16852823-16852845 CCTTATAAGAAGAGGATATTTGG + Intergenic
1134788850 16:16970071-16970093 TCTTATAAGAGGATGGCAGGAGG + Intergenic
1135060932 16:19270814-19270836 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1135258541 16:20961591-20961613 CCTTATGAGAAGAGGAGATGAGG + Intronic
1135289821 16:21225702-21225724 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1135353094 16:21746485-21746507 CCTTTTAAGAAGGAGCAAGGAGG + Intronic
1135451581 16:22562608-22562630 CCTTTTAAGAAGGAGCAAGGAGG + Intergenic
1135519052 16:23159468-23159490 CCTTATAAGAAGAGAGATTGGGG - Intergenic
1137513611 16:49123303-49123325 CCTTATAAGAAGAGGAGACTTGG - Intergenic
1137539205 16:49350381-49350403 CCTTATGAGAAGAGGAAAAGGGG + Intergenic
1137539780 16:49354333-49354355 CCTTATAAAAAGAGACAAAGAGG + Intergenic
1137573777 16:49584726-49584748 CCTCATAAGAAGAGGAAAATTGG - Intronic
1138145958 16:54612067-54612089 CCTTAGAAGAAGAGGAAATTAGG + Intergenic
1138268383 16:55677154-55677176 CCTCCTCAGAAGAGTGAAGGAGG - Intronic
1138785994 16:59847352-59847374 CCTTATGAGAAGAGGAAATTTGG - Intergenic
1138918535 16:61498247-61498269 ACTCATAAGAAAAGGGAGGGAGG + Intergenic
1138951080 16:61914041-61914063 CTTTATAAGAAGAGGTAATTTGG + Intronic
1139280294 16:65764774-65764796 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1139350213 16:66330238-66330260 CCTTAAAAGAAGAGGAAGGCCGG - Intergenic
1139509656 16:67419876-67419898 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
1140350589 16:74258404-74258426 TCTTACAAGAAGAGGGAATTTGG + Intergenic
1140422992 16:74836052-74836074 CCTTCTAAGAAGGAGGCAGGAGG - Intergenic
1140774841 16:78240176-78240198 CCTCATGAGAAGAGGAAAGCAGG + Intronic
1140826683 16:78713575-78713597 CCTTATAAAAAGAGGAAATTTGG + Intronic
1140837822 16:78811670-78811692 CCTTATAAGAAGAGGACAAGGGG - Intronic
1140904418 16:79398213-79398235 CCTTATAAGAAAGTGGCAGGAGG - Intergenic
1141170944 16:81691303-81691325 CCTTAGAAGAAGAGGAAACACGG - Intronic
1141276580 16:82593848-82593870 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1141480106 16:84300667-84300689 CCTTATAAGAAAAGGAGAAGGGG + Intronic
1141643053 16:85352629-85352651 CCTTAGAAGGATAAGGAAGGGGG + Intergenic
1141650725 16:85391599-85391621 CCTTATAAAAAGAGGGGAATTGG - Intergenic
1141778243 16:86138728-86138750 CCTTATAAGAAGAGGACAAGAGG - Intergenic
1141821196 16:86447216-86447238 CCTTATAAAAAGAGGAAAATTGG - Intergenic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1141999658 16:87656949-87656971 CCTTATAAGAAGAGGAGGAGAGG - Intronic
1203142432 16_KI270728v1_random:1777086-1777108 CCTTGTAAGAAGAGGAGATGAGG + Intergenic
1143297512 17:5882592-5882614 CCTTATAAGACGGGGGCAGAGGG - Intronic
1143310594 17:5985381-5985403 CCTTATAAGAAGAGGAAATTTGG + Intronic
1143771955 17:9174625-9174647 CCTTATTAGAAGAGGGCATCGGG - Intronic
1143896911 17:10143628-10143650 CCTTATAAGAAGAGGAAATTAGG + Intronic
1144169038 17:12640920-12640942 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1144588785 17:16506076-16506098 CCTTAGAAGATGGGGGCAGGAGG - Intergenic
1144749604 17:17639326-17639348 CTTTATAAGAATGGGGAAGCAGG + Intergenic
1145054924 17:19696149-19696171 CCTTATTAAAAGAGGGAATTTGG + Intronic
1145105036 17:20108024-20108046 CCTTTTAACAAGAGGGATGACGG - Intronic
1145218428 17:21069416-21069438 CCTCATAAGAGGGGGGCAGGAGG + Intergenic
1146132925 17:30293975-30293997 CGGAATAAGAAGATGGAAGGTGG + Intergenic
1146158701 17:30547167-30547189 CCTTATAAGGAGAGGAGATGAGG + Intergenic
1146299551 17:31677584-31677606 CCTTATAAGAAGGAGCCAGGAGG - Intergenic
1146315042 17:31800215-31800237 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1147001005 17:37362052-37362074 CCTTATAAGACGAGGCGACGAGG + Intronic
1147020498 17:37528321-37528343 CCTTATAAGGGGAAGGTAGGAGG - Intronic
1147035694 17:37678650-37678672 CCTTATAAGAGGGAGGAAGAGGG + Intergenic
1147462500 17:40582386-40582408 ACTTACATGAAAAGGGAAGGAGG + Intergenic
1147888802 17:43702719-43702741 TCTTAGCAGAAGGGGGAAGGGGG - Intergenic
1148994946 17:51701285-51701307 CCTTATGAGAAGAGGGAAATTGG - Intronic
1149289257 17:55200013-55200035 CTTTACAACAGGAGGGAAGGTGG - Intergenic
1149293646 17:55240993-55241015 CCTCATAAAAAGAGGAATGGTGG - Intergenic
1149388117 17:56162485-56162507 CCTTATAACAAGAGGAAATGTGG - Intronic
1150920948 17:69481710-69481732 CCTTATATGAAGAGGAAATTTGG - Intronic
1151080456 17:71323442-71323464 CGTTATAAGAAGAGGACAGTGGG + Intergenic
1151352438 17:73539782-73539804 CCTGAGAAGAAGAGAGAACGTGG + Intronic
1151385302 17:73751685-73751707 CCTTATAAGAAGAGGATATGTGG - Intergenic
1151408990 17:73908482-73908504 CCTTTTAGGAAGAGGGGATGAGG - Intergenic
1151851622 17:76694069-76694091 CCAGATAAGTAGATGGAAGGGGG - Intronic
1151884368 17:76914936-76914958 CCTTATAAAAAGAAGAAACGTGG - Intronic
1151903169 17:77030923-77030945 CCTCATAAGAAGAGGAAATTAGG + Intergenic
1153018350 18:604869-604891 CCTTATACGAACAGGGAACTCGG - Intronic
1153237150 18:2999293-2999315 CCTTATAAAAAGAGGAAATCTGG + Intronic
1153304577 18:3620169-3620191 CCTTATAAGAGGGAGGCAGGAGG + Intronic
1153619556 18:6964389-6964411 CCTTATAAAAAGGGGAAATGTGG + Intronic
1153663717 18:7349589-7349611 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1153780518 18:8491430-8491452 CCTTATGAGAGGAAGGCAGGAGG + Intergenic
1154055540 18:11009805-11009827 CCTTGTAAGAAGAGGAGAGTAGG + Intronic
1154129608 18:11725276-11725298 CCTTATAAGAAGAGGAGATTAGG + Intronic
1154345382 18:13539541-13539563 CCTTGAAAGAGGAGGAAAGGGGG - Intronic
1155318410 18:24594831-24594853 TCCTATAAGAAGAGGGAATTTGG + Intergenic
1155326529 18:24670500-24670522 CCTTATAAGAAGAGGAAACTTGG + Intergenic
1155337937 18:24784489-24784511 CCTTATAAGAAGAGGTGATAAGG - Intergenic
1155842425 18:30662367-30662389 CCTTATAAAATGAGTTAAGGAGG - Intergenic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1156191721 18:34727936-34727958 CCTAATATTAAGAGGGAGGGGGG + Intronic
1156617928 18:38810080-38810102 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1157245097 18:46046636-46046658 GCTTATAAGAAGAAGAAAGCAGG + Intronic
1157872840 18:51246383-51246405 CTTTATAAGAAGAGGAAGGCCGG + Intergenic
1157883055 18:51340592-51340614 CCTTAGAAGAAGAGGAAATGTGG - Intergenic
1157927957 18:51787033-51787055 CCTTATTAGAAAAGGGATTGAGG + Intergenic
1158274669 18:55754455-55754477 CCTTACAAGAAGAGGAAATTTGG + Intergenic
1158465284 18:57684822-57684844 CCTTATTAGAAGGGGAAATGTGG + Intronic
1158492012 18:57918601-57918623 CCTTACAAGAGGAGGGCAGAGGG - Intergenic
1158518265 18:58148625-58148647 CCTTCTAAGAAGAGGAAATTTGG - Intronic
1158623795 18:59054786-59054808 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1158696521 18:59708845-59708867 CCCTATAAGAAGAAGGAAGGTGG - Intergenic
1158747486 18:60218193-60218215 CCTTTTAAGAAGAGGAAATCTGG + Intergenic
1158839401 18:61367936-61367958 CCTTATAAGAAGAGGACATTTGG - Intronic
1159150538 18:64517641-64517663 CCTCATAAGAAGAGGGGATTGGG - Intergenic
1159151510 18:64529259-64529281 CCTTATAAGAAAAGGTGATGAGG - Intergenic
1159180083 18:64891973-64891995 CCTTACAAGAGGAAGGCAGGGGG + Intergenic
1159223067 18:65490909-65490931 CCTTATAAGAAGAGACACTGAGG - Intergenic
1159234717 18:65656756-65656778 CCTAATAATGGGAGGGAAGGTGG + Intergenic
1159877647 18:73829911-73829933 TCTTATAAGAAGATTCAAGGAGG - Intergenic
1160417300 18:78720322-78720344 CCTTATAGAAAGAGGTAAGTTGG - Intergenic
1161503313 19:4629737-4629759 GCTTATAAGAAGGAAGAAGGAGG - Intergenic
1161863739 19:6818701-6818723 CCTTATAAGAAGAGTAAACTAGG + Intronic
1161953713 19:7481571-7481593 CCTTATAGGAGGGAGGAAGGAGG + Intronic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
1164890729 19:31821095-31821117 CCTTCTAAGAAGAGGAAAGCTGG - Intergenic
1165590990 19:36969709-36969731 CCTTAAAAGAGGAAGGCAGGAGG - Intronic
1165810167 19:38607258-38607280 TTGTATAAGAAGATGGAAGGAGG + Intronic
1166441000 19:42815338-42815360 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166459447 19:42973304-42973326 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166460474 19:42983944-42983966 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166476769 19:43133349-43133371 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166477773 19:43143918-43143940 CCTTCTAAGAAGAGGAGATGAGG + Intronic
1166581516 19:43904024-43904046 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1166588485 19:43972884-43972906 CCTCATAAAAAGAGTTAAGGAGG - Intronic
1166656760 19:44618054-44618076 CCTTGGAAGAGCAGGGAAGGAGG - Intronic
1166657009 19:44619744-44619766 CCTTATAAGAAGAGGAAGTTTGG - Intronic
1166807788 19:45497245-45497267 CTTTAGGGGAAGAGGGAAGGAGG + Intronic
1166919050 19:46216031-46216053 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1166972168 19:46576314-46576336 CCTTATAGGAAGAGGAAGAGAGG - Intronic
1167188751 19:47967609-47967631 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1167230788 19:48281823-48281845 CCTTATAAGAAGAGGAAATCTGG - Intronic
1167677621 19:50897252-50897274 CCTAATATGAAGAGGAAAAGAGG + Intergenic
1167794338 19:51699660-51699682 CCTTATGAGAAGAGGAAATTAGG - Intergenic
1168050444 19:53825760-53825782 CTTTATAAGAAGAAGACAGGAGG + Intergenic
1168082240 19:54018718-54018740 CCTGATAAGAAGCTAGAAGGAGG + Intergenic
1168325041 19:55534248-55534270 CCTTATAAGAAGAGGAGATCAGG + Intronic
1168514750 19:57002023-57002045 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1168526077 19:57089828-57089850 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1168588925 19:57616734-57616756 CCTCACAAGAGGAGGGAAGCTGG - Intronic
1168609757 19:57789799-57789821 CCTTATCAGTAGAAGAAAGGGGG + Intronic
925055053 2:850919-850941 CCTTATAAGAAGAGGAGATGAGG - Intergenic
925062067 2:899794-899816 CCTTATAAGAAGAGGAAATGAGG - Intergenic
925550590 2:5069837-5069859 CTTTATAAGAAGAGGGGATGAGG - Intergenic
925588486 2:5487043-5487065 CTTTTTAAGCAGAGGGAAAGAGG - Intergenic
925916297 2:8609019-8609041 CCTTATAAAAAGAGGGAGAGAGG - Intergenic
926149046 2:10414498-10414520 CCTTATAAGAAGAGGAGATGAGG - Intronic
926689602 2:15724381-15724403 CCTTATAAGAAGAGGAAATTTGG - Intronic
926694082 2:15758513-15758535 TCTTATAAGAAAAGGAAATGTGG + Intergenic
926708103 2:15850908-15850930 CCTTATAAAAAGGGGGAATTTGG + Intergenic
926809410 2:16743115-16743137 CCTTATAAGAAAAGAGAATTAGG + Intergenic
926814236 2:16784476-16784498 CCTTATAAGAAGAAGAAACGTGG + Intergenic
926839442 2:17062816-17062838 CCTTGTAAGAAGGAGGCAGGAGG - Intergenic
926966780 2:18423614-18423636 TCTTATAAGAAGAGGAAATGAGG - Intergenic
927382499 2:22495296-22495318 CCTTTTAAGAAGAGGAAATTTGG + Intergenic
927427886 2:23001582-23001604 CCTTATAACAAAAGGAAATGTGG + Intergenic
927435858 2:23065548-23065570 CCTTATAAGAAGAGGAGATGAGG + Intergenic
927460916 2:23297606-23297628 CCTTATAAGCAGAGGGGATTAGG - Intergenic
928066102 2:28166021-28166043 CCTTATAATAAGAGGAAATTAGG + Intronic
928613280 2:33011479-33011501 TCTTATAAGAAGAGGCAATTTGG + Intronic
928766569 2:34653595-34653617 CCTCATAAAATGAGTGAAGGAGG - Intergenic
928784189 2:34862236-34862258 TCTTATAAGAAGAGGAAATTTGG - Intergenic
928892067 2:36215892-36215914 CCTTATGAGAAGAGGAAATCGGG + Intergenic
929007408 2:37409604-37409626 CCTTATAAGAAGACGAAATTTGG - Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929470078 2:42182918-42182940 CCTTATAAGAAGAGGAAATCTGG - Intronic
929974699 2:46621212-46621234 CCTTGTAAGAACATGGTAGGGGG - Intronic
930149474 2:48044034-48044056 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
930285620 2:49424087-49424109 CCTTATAAAAAGGGGGAATTTGG + Intergenic
930345823 2:50179867-50179889 CAGTATAGGAAAAGGGAAGGAGG - Intronic
930374835 2:50551807-50551829 CCTGAGAAAGAGAGGGAAGGAGG - Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
931120331 2:59210627-59210649 CCTTATAAAAAGAGGAAATTTGG - Intergenic
931654907 2:64502131-64502153 CCTAATAAGGAGTGGGATGGTGG + Intergenic
932225954 2:70040934-70040956 GCTTATAGGAAGTGGGAAGAGGG - Intergenic
932689579 2:73900917-73900939 CTTTATAAGAAGAGGGAATTAGG - Intronic
932808256 2:74801339-74801361 CCTTATAAGAAGAGGAAATTTGG + Intergenic
932861439 2:75297007-75297029 CCTCATAAGAGGGAGGAAGGAGG - Intergenic
933492767 2:83008712-83008734 CTTTATAAGAAGAGAGAGAGAGG + Intergenic
934032870 2:88064259-88064281 CCTTATAGGAGGAAGGCAGGAGG - Intergenic
934034329 2:88076518-88076540 CCTTAAAAGATAAAGGAAGGCGG - Intronic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
934575128 2:95395389-95395411 CCTTATAAGGAGAGGAAATTAGG + Intergenic
935055273 2:99560436-99560458 CCTTAGAAAAAGCGGGGAGGAGG + Exonic
935215798 2:100974467-100974489 CTTTCCAAGAAGGGGGAAGGAGG - Intronic
935227322 2:101064222-101064244 CCTTATAAGAAGAGACACCGGGG + Intronic
935237991 2:101153765-101153787 CCTTATAAAAAGAGGAAATTTGG + Intronic
935241173 2:101179400-101179422 CCTTATAAGAAAAGAGACAGAGG - Intronic
935500743 2:103835616-103835638 GCATATAAGAAGAGGAAAAGAGG + Intergenic
935575895 2:104710155-104710177 CCTTAAGAGAAGAGGGTGGGTGG - Intergenic
935609502 2:105006314-105006336 CCTTATAAGAAGAGGAGATTAGG - Intergenic
935633005 2:105227398-105227420 CCTTACAAGAAAAGGAAAGGAGG + Intergenic
935796382 2:106645252-106645274 CCTTATAAGAGGAGGAAATTTGG - Intergenic
936140531 2:109936184-109936206 CCTTATTAGAAGAGGAAACTTGG + Intergenic
936177222 2:110234129-110234151 CCTTATTAGAAGAGGAAACTTGG + Intergenic
936204163 2:110435302-110435324 CCTTATTAGAAGAGGAAACTTGG - Exonic
936232135 2:110712284-110712306 CCTAGTGAGAAGGGGGAAGGTGG - Intergenic
936549190 2:113420657-113420679 CCTTTTAAGAAGAGGAGACGAGG - Intergenic
936822010 2:116533355-116533377 CTTTATAAGAAGAGGAAATTTGG - Intergenic
937014058 2:118587462-118587484 CCTCATAAGAAGAGGAAATCTGG + Intergenic
937080901 2:119139008-119139030 CCTTATAAGAAGGAGGCAGCGGG - Intergenic
937086664 2:119176360-119176382 CCTTATAAGAAGAGGTGATTAGG - Intergenic
937246350 2:120496572-120496594 CCTAAGGATAAGAGGGAAGGGGG + Intergenic
937256490 2:120559799-120559821 CCTTATAAGAAGAGGACATTTGG - Intergenic
937342018 2:121097132-121097154 CCTTATAAGAGGGAGGCAGGAGG + Intergenic
937499871 2:122466667-122466689 CATGAAAAGAAGAGTGAAGGAGG + Intergenic
938078260 2:128353614-128353636 CTTTACAAGAAGAGGAAGGGAGG + Intergenic
938614296 2:132981394-132981416 CCTGAGAACATGAGGGAAGGAGG + Intronic
938978637 2:136504544-136504566 CCTTATAAGAAGAGAAAATCTGG - Intergenic
939354647 2:141085449-141085471 CCTTGTGAGAAGAGGAAATGAGG + Intronic
939801676 2:146719157-146719179 CCTTATAAGAAAAGGAAATTTGG - Intergenic
939843408 2:147215695-147215717 CCTTATAAAAAGAGGGAATTTGG + Intergenic
939857600 2:147378646-147378668 CCTGATAAGAAGAGGAAATTAGG + Intergenic
940073661 2:149717446-149717468 CCTTATAAGAAGATGAAATTAGG - Intergenic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
940964846 2:159825590-159825612 CCTCATAAAATGAGTGAAGGAGG - Intronic
940991260 2:160098943-160098965 CCTTATAAGAAGAGGAGATTAGG - Intergenic
941007321 2:160261423-160261445 CCTTATAAGAAGAGGAAATTTGG - Intronic
941238468 2:163006587-163006609 CCTTATAAGAAGAGGAAATATGG - Intergenic
941242412 2:163055660-163055682 CTTTATAAAAAGAGGGACGTTGG - Intergenic
941254504 2:163211669-163211691 CCATATAAGAAGAGGAAATCTGG - Intergenic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941798694 2:169630417-169630439 CTTGATAATAAGAGGGAAAGTGG + Intronic
941805556 2:169708560-169708582 CCTTATAAGAAAGGGGCAGAGGG - Intronic
941947617 2:171117100-171117122 CCATGAAAAAAGAGGGAAGGTGG + Intronic
941956390 2:171209711-171209733 CCTTATAAGAAGAGGAAATTTGG + Intronic
941984814 2:171499968-171499990 CCTTATAAGAAGAGGAGATTGGG - Intergenic
942068030 2:172290250-172290272 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942270063 2:174265595-174265617 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942270439 2:174268872-174268894 CCTTATAAGAAGAGGAGATTAGG + Intergenic
942389415 2:175476667-175476689 CCTTATAAGAAGAGGCGATTAGG - Intergenic
942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG + Intronic
942934708 2:181541185-181541207 CCTTATAAGAAGAGGAAATTTGG + Intronic
944311946 2:198243429-198243451 CCTTATAAGAAGAGGAAATTAGG - Intronic
944312061 2:198244440-198244462 CCTTATAAGAGGGTGGTAGGAGG + Intronic
944461922 2:199958248-199958270 CCTTATAAGAGGAGCAAATGTGG - Intronic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
944922349 2:204428710-204428732 CCTTATAAGAGGAAGGCAAGAGG + Intergenic
944922932 2:204434359-204434381 CCTTATAAGACAAAGGCAGGTGG + Intergenic
944931908 2:204528512-204528534 CCTTATAAGAGGGAGGCAGGGGG + Intergenic
945175334 2:207038038-207038060 CCTTATAAAAAGAGGAAATTTGG + Intergenic
945498774 2:210542512-210542534 CCTTTTAACAGGAGGGTAGGAGG - Intronic
945678629 2:212886087-212886109 CCTTATAAAAAGAGTTAGGGAGG - Intergenic
946007676 2:216539424-216539446 CCTTGAAAGAAGAGGGAATTTGG - Intronic
946013486 2:216585190-216585212 CTTTATAAGAAGAAGAAATGAGG + Intergenic
946136080 2:217648288-217648310 CCTTATAAGAAGAGGAAATTTGG - Intronic
946176616 2:217926066-217926088 CCTTGTAAGTAGAGGAAACGAGG + Intronic
946287198 2:218712713-218712735 CCTTACAAAAAAAGGGTAGGAGG + Intronic
946467593 2:219925788-219925810 CCTTGTAAGAAGAAGAAAGTTGG + Intergenic
946585334 2:221180074-221180096 CCTTATGAGAAGAGGGAATCTGG + Intergenic
946887458 2:224237096-224237118 CCTTATGAGAAGAGGAAGAGAGG - Intergenic
946979880 2:225198963-225198985 TCTTATAATAAGAGGAATGGAGG + Intergenic
947521093 2:230846654-230846676 CCTTATAAGAAGAGGAGATTCGG - Intergenic
947597469 2:231422287-231422309 CTTTATAAGAAGAGGAAATTTGG - Intergenic
947813246 2:233018433-233018455 CCTTATAAGAAGAGAAAATTAGG - Intergenic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
947955307 2:234184724-234184746 CCTTACAAGAAGAAGGAAATTGG + Intergenic
948075229 2:235160688-235160710 CCTTATAGGAGGAGGGAGGCAGG - Intergenic
948115183 2:235490207-235490229 CCTTATACGAGGAAGGCAGGAGG - Intergenic
948254551 2:236556462-236556484 CCTTATATGACGGGGGCAGGGGG + Intergenic
948260062 2:236597470-236597492 CCTGATAAGATGAGGGTTGGTGG - Intergenic
948355704 2:237375236-237375258 CCTTATAAGAGGGGGTAAGAGGG + Intronic
948524832 2:238565046-238565068 CCTTATAGGAAGAGGAAATTGGG + Intergenic
948703436 2:239775045-239775067 ACATAGAAGCAGAGGGAAGGGGG + Intronic
948790248 2:240373071-240373093 CCTTGTAAGAAGAGGCCAGAGGG - Intergenic
949061104 2:241957905-241957927 CCTTATAAGAGAAAGGAAGAGGG - Intergenic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1169361868 20:4957105-4957127 GCCAGTAAGAAGAGGGAAGGAGG - Intronic
1169696272 20:8390313-8390335 CCTTATTAGAAGAGGAAATTAGG - Intronic
1169815906 20:9655898-9655920 CCTTATAAGAAAAGGAAACTTGG - Intronic
1170073376 20:12392724-12392746 CATTATAAGAAGAGGAAATGTGG + Intergenic
1170095963 20:12646375-12646397 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1170167031 20:13370744-13370766 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1170354533 20:15477833-15477855 CCTTATATGAGGAAGGCAGGAGG + Intronic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1170498292 20:16948281-16948303 CCTTATAAGGAGAGGAAATTAGG + Intergenic
1170534092 20:17323252-17323274 CCTTATAAGAAGAGGAGATTAGG + Intronic
1170753174 20:19170805-19170827 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1170804586 20:19618433-19618455 CCTTATAAGAACAGGAAATTAGG - Intronic
1170916485 20:20631466-20631488 CCTTATAAGAGGGTGGCAGGAGG + Intronic
1171125101 20:22595824-22595846 CCTTCTAAAAAGATGGATGGAGG - Intergenic
1171250857 20:23645967-23645989 CTTTATAGAAAGAGTGAAGGAGG - Intergenic
1171462372 20:25305659-25305681 CTTTAAAAAAAGAGGGAAGTAGG - Intronic
1172156664 20:32830643-32830665 CAATATAACAAAAGGGAAGGTGG - Intronic
1172310830 20:33917211-33917233 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1172341446 20:34161180-34161202 CTTTATAAGAAGAGGAAATTTGG - Intergenic
1172475899 20:35237413-35237435 CCTTATAAGAGGAAGGCAGGGGG - Intronic
1172784221 20:37455726-37455748 CCTTAAAAGAAGAGGAAGAGAGG + Intergenic
1172893926 20:38286397-38286419 CCTTATAAAAAGGGGAAATGTGG - Intronic
1172909835 20:38399798-38399820 CCTTATAAGAACAGGAAATCTGG + Intergenic
1172954065 20:38742955-38742977 TCTTAGAAGAAGAGGAAAAGTGG + Intergenic
1173019467 20:39255109-39255131 TCTTATAAGAAGAGGAAAATAGG - Intergenic
1173042286 20:39475662-39475684 CCTTATAAGAAGAGGAAAAGTGG - Intergenic
1173254519 20:41384696-41384718 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1173277504 20:41597504-41597526 CCTTATCAGAAGTTGGAAAGAGG + Intronic
1173404339 20:42752037-42752059 GAGTATAAGAAGAGGGAGGGAGG - Intronic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1173983471 20:47242462-47242484 CCTTCTAAGAGGAGGGCAGGGGG + Intronic
1174001374 20:47377320-47377342 GCTAATAGGAAGAGGTAAGGAGG + Intergenic
1174062633 20:47843476-47843498 CTTTATAAGAGGAGGGCAGGAGG + Intergenic
1174073662 20:47916677-47916699 CCTTGTAAGAAGGAGGCAGGAGG + Intergenic
1174075652 20:47934146-47934168 CCTTATAAGAGGACGGAAGGAGG - Intergenic
1174284443 20:49462505-49462527 AGAAATAAGAAGAGGGAAGGTGG + Intronic
1174703590 20:52634166-52634188 CCTTATAAGAAGAGAGACCCAGG + Intergenic
1174883943 20:54310860-54310882 CCTTATAAGAAGAGGAGATAAGG - Intergenic
1174921969 20:54713028-54713050 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175172490 20:57090345-57090367 CCTTATAAGACGGAGGTAGGAGG + Intergenic
1175287732 20:57848977-57848999 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175666074 20:60861136-60861158 GCTTATAAAAAGAGGGAATCGGG + Intergenic
1175687502 20:61042207-61042229 CCTTATAAGAAGAGAAAATTAGG + Intergenic
1175735348 20:61382359-61382381 CCTTATGCCAAGAGGAAAGGTGG + Intronic
1175765939 20:61592993-61593015 CCTTATAGGAGGGGGGCAGGAGG + Intronic
1176060347 20:63169775-63169797 CCTGAGCAGAACAGGGAAGGTGG - Intergenic
1176343287 21:5717691-5717713 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176429423 21:6566918-6566940 CCTTGTAAGAAGAGGAGATGAGG + Intergenic
1176501540 21:7606765-7606787 CCTTATTAGAAGAGGCAGGAAGG + Intergenic
1176537608 21:8115760-8115782 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176900266 21:14432808-14432830 CCTTGTAATAAGAGGGAATTTGG + Intergenic
1177207386 21:18025850-18025872 CCTTATAAGAACAGGAAATTTGG - Intronic
1177210638 21:18066803-18066825 CCTTATAAGAAGACGAAATTTGG + Intronic
1177298078 21:19202783-19202805 TCTTATAAAAAGAGGGAATTGGG + Intergenic
1177312711 21:19418205-19418227 CCTTATAAGAAAAGGAAAGTAGG + Intergenic
1177532640 21:22381383-22381405 CTTTATAAGACATGGGAAGGAGG + Intergenic
1177696004 21:24571932-24571954 CCTTATAAGAAGAGAAAAATAGG + Intergenic
1177853528 21:26376875-26376897 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1178316286 21:31569355-31569377 CCTTATAAGAAGAGGAAGTTTGG - Intergenic
1178355154 21:31905150-31905172 CTTTATAAGAAGAGGAAATTTGG + Intronic
1178368782 21:32009886-32009908 CCTTATAAGAAGGGGAAATTGGG + Intronic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1178599859 21:33986027-33986049 CCTTATAAAAAGGGGAAATGTGG - Intergenic
1178637340 21:34315805-34315827 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1178642357 21:34355349-34355371 CCTTATAAGAAGCAGGCAGGGGG + Intergenic
1178752872 21:35321013-35321035 CCTGATCGGATGAGGGAAGGAGG - Intronic
1178763122 21:35423029-35423051 CCTTATAAAAAGAGGAAATTTGG + Intronic
1178816406 21:35933966-35933988 ACTTAGAAGGAGAAGGAAGGAGG + Intronic
1178846101 21:36175410-36175432 CCTTGTAAGAAGAGGAAATCTGG - Intronic
1178849393 21:36200541-36200563 CTTTATAAGACGCGGGGAGGGGG + Intronic
1178898343 21:36579136-36579158 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1179019881 21:37629538-37629560 CCTTATAAGAAGAGGAAATTAGG + Intronic
1179112718 21:38461289-38461311 CCTTATAAAAAGAGGTAATTTGG - Intronic
1179119297 21:38528172-38528194 CCTTATGAGAAGAGGAAATTTGG - Intronic
1179153980 21:38833596-38833618 CCTTATAAAAAGGGGGAATTTGG - Intergenic
1179186597 21:39089706-39089728 CCTTATAAGAAGAGGGGATTAGG + Intergenic
1179279021 21:39917924-39917946 CCTTATAAGAAGAAGAGATGAGG + Intronic
1179363132 21:40731635-40731657 CCTTATAAGAAGAGGAAATTAGG - Intronic
1179364096 21:40739546-40739568 CCTTATAAGAAGAGGAGATTAGG - Intronic
1179398020 21:41059158-41059180 CCTTATAGGAAGAAAGTAGGAGG - Intergenic
1179430837 21:41319966-41319988 CCTTATAAGAAGAGGAGATGAGG + Intronic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179570905 21:42278507-42278529 CCCTGTAAGAAGAGGAGAGGAGG + Intronic
1179593669 21:42428044-42428066 CCTTATAAGAAGAGGGGATGAGG + Intronic
1179704817 21:43174380-43174402 CCTTGTAAGAAGAGGAGATGAGG + Intergenic
1179708939 21:43200735-43200757 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1179718871 21:43304289-43304311 CCTTATAAAGAGAGGACAGGTGG + Intergenic
1179942991 21:44651613-44651635 CCTTATCAGAAGGAGGGAGGAGG - Intronic
1180011623 21:45055077-45055099 CATTACATGAAGTGGGAAGGTGG - Intergenic
1180911247 22:19452275-19452297 CCTTTTAAGAAGAGGAAATTTGG - Intronic
1181078536 22:20397936-20397958 CCTCATAAGAAGAGGAAATTTGG - Intronic
1181284518 22:21742174-21742196 CCTTATAAAAAGAGATTAGGTGG + Intergenic
1181384447 22:22533609-22533631 CCTTATAAGAGGAGGAAACATGG + Intergenic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1182096442 22:27629214-27629236 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1182106316 22:27692304-27692326 CCTTGTAAGAGGAAGGCAGGAGG + Intergenic
1182240900 22:28915311-28915333 CCTTATAAGAAGAGAAAATTTGG - Intronic
1182768235 22:32774319-32774341 CCTCATAAGAAGAGGAAATTTGG + Intronic
1182820771 22:33214302-33214324 CCTTATAAGAAGAAGAGACGAGG - Intronic
1182892868 22:33833412-33833434 CCTTATAAGAAGAGGAGATAAGG + Intronic
1182910300 22:33978656-33978678 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1182922483 22:34092859-34092881 CCTTATAAGAAGAAGAGATGAGG + Intergenic
1183128678 22:35811386-35811408 CCTTATAAGAAAAGGGAATGTGG + Intronic
1183719778 22:39555977-39555999 CGAGATAAGAAGAGAGAAGGTGG - Intergenic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
1184275913 22:43409794-43409816 CCCTAAAAGATGAGGGAATGAGG - Intergenic
1184364359 22:44040485-44040507 CCTTATGAGAAGGAGGCAGGAGG + Intronic
1184417677 22:44361702-44361724 CCTTATAAGAAGAGGAGACTGGG + Intergenic
1184449405 22:44574207-44574229 GTTTCTAAGGAGAGGGAAGGAGG - Intergenic
1184464953 22:44663527-44663549 CCTTATAAGAGGTGGGCAGGAGG - Intergenic
1184622630 22:45693753-45693775 CCTTATAGGAAGAGGAAATTAGG + Intronic
1184639195 22:45860113-45860135 CCTTGTAAGAAAAGGGGATGTGG - Intergenic
1185208828 22:49555329-49555351 CCTTATAAAAAGAAGGAAACTGG + Intronic
1203242554 22_KI270733v1_random:32115-32137 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
949306415 3:2646818-2646840 CCTTATAAGAAGAGGAAATTTGG - Intronic
949840483 3:8314658-8314680 CCTTACAAGAAGAGGGAATTTGG + Intergenic
950227852 3:11250510-11250532 CCTTATCAGAAGTTGGAAAGAGG - Intronic
950445290 3:13033975-13033997 CCTTATAAGAAAAGGAAATTGGG - Intronic
950453673 3:13079878-13079900 CTATGTAAGATGAGGGAAGGAGG + Intergenic
950572202 3:13808372-13808394 CCTCATAAAAAGAGGAAATGTGG + Intergenic
950749373 3:15116808-15116830 CCTTATAGGAAGAGGGAATTAGG - Intergenic
950799027 3:15534462-15534484 CCTTATAAGAGGAGGCAATTTGG - Intergenic
951145222 3:19218866-19218888 CCTTATAAAAAGAGGAAATTTGG - Intronic
951194135 3:19804701-19804723 CCTCCTAGGAAGGGGGAAGGGGG + Intergenic
951409744 3:22348345-22348367 CCTTATAAGAAGGGGAAAGTAGG + Intronic
951522806 3:23625347-23625369 CTTTATAAGAAGAGGAGAAGAGG - Intergenic
951531027 3:23698227-23698249 CCTTATAAGAAGAGGAAATTTGG + Intergenic
951657547 3:25026517-25026539 CCTTATAAGAATAGGAAATTTGG - Intergenic
952385029 3:32834581-32834603 TCTTATAAAAGGAGGGATGGTGG + Intronic
952699426 3:36310348-36310370 AATTATAAAAAGTGGGAAGGGGG - Intergenic
952710861 3:36430834-36430856 CCTTGTAAGAAGAGGAAATTTGG - Intronic
952780447 3:37092177-37092199 CCTTATAAGAAAAGTGAAACAGG + Intronic
952928139 3:38336857-38336879 CCTTATAAGAAGAGGAAAATTGG - Intergenic
953034902 3:39203022-39203044 CATGAGAAGATGAGGGAAGGAGG + Intergenic
953236697 3:41113306-41113328 CCTTATAAGAAGAGGAGATTAGG + Intergenic
953691522 3:45124012-45124034 CCTAATAAGGAGAGGTCAGGAGG - Intronic
955081893 3:55665488-55665510 CCTTATAAGAAGGGGAAATTTGG + Intronic
955167802 3:56531635-56531657 CCTTATAAGAAGAGGAAATTTGG - Intergenic
955168217 3:56536223-56536245 CCTTTTAAGAAGAGGAAATTTGG - Intergenic
955463211 3:59208372-59208394 CCTTTGAAGATGAAGGAAGGTGG + Intergenic
955825221 3:62938973-62938995 CCTTATAAGAAGAGACACAGAGG - Intergenic
955930343 3:64049981-64050003 ACTTGTAAGTAGAGGGGAGGAGG + Intergenic
956174539 3:66460522-66460544 CTTTATAAGAAGAGGAAATCTGG + Intronic
956568734 3:70670247-70670269 CCTTATAAGAAGAGGAAATATGG - Intergenic
956811976 3:72872320-72872342 CCTTACAAGAAGAGGAAAGGAGG - Intergenic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
957286073 3:78219096-78219118 CCTTGTAAAAAGAGGGAAAAGGG - Intergenic
957589725 3:82180403-82180425 CCTTATAAAAAGAGGAAATTCGG - Intergenic
957748920 3:84386145-84386167 CCTGATAAGAATAAGGAAGTAGG + Intergenic
957872241 3:86104274-86104296 ACTAATAAAAAGAGGGAAGAGGG - Intergenic
958114008 3:89190840-89190862 CCTTATAAGAAGAGGAAATTTGG - Intronic
958424856 3:93968265-93968287 CCTTATAAAAAGGGGAAATGTGG + Intronic
958470551 3:94512502-94512524 CCTTATAAGAAGAGACACCGAGG + Intergenic
958567243 3:95830074-95830096 CCTTATAAGAAGAGGAAATGTGG + Intergenic
958790678 3:98647480-98647502 CCTTATAAGAAGAGGAAATCTGG - Intergenic
958834653 3:99130675-99130697 CCTTATAAAAAGGGGAAAGTAGG - Intergenic
958860433 3:99438660-99438682 CCTTAAAAGAAGAGGAAATTAGG + Intergenic
958979570 3:100705668-100705690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
959608112 3:108264132-108264154 CCTTATAAGAAGAGACACAGAGG + Intergenic
959610304 3:108286600-108286622 CCTTGTAAGAAGAGGTGATGAGG + Intergenic
960012222 3:112846780-112846802 CCTTATAAAAAGAGGAAAACTGG + Intronic
960018141 3:112916517-112916539 CCTTATATAAAGAGGGAATTTGG + Intergenic
960725189 3:120662943-120662965 CCTTATAAGAAGAGGAAATTTGG + Intronic
960822847 3:121752825-121752847 TTTCACAAGAAGAGGGAAGGTGG + Intergenic
960908563 3:122625626-122625648 CCTTATAAGAAGAGGACATTAGG + Intronic
961015577 3:123465682-123465704 CCTTATAAGAAGAGGAAATTTGG + Intergenic
961518627 3:127454399-127454421 CCTTCTAAGAAGAGAGAATAAGG - Intergenic
961678704 3:128584301-128584323 CCCCATCAGCAGAGGGAAGGAGG - Intergenic
961738012 3:129014486-129014508 CCTTCTAAGAAGAGGGGATTAGG - Intronic
962073853 3:132059647-132059669 TCTTCTAAGAAGAGGAAAGTTGG - Intronic
962092162 3:132255775-132255797 TCTTATAAGGAGAGGAAAGATGG + Intronic
962215440 3:133516929-133516951 CCTTATAAGAAGAGGAGATTAGG - Intergenic
962254086 3:133858572-133858594 CCTTATAAGAAGAGGAGATGAGG - Intronic
962282417 3:134061910-134061932 CCTTATAAGAAGAGGAATTTTGG - Intergenic
963084744 3:141426507-141426529 CCTTATGAGAGGAGGAGAGGAGG + Intronic
963728957 3:148952356-148952378 CCTTATAAGAAGAGGCAATTAGG - Intergenic
963907246 3:150782785-150782807 CCTTATAAGAAGAGAAAGAGAGG + Intergenic
963975171 3:151472486-151472508 CCTTTTCAGAAGAGTGAGGGTGG - Intergenic
964111909 3:153096625-153096647 CCTTTTAAGAAGAGGAAATTTGG + Intergenic
964465380 3:156985924-156985946 CCTTATAAGAGGAAGCAAGAGGG + Intronic
964623585 3:158738587-158738609 CCTTATAAGAAGAGACACAGAGG - Intronic
966004574 3:174993969-174993991 CCCTATAAGAAGAGAGAAATTGG - Intronic
966069749 3:175861245-175861267 CCTTATAAGAAGAGGACATTAGG + Intergenic
966733169 3:183167560-183167582 CCTTATAAGAAGAGGAGATTAGG - Intergenic
966998500 3:185309013-185309035 CCTTATAAGAAGAGAAAACACGG - Intronic
967348083 3:188480948-188480970 GATTAGAAGAAGGGGGAAGGAGG - Intronic
967634187 3:191781366-191781388 CCTTATGAGAGGAGGAAAGGAGG - Intergenic
967842273 3:194016085-194016107 CCTTATGAGAAGAGGAAATTGGG - Intergenic
967964305 3:194949022-194949044 CCTTATAAGAAGAGGAAATTTGG + Intergenic
967964437 3:194949932-194949954 CCTTATAAGAAGAGGAAATTTGG - Intergenic
968280140 3:197471011-197471033 CCTTATAATAAGAGGAAATTCGG - Intergenic
968745802 4:2359504-2359526 CCTTATAAGAAGAGGAAATATGG + Intronic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
969033527 4:4231957-4231979 CTTTATAAGAAGAGGAAAAGAGG - Intergenic
969174666 4:5389514-5389536 CCTTATAAGAAGAGGAGAGTAGG - Intronic
969257941 4:6015294-6015316 CCTTGTAAGAGGAGGAGAGGAGG + Intergenic
969322714 4:6422674-6422696 CCTTATAAGAAGAGGAGATTAGG - Intronic
969342741 4:6552592-6552614 CCTTATAAGAGGGAGGTAGGAGG - Intronic
969482878 4:7456114-7456136 CCTTATAAGAAGAGGAGATCAGG - Intronic
969515600 4:7646466-7646488 CCTTATAAGAAGAGGAGATCAGG + Intronic
969859507 4:10024422-10024444 CCTTATAGGAAGAGGAAATGAGG + Intronic
970025575 4:11620780-11620802 CCTTATAAGAAGAGAAAATTTGG + Intergenic
970077538 4:12241472-12241494 CCTTATAATAAGAGGAAATTAGG + Intergenic
970584315 4:17500527-17500549 CCTTAGAAGAGGAGGAAACGAGG + Intronic
970586290 4:17517605-17517627 CCTTCTAAGAAGGAAGAAGGAGG - Intronic
970917370 4:21351690-21351712 CCTTATAAGAAAAGGAAATTAGG + Intronic
970926716 4:21460607-21460629 CTTTATAAGAAGAGGAAGAGAGG - Intronic
971290969 4:25339125-25339147 CCTTAAAAGAAGAGGAAATTTGG - Intronic
971528116 4:27648398-27648420 CCTTATATTAAGAGGGAATTTGG - Intergenic
972180620 4:36460457-36460479 CCTTCTAAGAAGAAAGCAGGAGG - Intergenic
972184330 4:36510536-36510558 CCTTATAAGAAGAGGAAATGTGG + Intergenic
972380072 4:38511313-38511335 CCTTATAAGAAGAGGAAATTTGG - Intergenic
972662157 4:41126791-41126813 CCTTATAAGAAGAAGAAATTAGG - Intronic
972745829 4:41931943-41931965 CCTTATAAGAAGGGGAAGAGAGG + Intergenic
973242920 4:47977247-47977269 CCTTATAAGAAGAGGAAACGTGG + Intronic
973838588 4:54837343-54837365 CCTTATAAGAAGAGGAGATTAGG + Intergenic
973839511 4:54846593-54846615 CCTTATAAGAAGAGGAGATTAGG - Intergenic
973960041 4:56100670-56100692 CCTCATAAGAAGAGGAAATTTGG + Intergenic
974140761 4:57883569-57883591 CCTTATAAGAAGAGTAAAGTTGG - Intergenic
974144541 4:57930637-57930659 CCCTATGAGAAGACAGAAGGAGG + Intergenic
974589633 4:63927685-63927707 CCTCATAAGAAGAGGAAATTTGG - Intergenic
974808153 4:66908979-66909001 CCTTTTAAGACCAAGGAAGGTGG - Intergenic
975430757 4:74288062-74288084 CCTTCTAAGAAGAGGAAATTTGG - Intronic
975749929 4:77512574-77512596 CCTTATAAGAAGAGAAAATTTGG - Intronic
975885365 4:78958538-78958560 CCTAATAAGAACAGGGAATTTGG + Intergenic
976028474 4:80721471-80721493 CCTTATAAGATGAGGAAATGAGG - Intronic
976047420 4:80967632-80967654 CCTTATAAGAAGAGCAAATTTGG - Intergenic
976080948 4:81354122-81354144 CCTAAGAAGAAGAGGAAAGGGGG - Intergenic
976304052 4:83541920-83541942 CCTTGTAAGAAGAGGAAACTTGG - Intronic
976496313 4:85733751-85733773 CCTTATAAGAAGAAGAAATTAGG - Intronic
976574007 4:86647749-86647771 CCTTATAAGAAGAGGAAATTAGG + Intronic
976663846 4:87569107-87569129 CCTTATAAGAAGAGGAGATTAGG - Intergenic
976796456 4:88939379-88939401 CCTTATAAGAATGGGGTAGAGGG - Intronic
976816122 4:89149620-89149642 CCTTATAAGAAGGGGAAATTTGG + Intergenic
976888656 4:90016773-90016795 CCTTATAAGAAGAGGAGATTTGG + Intergenic
977227122 4:94405882-94405904 GCTTGTAAGAAGATGAAAGGTGG - Intergenic
977303885 4:95299193-95299215 CCTTATAAGAAGAAGAAATTTGG + Intronic
977399832 4:96518946-96518968 CCTTATAAAAAGAGGAAATCTGG - Intergenic
978481175 4:109192551-109192573 CCTTTTAAGAAAAGAGAAGGTGG + Intronic
978580759 4:110229157-110229179 CCTTATAAGAAGAGGCGACTAGG - Intergenic
978674159 4:111290549-111290571 TAATACAAGAAGAGGGAAGGAGG + Intergenic
979089400 4:116462191-116462213 CATTATGAGAAGAGGAAGGGAGG - Intergenic
979587910 4:122442834-122442856 CCTTATAAAATGAGTGAGGGAGG + Intergenic
979625451 4:122840026-122840048 CTTTATAAGAAGAGGAAACCTGG - Intronic
979682430 4:123476668-123476690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
980812546 4:137901407-137901429 CCTTATAAGAAGAGGAGACCCGG - Intergenic
981842974 4:149133845-149133867 CCTTATAAGAAGAGGAAATGTGG + Intergenic
981977858 4:150753026-150753048 AGTTATAAGAAGATAGAAGGTGG - Intronic
982100033 4:151958671-151958693 CCTTACAAGAAGAGGGAATTTGG - Intergenic
982226363 4:153171040-153171062 CCTTACTAAAAAAGGGAAGGTGG - Intronic
983378624 4:166962037-166962059 CCTTCTTTGAAGAAGGAAGGGGG - Intronic
983576207 4:169264300-169264322 TCTTATAAGAAGAGGAGATGAGG - Intronic
984024667 4:174528882-174528904 CCTTATAAGAAGAGGAAATTTGG - Intergenic
984049050 4:174841360-174841382 CCTTATAAGAAGAGGAGATTAGG - Intronic
984152932 4:176156938-176156960 ACTTATAAGAAGAGGAAATCTGG - Intronic
984426273 4:179590928-179590950 CCTTATAAGAAGAGAAAAGGAGG - Intergenic
984589528 4:181601526-181601548 CCTTATAAGAAGAGGACATTAGG - Intergenic
984599140 4:181706203-181706225 CCTTATAAGAAGAGGAGATTTGG - Intergenic
985245667 4:187977524-187977546 CCTTATACGAAGAGGAAACAGGG + Intergenic
985724448 5:1508446-1508468 CCTTATAAGAAGAGGAGATGAGG + Intronic
985771537 5:1814940-1814962 CCTTATAAGAAGAGGGGATGAGG - Intronic
985816837 5:2133698-2133720 CCTTATAAGAAGAGGAGAAGAGG - Intergenic
986113514 5:4746092-4746114 CTTTATAAGAAGAGGGGATTAGG - Intergenic
986280897 5:6321510-6321532 CCAGATTAGAAGGGGGAAGGTGG + Intergenic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986463620 5:7998389-7998411 CCTTATTAGAAGAGTGAATTTGG - Intergenic
986576585 5:9219552-9219574 CCTTATAAGAATAGGAAATTAGG + Intronic
986623425 5:9700810-9700832 CCTGATAAGAAGAGGAGATGAGG - Intronic
986707961 5:10466967-10466989 TCTAATAAGAAGAGGAAACGAGG - Intronic
986776947 5:11024555-11024577 CCTTATAAGAAAAAGGAAAAAGG - Intronic
986943079 5:12980334-12980356 CCTTAGAAGAAGAGGAAATTAGG + Intergenic
986977710 5:13411830-13411852 CCTTATAAGAAGAGGAAATTAGG + Intergenic
986987057 5:13512135-13512157 CCTTCTAAGAAGAGGAGAGCAGG - Intergenic
987033837 5:14000183-14000205 CCTTCTGAAAAGAGGGAAGTTGG + Intergenic
987150882 5:15038537-15038559 CCTCATAAGAGGAAGGTAGGAGG - Intergenic
987180975 5:15368148-15368170 CCTTATAAGAGGGAGGTAGGAGG + Intergenic
987188063 5:15445235-15445257 CCTTATTAGAGGAAGGCAGGAGG + Intergenic
987244379 5:16033704-16033726 CCTTATAAGAAGAGGAAATTAGG + Intergenic
987253404 5:16123296-16123318 CCTTATAAGAAGAGGAGATTAGG + Intronic
987353025 5:17038072-17038094 CATCCTAAGAAGAGGGAAGTTGG + Intergenic
987362886 5:17122527-17122549 CCCTATAAGAAGAGGAAATGTGG + Intronic
987820607 5:22961515-22961537 CCTTATAAGAAGAGGAGGAGAGG - Intergenic
987877458 5:23697041-23697063 CCTTATGAAAACAGGGAAGATGG + Intergenic
988360684 5:30232859-30232881 CCTTTTAAGAAGAGGAAATTAGG + Intergenic
988414050 5:30923521-30923543 CCTTATAAGAAGGGGAAATTTGG + Intergenic
988443934 5:31263581-31263603 CTTTATAAGAAGAGGAAGAGAGG - Intronic
988593549 5:32569891-32569913 CCTTATAAAAAGGAGGAAGAGGG + Intronic
988653704 5:33183254-33183276 CGTTATAAGAAGAGATATGGTGG - Intergenic
988660170 5:33257788-33257810 CCTTACAAGAAGAGGAAATTTGG + Intergenic
988709965 5:33763290-33763312 CCTTATAAGAGGAAGGCAAGAGG + Intronic
988998902 5:36740997-36741019 CCTTATAAGAAGAAGAAATTAGG - Intergenic
989094618 5:37770297-37770319 CTTTATAAGAAGAGGAAATTTGG + Intergenic
989364516 5:40640616-40640638 CCTTATAAGATGAGGAAATCTGG + Intergenic
989437186 5:41428427-41428449 CATTATAAGAAGAGGAAATTTGG + Intronic
989963230 5:50440579-50440601 CCTGCCAAGAGGAGGGAAGGAGG + Intronic
990220191 5:53579814-53579836 CCTTATAAGAAGGATGCAGGTGG + Intronic
990335126 5:54764889-54764911 CCTTATAAGAAAAGGAAATGTGG - Intergenic
990741460 5:58916474-58916496 CCTTATAAGACAAAGGCAGGTGG + Intergenic
991437331 5:66610240-66610262 CCTTATAAAAAGGGGAAATGTGG - Intronic
991446673 5:66707606-66707628 TCTTATAAGAAGAGGAAATTAGG - Intronic
991525431 5:67551829-67551851 CCTTATAAGAAGAGGATATTAGG - Intergenic
991937516 5:71816568-71816590 TCTTATAAGAAGAGGAAACCTGG - Intergenic
991998200 5:72409332-72409354 CCTTATAAGAAGAGAGAAATAGG - Intergenic
992194346 5:74324938-74324960 CCATGGAAGAAAAGGGAAGGGGG - Intergenic
992202438 5:74397663-74397685 CCTTATAAGAAGAGGGAATTTGG - Intergenic
992318750 5:75588820-75588842 CCTTATAAGAAGGAGGCAGGAGG - Intronic
992688806 5:79223389-79223411 GCTTATAAGATGAAGCAAGGAGG + Intronic
993858179 5:93101086-93101108 CCTTATAAGAGGAAGACAGGAGG + Intergenic
993874327 5:93288743-93288765 CCTTATAAGAAGAGGAGATAAGG - Intergenic
994184440 5:96802819-96802841 CCTTATAAGAAGATGGAGACTGG + Intronic
994282501 5:97922279-97922301 CCTTATAAGAAGAGGAAATTTGG - Intergenic
994469122 5:100179825-100179847 CCTTGAAAGAAGAGGGTTGGAGG + Intergenic
994673043 5:102785252-102785274 CTTAATAAGAAAAGGGAGGGGGG + Intronic
995379243 5:111513196-111513218 CCTTAGAAGCAGAGAAAAGGAGG + Intergenic
995405964 5:111796280-111796302 CCTTAAAAGATGAAAGAAGGAGG - Intronic
995424162 5:112001384-112001406 CCTTATAAGAAGAGGAAATTTGG - Intergenic
995837060 5:116409574-116409596 CCTTATAAGAAGAGGGGATTAGG + Intronic
996534971 5:124568273-124568295 CCTTATAAGAAAAGGAAATCTGG + Intergenic
996567416 5:124894097-124894119 CCTTATAAGAAGAGGAAATTTGG - Intergenic
996771598 5:127092368-127092390 CCTTATAAGAAGAGGAAATTTGG + Intergenic
997254453 5:132417711-132417733 CCTTATAAGAGGGAGGCAGGGGG - Intronic
997901006 5:137764255-137764277 CCTTATAAGAAGAGCCCAGAGGG + Intergenic
998010106 5:138688140-138688162 TCTTATAAGAAGAGGAGTGGTGG + Intronic
998058850 5:139103334-139103356 CCTTTTAAAAAGAGGGAGGAAGG - Intronic
998329234 5:141309216-141309238 CATTCTCAGAAAAGGGAAGGGGG - Intergenic
998360409 5:141581123-141581145 CCTTATAAAAAGAGGAAATTTGG + Intronic
999161039 5:149499293-149499315 CCTTAAAAAAAAAGGGGAGGGGG + Intronic
999446011 5:151639967-151639989 CCTTATAAGAGGTGGGTAGAGGG - Intergenic
999497945 5:152118548-152118570 CCTTATGAGAAAAGGGCAGAGGG + Intergenic
1000017332 5:157289612-157289634 CCTTATAAAAAGAGGAAATCTGG - Intronic
1000041281 5:157486918-157486940 CCTCATAAGAAGAGGAGAGTTGG + Intronic
1000122363 5:158209378-158209400 CCTGATAAGAAGAGACAAAGTGG - Intergenic
1000279208 5:159767724-159767746 CCTTATAAGGGGAGGAAAGGGGG - Intergenic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1000857153 5:166412788-166412810 TTTTCTGAGAAGAGGGAAGGTGG + Intergenic
1000973362 5:167738811-167738833 CCTTATAAGAAGAGGAAATTTGG - Intronic
1001028032 5:168240727-168240749 AAATATAAGAAAAGGGAAGGAGG + Intronic
1001179181 5:169502725-169502747 CCTTATAAGAAGAGGTGATTAGG + Intergenic
1001338831 5:170825179-170825201 TCTTATAAGAAGAGGAAATTTGG - Intergenic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1001581688 5:172802829-172802851 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1001679511 5:173545911-173545933 CCTTGTGGGAAGAGGGGAGGGGG - Intergenic
1001707257 5:173750516-173750538 CCTTACAAGAAGAGGAAATTAGG + Intergenic
1001869677 5:175140421-175140443 TCTTATAAGAAGAGGAAATTAGG + Intergenic
1001888586 5:175319072-175319094 CTTTATAAGAAGAGAGAGAGCGG + Intergenic
1002706322 5:181162782-181162804 CCTTATAAGAGGAGGAAATGTGG + Intergenic
1002871182 6:1168586-1168608 CCTTACGAGAAGAAGGCAGGAGG + Intergenic
1002886914 6:1305531-1305553 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1002906426 6:1452868-1452890 CCTTATAAAAAGAGGAAATCAGG - Intergenic
1002939018 6:1699651-1699673 CCTTATAGGAGGAAGGCAGGAGG - Intronic
1003024530 6:2542459-2542481 CCTTATCAGAAGAGGACATGAGG + Intergenic
1003072815 6:2958160-2958182 CCTTATAAAAAGAGGAGATGAGG + Intronic
1003265610 6:4562723-4562745 CCTTACAAGAAGAGGAGATGAGG + Intergenic
1003311249 6:4971682-4971704 CCTCATAAGAAGAGGAAATTTGG - Intergenic
1003466226 6:6382684-6382706 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1003487165 6:6589741-6589763 ACTTATAAGAAGAGGAGATGAGG - Intronic
1003498644 6:6686453-6686475 CCTTATAGGAAGAGGAGATGAGG - Intergenic
1003617751 6:7670710-7670732 CCTTATAAGAAAAGGAAATTAGG - Intergenic
1003668363 6:8132417-8132439 CTTTGTAAGAAGAGGAAATGTGG - Intergenic
1003733406 6:8851144-8851166 CCTTATAAAAAGAGGAGATGAGG + Intergenic
1003862526 6:10335505-10335527 CCTCATAAGAAGCGGGGATGAGG + Intergenic
1003970654 6:11296058-11296080 CCTTATAAGAAGAGGAGATGAGG + Intronic
1003991025 6:11486741-11486763 CCTTATAAGAAGAGAAGATGAGG - Intergenic
1004004033 6:11622758-11622780 CCTTATAAGAAGGGGAGATGAGG - Intergenic
1004062215 6:12208676-12208698 CCTTAGAAGAAGAGGAGAGGGGG + Intergenic
1004088991 6:12480131-12480153 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1004310310 6:14539798-14539820 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1004404405 6:15318611-15318633 CCTTGTAAGGAAAGGGGAGGGGG - Intronic
1004715820 6:18215494-18215516 CCTCATAAGAAGAGGAGATGAGG - Intronic
1005146376 6:22695212-22695234 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1005273094 6:24187168-24187190 CCTTAAAAAAATAGGGAAGTTGG + Intronic
1005427209 6:25715407-25715429 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1005647728 6:27857148-27857170 CCTTTTAAGAAGAGGAAATTTGG + Intronic
1005888252 6:30113793-30113815 CCTTAAGACAAGAGGCAAGGAGG - Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006709095 6:36049861-36049883 AGTTATAGCAAGAGGGAAGGTGG + Intronic
1006728506 6:36217486-36217508 CTTTATCTGAAGAGGCAAGGTGG + Intronic
1006858750 6:37155066-37155088 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1007066286 6:38993547-38993569 CCATAAAAGAAGAGGGAAATGGG - Intronic
1007839988 6:44708264-44708286 CCTTACAAGAAGAGGAAATTTGG - Intergenic
1008279884 6:49584361-49584383 CCTTATAAGAAGAGACAATTAGG - Intergenic
1008333241 6:50268308-50268330 CCTTTTAAAGACAGGGAAGGGGG - Intergenic
1009043585 6:58211440-58211462 CCTCATAAAATGAGGGAGGGAGG - Intergenic
1009206646 6:60810378-60810400 CCTTATAAGTCCAGGGAAGCCGG - Intergenic
1009263505 6:61525596-61525618 TCTTATAAGAAGAGGAAATCTGG - Intergenic
1009906541 6:69875921-69875943 CATTATAAAGAGAGGAAAGGAGG + Intronic
1010108985 6:72202430-72202452 CCTTACAAGAAGAGGAAATTTGG - Intronic
1010273318 6:73939642-73939664 CCTTATAAGGAGAGGAAATTAGG + Intergenic
1010729960 6:79380831-79380853 CCTTATAAGAAGAGGGGGTTAGG - Intergenic
1010808315 6:80265537-80265559 GCTTGGAAGAAGAGGGAATGAGG + Intronic
1010931960 6:81814584-81814606 CCTTCTAAGAAGAGGAAATTAGG - Intergenic
1011790443 6:90893170-90893192 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1012044160 6:94248313-94248335 CCTTATATGAAGAGGAAATTTGG - Intergenic
1012482337 6:99680921-99680943 CCTTATAAGAAGAGGAAAATTGG + Intergenic
1013055384 6:106577745-106577767 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1013260670 6:108438401-108438423 CCTTATGAGAAGAGGAAATGTGG - Intronic
1013260698 6:108438722-108438744 CCTTCCAAAAAGCGGGAAGGGGG - Intronic
1013277972 6:108604903-108604925 CCCTATAAGAAGAGAGAAAAAGG + Intronic
1013346235 6:109263330-109263352 CCTTATAAGAAGAGGAAATTCGG + Intergenic
1013447960 6:110250371-110250393 CCTTATAAAAAGAGGAAATTTGG - Intronic
1013993586 6:116281085-116281107 TCTTATAAGAAGGAGGCAGGAGG + Intronic
1014597976 6:123369228-123369250 CCTTAAAAGAAGAGGAAATTTGG - Intronic
1014660013 6:124158251-124158273 CCTTATAAGAAGAGGTGATTAGG - Intronic
1014707213 6:124762292-124762314 CCTTATGAGAAGAGGAAATTTGG - Intronic
1014722788 6:124938635-124938657 ACTTAGAGGAAGGGGGAAGGTGG - Intergenic
1014961683 6:127694664-127694686 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015058055 6:128928549-128928571 CCGTTCAAGGAGAGGGAAGGAGG + Intronic
1015136013 6:129871652-129871674 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015678604 6:135779458-135779480 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1016035735 6:139380865-139380887 CCTCATAAGAAGAGGAAATTTGG - Intergenic
1016240882 6:141929127-141929149 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1016397649 6:143642659-143642681 TCTTATAAAAAGAGGGAATTTGG + Intronic
1016516387 6:144897157-144897179 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1016659861 6:146565824-146565846 CTTTATAAGAAGAGGAAGAGAGG - Intergenic
1016724355 6:147344632-147344654 TCTTATAAGAAGAAGAAATGTGG - Intronic
1016740997 6:147528436-147528458 CCTTATAAGAAGAGGAGATTAGG - Intronic
1017321224 6:153096160-153096182 GCTGCTAAGACGAGGGAAGGAGG + Intronic
1017757195 6:157539555-157539577 CTATTTAAGAAGAGGGAAAGAGG + Intronic
1017937081 6:159015214-159015236 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1018035098 6:159874984-159875006 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1018390009 6:163335094-163335116 CCTTATAGAAAGAAGGAATGTGG + Intergenic
1019554904 7:1624393-1624415 CCTTCTAAGAAGAGGAAATCAGG - Intergenic
1019791260 7:3015446-3015468 CCTTATAAGAAGAGGAAATGAGG - Intronic
1019826539 7:3289263-3289285 CCTTATAAAAAGAGGAAATTAGG - Intergenic
1020108594 7:5434910-5434932 CCTTATAAGAAGAGGAGATTAGG - Intronic
1020361892 7:7335651-7335673 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1020677842 7:11201825-11201847 CCTTAGGAGAAGAGGGGAGTGGG + Intergenic
1021065805 7:16170964-16170986 CCCCACAAGAAGAGGGAAGCCGG + Intronic
1021190124 7:17610610-17610632 ACTTAAAAGAAGAGGGAATTTGG + Intergenic
1021611760 7:22464629-22464651 CCTTATAAGAGGAGGAAATTTGG + Intronic
1021972603 7:25980516-25980538 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1022549166 7:31220770-31220792 CTTTATAAGAAGAGAAAATGTGG - Intergenic
1023010814 7:35923540-35923562 CCTTATAAGAAGGGGAGATGGGG + Intergenic
1023296190 7:38717225-38717247 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1023317207 7:38951673-38951695 CCTTATAAGAAAAGGAAATGAGG + Intergenic
1023378768 7:39585362-39585384 CCTTATAAGAAGAGGAAATTTGG + Intronic
1023393310 7:39730868-39730890 CCTTATAGGATGAGGAAAAGAGG + Intergenic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1023790941 7:43753205-43753227 CCTTACGAGAAGAGGAAAGTTGG - Intergenic
1023817627 7:43962513-43962535 CCCTATCAGAACAGGGAAGCTGG - Intergenic
1024281468 7:47722817-47722839 CCTTATAAGAAGAGGAGATTAGG - Intronic
1024472714 7:49779885-49779907 CCTTATAAGAAGAGGAGATGTGG - Intronic
1024542709 7:50492025-50492047 CCTTATAAGAAGAGAAAATTTGG + Intronic
1024670494 7:51589548-51589570 CCTTATAAGAAGAGACATGAGGG + Intergenic
1024762226 7:52612435-52612457 TTGTATAAGAAGAGGGAATGAGG - Intergenic
1024830684 7:53451776-53451798 CTTTATGAGAAGAGGAAATGTGG - Intergenic
1025124447 7:56333645-56333667 CCTTATAAGAAGGGGAGATGGGG + Intergenic
1025192633 7:56907716-56907738 CCTTGTAAGAGAAGGGCAGGAGG - Intergenic
1025679312 7:63669204-63669226 CCTTGTAAGAGAAGGGCAGGAGG + Intergenic
1025702809 7:63835501-63835523 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
1026108903 7:67443052-67443074 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1026154692 7:67816864-67816886 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1026172058 7:67962612-67962634 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
1026538869 7:71262990-71263012 CCTTATGAGAAGAGGAAATTTGG + Intronic
1026839509 7:73661794-73661816 TCTTATAAGAGGGAGGAAGGAGG - Intergenic
1027835205 7:83232876-83232898 CCTCATAAGAAGAGGAAATGTGG + Intergenic
1027844943 7:83361063-83361085 CTTTATAAGAAGAGGAAGGGAGG - Intergenic
1027946873 7:84758471-84758493 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1027979116 7:85194871-85194893 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1028205676 7:88013995-88014017 CCTTAGAAGGAGAGGGTAGTAGG - Intronic
1028809315 7:95066153-95066175 CCTTATAAGAATAGGAAATTTGG + Intronic
1028921000 7:96309951-96309973 CCTTATACGAAGAGGAAATTAGG + Intronic
1029090746 7:98046200-98046222 CCTTATAAGAAGAGGAATGAGGG + Intergenic
1029193780 7:98790103-98790125 CCTTCTAAGAAGAGGAAATTTGG - Intergenic
1029256304 7:99271996-99272018 CCATATAAAAAGAGGGAAGATGG - Intergenic
1029519246 7:101049690-101049712 CCTTATAAGAAGGGGAAATTTGG - Intronic
1029554949 7:101262422-101262444 CCTTATAAGAAGGGGAGATGGGG + Intergenic
1029742251 7:102497387-102497409 CCCTATCAGAACAGGGAAGCTGG - Intronic
1029760241 7:102596552-102596574 CCCTATCAGAACAGGGAAGCTGG - Intronic
1029890950 7:103930261-103930283 CATTATAAGAAGAAGAAATGTGG - Intronic
1029923172 7:104287619-104287641 CCTTAAAAGAAAAGAGAAGAAGG - Intergenic
1029986547 7:104928142-104928164 CCTCATAAGAAGAGGAAATTTGG + Intergenic
1030045737 7:105493675-105493697 CCTCCTAAGAAGAGGAAATGGGG + Intronic
1030346944 7:108444685-108444707 CCTTATAAAAAGAGGCAATTTGG - Intronic
1031297701 7:120024323-120024345 CCTCATAAGAAGAGGAAGAGAGG - Intergenic
1031478354 7:122249273-122249295 CCTTTTAAAAAGAGGGAATTTGG + Intergenic
1031562985 7:123260623-123260645 CCTTCTAAGGACAAGGAAGGAGG - Intergenic
1031910406 7:127511110-127511132 CCTTCTAAGAGGAAGGCAGGAGG + Intergenic
1032004406 7:128288729-128288751 GCTTATAAGAAGATGGCATGTGG + Intergenic
1032123398 7:129173116-129173138 CCTTATGAGAAGAGGAAAATTGG - Intergenic
1032145599 7:129376932-129376954 GCTGGGAAGAAGAGGGAAGGTGG - Intronic
1032172757 7:129599577-129599599 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1032508639 7:132454703-132454725 CCTTATAAGAAGAGGAAATTTGG + Intronic
1033720407 7:144052983-144053005 CTTTAAAAGAAAAGGGAAAGAGG + Intergenic
1033983615 7:147196032-147196054 CCTTATAAGAAGGGGAAATTAGG + Intronic
1034308216 7:150063882-150063904 GCGTATAGGAAGAGGGAGGGGGG - Intergenic
1034709416 7:153177705-153177727 CATTAGAAAAAGAGGAAAGGAGG - Intergenic
1034726376 7:153339994-153340016 CCTTATAAGAAGAGAAAACTTGG - Intergenic
1034760897 7:153670882-153670904 CCTTATAAGAAGAGGAGATCAGG - Intergenic
1034798637 7:154036789-154036811 GCGTATAGGAAGAGGGAAGGGGG + Intronic
1035046711 7:155972677-155972699 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1035116769 7:156531471-156531493 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1035700813 8:1638311-1638333 CCTTATAAGAAGAGGAGATGAGG + Intronic
1035830322 8:2688479-2688501 CCATCTAGGAAGCGGGAAGGGGG - Intergenic
1036112711 8:5921721-5921743 CCCCAAAAAAAGAGGGAAGGAGG + Intergenic
1036115408 8:5954794-5954816 CCTAAGAAGAAGAGAGATGGGGG - Intergenic
1036129468 8:6095512-6095534 CCTATTAAGGAGATGGAAGGAGG - Intergenic
1036211287 8:6843168-6843190 CCTTATAAGAAAAGGAAATTTGG + Intergenic
1036574573 8:10014817-10014839 CCTTATAAGAAGAGGCGATTAGG - Intergenic
1036781426 8:11650564-11650586 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1037241821 8:16786076-16786098 CCTTATAAGAGAAAGGTAGGGGG + Intergenic
1037346374 8:17905618-17905640 CATTTTGAGAAGAGGGAAAGAGG + Intronic
1037616310 8:20522309-20522331 CCTTATAAGAAGGGGAGAGGAGG + Intergenic
1037851318 8:22331785-22331807 CCTCATAAGAAGAGGAGATGAGG - Intronic
1037983698 8:23273205-23273227 CCATATAAGAAGAGGAAATTTGG + Intronic
1038016794 8:23522465-23522487 CTTTATAAGAAGAGAGGAGTTGG + Intergenic
1038062895 8:23931794-23931816 CCTAAAAAGAAGAGGGAACTGGG - Intergenic
1038067558 8:23978895-23978917 ACTTATACACAGAGGGAAGGAGG - Intergenic
1038161458 8:25043290-25043312 TCTTATAAGAAGAGGAAATTTGG - Intergenic
1038340124 8:26679181-26679203 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1038340991 8:26684764-26684786 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1038349255 8:26761506-26761528 CCTTATAAGAAGAAGAAATTGGG + Intronic
1038355294 8:26823647-26823669 TCTTATAGGAAAAAGGAAGGTGG - Intronic
1038368291 8:26960663-26960685 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1038558703 8:28549178-28549200 CCTTATAAGAGGAGGAAATTTGG - Intronic
1038586607 8:28795339-28795361 CCTCATAAGAAGAGGAAGAGAGG + Intronic
1038619343 8:29125292-29125314 CCTTATTAGAAAAGGAAATGAGG - Intronic
1039057929 8:33551278-33551300 CCTGATAGGAAGAGGCAAGGAGG - Intronic
1039146736 8:34455675-34455697 CCTTATAAGAAGAAGAAATATGG + Intergenic
1039370895 8:36982896-36982918 CCTTACAAGAAGAGGGAATTAGG + Intergenic
1039440033 8:37588669-37588691 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1039564852 8:38544040-38544062 CCTTATAAAAAGAGGCAATTTGG + Intergenic
1039720785 8:40162018-40162040 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1039741848 8:40390014-40390036 CTAAATAAGAAGAGGGAAGCAGG - Intergenic
1040618192 8:49061275-49061297 CCTCATAAGAAGAGGGAATTTGG + Intronic
1040660168 8:49563829-49563851 CCTTATTAGAAGAGGAAATTAGG - Intergenic
1040803934 8:51373190-51373212 CCTTATAAGAAAAGGAAATGTGG + Intronic
1040856022 8:51948716-51948738 CCTTATAAGAAAAGGAAATTTGG + Intergenic
1040857373 8:51961857-51961879 CCTTACAAGAAGAGGAAATGTGG - Intergenic
1040864820 8:52038334-52038356 CCTTTTAAGAAGAGATTAGGGGG - Intergenic
1040978085 8:53215970-53215992 CCTTATAAAAAGAGGGCATTAGG - Intergenic
1041240312 8:55843584-55843606 CCTTATAAGGAGAGGAAATTTGG + Intergenic
1041260961 8:56020194-56020216 TGTTATAAGAAGAGGGAATTTGG - Intergenic
1041644249 8:60235303-60235325 CCTTATAAGAAGAGGAAATTTGG - Intronic
1041719901 8:60966148-60966170 CCTTAGAAGAAGAAAGAAAGAGG - Intergenic
1041777069 8:61535037-61535059 CCTTATAAGAAGAGGAACTTTGG - Intronic
1041808633 8:61883469-61883491 CATTATAAAAGGAGGGAAAGTGG + Intergenic
1041954248 8:63539916-63539938 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1042000056 8:64112054-64112076 CCTTATAAGAAGAGGGGATTAGG - Intergenic
1042192218 8:66198509-66198531 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1042250994 8:66756105-66756127 TCTTATAAGAAGAGGAAATTTGG + Intronic
1042263589 8:66885764-66885786 ACTGATTGGAAGAGGGAAGGAGG - Intronic
1042929029 8:73995402-73995424 CCTTATAAGAAGAGGAAATTTGG - Intronic
1043534139 8:81182427-81182449 CCTTATAAGAAGAGGATACTAGG - Intergenic
1043772370 8:84221264-84221286 TCTTATAAGAAAATGGAAAGCGG + Intronic
1043794656 8:84521178-84521200 CCTTATAAGAAGTGGAAGAGAGG + Intronic
1044354741 8:91208041-91208063 CCTTATGAGAAGAGGAAATTTGG - Intronic
1044684940 8:94817437-94817459 TCTGAAGAGAAGAGGGAAGGAGG - Intronic
1044704231 8:94993177-94993199 CCTTATAAGAAGAGGAGATAAGG - Intronic
1044846338 8:96385535-96385557 CCTTATAAGAAGAGGAAAATAGG + Intergenic
1044884576 8:96763101-96763123 CTTTATAAGAAGAGGAAAGTTGG - Intronic
1045003683 8:97899596-97899618 CCTTATAAGAAGAGGAAGTCTGG - Intronic
1045403491 8:101842155-101842177 CCTTAAAAGAAGAGGAAATTTGG - Intronic
1045611085 8:103842988-103843010 ACTTATAAGAAGAGGAAATTTGG - Intronic
1045669277 8:104529180-104529202 CCTTATAAGAAGAGGAGATCAGG + Intronic
1045704704 8:104908277-104908299 CCTTATAAGAAGAGGAAATTAGG + Intronic
1045943405 8:107765841-107765863 CCTTATAAGATGAGGAAATTTGG + Intergenic
1046490744 8:114950630-114950652 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1046627787 8:116593593-116593615 CCTTATTAGAAGAGGAAATTAGG + Intergenic
1046790542 8:118317031-118317053 TCTTATAAGAAGAGGAAATTTGG + Intronic
1046886675 8:119375181-119375203 CCTAATAAGAAGGAGGCAGGAGG + Intergenic
1047002440 8:120586540-120586562 CCTTATAAGAGGGAGGCAGGAGG - Intronic
1047124526 8:121945950-121945972 CTTTATAAGAGGAGGGCAGGAGG - Intergenic
1047184985 8:122624741-122624763 CCTTACAAGAAGAAGAAAAGAGG - Intergenic
1048218001 8:132514304-132514326 CCTTATAAGAGGATGCCAGGTGG - Intergenic
1048270113 8:133021711-133021733 CCTTATAAGAAGAGGGGGTCAGG - Intronic
1048356228 8:133656230-133656252 CCTTATAAGAAGGAAGCAGGAGG - Intergenic
1048404376 8:134104912-134104934 CCTTAAAAGAGGGAGGAAGGAGG + Intergenic
1048455585 8:134575326-134575348 CCTTATAAAAGGAAGGCAGGAGG + Intronic
1048544365 8:135372632-135372654 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1048679424 8:136823420-136823442 CTTTATGAGAAGAGGCAACGAGG + Intergenic
1048875940 8:138837243-138837265 CCTTATAACCAGAGTGAAAGAGG - Intronic
1049241685 8:141540571-141540593 CCTTATAAGAAGAGGCGATGGGG - Intergenic
1049358525 8:142200647-142200669 CCTTTTAAGAGGAAGGCAGGTGG + Intergenic
1049903753 9:196189-196211 CCTTTTAAGAAGAGGAGACGAGG + Intergenic
1050070761 9:1810883-1810905 CCTCATAGAAAGAGTGAAGGAGG + Intergenic
1050185230 9:2965949-2965971 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1050229771 9:3509920-3509942 ACCTATAAGAAGTGGGGAGGAGG + Intronic
1050369512 9:4906405-4906427 CCTTATAAGAAGAGAAAATGTGG + Intergenic
1050535129 9:6624355-6624377 CCTTATAAGAAGAGCAAAATTGG + Intronic
1050639275 9:7649224-7649246 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1050646359 9:7723789-7723811 CCTTATAAGAGTGGGGCAGGAGG + Intergenic
1051202429 9:14642597-14642619 CCTTATAAGAAGAGGAAATTTGG + Intronic
1051358232 9:16259395-16259417 CCTTATAACAAGAGGAAATTTGG - Intronic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052183108 9:25555430-25555452 CCTTATAAGAGGGAGGTAGGGGG - Intergenic
1052684966 9:31744080-31744102 CCTTATAAGAGAGAGGAAGGAGG - Intergenic
1052708350 9:32020958-32020980 CCTTATAAAAGGAGAGCAGGAGG + Intergenic
1052796859 9:32931117-32931139 CCTTATAAAAAGAGGAAGGCAGG - Intergenic
1053558499 9:39163432-39163454 CCTTTTCAGAAGAGCGAAGTTGG - Intronic
1053822617 9:41983657-41983679 CCTTTTCAGAAGAGCGAAGTTGG - Intronic
1054138615 9:61455509-61455531 CCTTTTCAGAAGAGCGAAGTTGG + Intergenic
1054857678 9:69918601-69918623 CCTTATAACAAGGGGGAATTTGG - Intergenic
1055645632 9:78358905-78358927 CCTTCTAAGAAGAGGAAATTTGG - Intergenic
1056048248 9:82741407-82741429 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1056296505 9:85198560-85198582 CCTTATAACAAGAGGAAATTAGG - Intergenic
1056409923 9:86315000-86315022 ACTTCTAAGAAGAGAGAATGTGG - Intronic
1056598922 9:88030832-88030854 CCTTATCAGAAGAGGAGATGAGG - Intergenic
1056737337 9:89220908-89220930 CCTCATAAGAAGAGGAGATGAGG + Intergenic
1056847462 9:90053384-90053406 TCTTATAAGAAGAGGAGATGAGG - Intergenic
1056938986 9:90938925-90938947 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1056957820 9:91096595-91096617 CCTTCTAAGAAGAGGAGATGAGG - Intergenic
1057008068 9:91578135-91578157 CCTTATAAGAAGAGGAAATTAGG + Intronic
1057306146 9:93913097-93913119 CCTTATAAAAAGGGGGAAATTGG + Intergenic
1057317112 9:93976650-93976672 CCTTATCAGAAGAGGAGATGAGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057559218 9:96114240-96114262 CCTTGTAAGAAAAGGGAACTAGG - Intronic
1057863424 9:98660828-98660850 TCTTATAAGAAGGAGGCAGGAGG - Intronic
1057941369 9:99288123-99288145 CCTCAAAGGAAAAGGGAAGGAGG + Intergenic
1058003638 9:99892845-99892867 CCTTATATGAAGAGGAAATTTGG + Intergenic
1058328205 9:103725116-103725138 ACTGAAAAGAAGAGAGAAGGTGG + Intergenic
1058425408 9:104871368-104871390 CTTACTGAGAAGAGGGAAGGTGG + Intronic
1058464182 9:105211831-105211853 CCTTATGAGAATAGGAAATGTGG - Intergenic
1058530517 9:105901245-105901267 CCTCAGAAGAGGAGGGTAGGGGG + Intergenic
1058590144 9:106556823-106556845 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1058735519 9:107890521-107890543 CCTTACAAGAAGAGAGAATTTGG + Intergenic
1059014114 9:110495394-110495416 CCTTATAAGGGGAAGGCAGGAGG + Intronic
1059058978 9:111015014-111015036 CCTTATAAGAGGAAGAAAGTTGG + Intronic
1059204951 9:112455872-112455894 CATTCTACTAAGAGGGAAGGAGG - Intronic
1059343170 9:113611054-113611076 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1059496721 9:114716139-114716161 CCTTGTAAGAAGAGGAAATTTGG - Intergenic
1059498800 9:114732679-114732701 CCTTCTAAGAAGAGGAAATTAGG + Intergenic
1059698808 9:116755415-116755437 CCTTTTAAGAAGAGGAAAACTGG + Intronic
1059726636 9:117014756-117014778 CCTTATAAGAAGAGGATATTGGG + Intronic
1060938702 9:127530876-127530898 CCTATTCAGAAGTGGGAAGGAGG + Intronic
1061277090 9:129575376-129575398 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1061430661 9:130528313-130528335 CCTGAGATGAGGAGGGAAGGTGG + Intergenic
1061551556 9:131337652-131337674 CCTTATAAAAAGGGGAAATGTGG + Intergenic
1061559102 9:131391391-131391413 CCTCACAAGAGGAAGGAAGGAGG - Intergenic
1061750303 9:132772431-132772453 CCTTCTAAGAGGAGGAAATGTGG + Intronic
1061755751 9:132811325-132811347 CCTTATAAGAAGGAGGTAAGAGG + Intronic
1061829303 9:133280649-133280671 CCTTATCAAAAGACGGAAAGAGG - Intergenic
1062488947 9:136795108-136795130 CCTCATAAGAAGAGGAAATTAGG + Intronic
1062638350 9:137503380-137503402 CCAAAAAAGAAGAAGGAAGGAGG + Intronic
1203458880 Un_GL000220v1:15198-15220 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1185604906 X:1363074-1363096 CCTTATAAGAAGAGGAGACGTGG - Intronic
1185606251 X:1368652-1368674 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185607185 X:1373782-1373804 CCTCATAAGAAGAGGAGATGAGG + Intronic
1185607699 X:1376579-1376601 CCTCATAAGAAGAGGAGATGAGG + Intronic
1185627896 X:1495413-1495435 CCTCATAAGAAGAGGAGATGAGG + Intronic
1185627933 X:1495648-1495670 CCTCATAAGAAGAGGAGATGAGG + Intronic
1185627973 X:1495883-1495905 CCTCATAAGAAGAGGAGATGAGG + Intronic
1185631200 X:1516985-1517007 CCTCATAAGAAGAGGAGATGAGG + Intronic
1185682075 X:1897118-1897140 CCTTATAAGAAGAGGACATGAGG - Intergenic
1185704699 X:2258004-2258026 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185714146 X:2327778-2327800 GCTTATAAGAAGAGGAGATGAGG + Intronic
1185721826 X:2388416-2388438 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185746078 X:2574575-2574597 CCTTATAAGAAGAGGAGACGAGG + Intergenic
1185770425 X:2761707-2761729 CCTCATAAGAAGAGGAGATGAGG + Intronic
1185776359 X:2805731-2805753 CCTTATAAGAAGAGGAGATGAGG - Intronic
1185790215 X:2923651-2923673 CCTTATAAGAAGAGGAGATGAGG - Intronic
1185791837 X:2933057-2933079 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185800703 X:3007899-3007921 CTTTATAAGAAGAGGAAATGAGG - Intronic
1185815378 X:3150282-3150304 CCTTATAAGAAGAGGAGAGGAGG - Intergenic
1185822340 X:3217656-3217678 CCTCATAAGAAGAGGAGATGAGG - Intergenic
1185841674 X:3397884-3397906 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1185869608 X:3652827-3652849 CCTCATAAGAAGAGGAGATGAGG + Intronic
1185921971 X:4103482-4103504 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185924841 X:4134284-4134306 CCTTTTAAGAAGAGGAGATGAGG - Intergenic
1185936258 X:4260786-4260808 CCTTATAAGAAGAGACACAGGGG - Intergenic
1185943338 X:4346090-4346112 CCTTATAAGAAGAGGAGAAGAGG + Intergenic
1185943607 X:4349138-4349160 CCTTATAAGAAGAGGAGATTCGG + Intergenic
1185952174 X:4449477-4449499 CATTAAAGGAAGAGGGAAGTTGG + Intergenic
1186009300 X:5111391-5111413 CCTCATAAGAAGAGGAGATGAGG - Intergenic
1186009332 X:5111626-5111648 CCTTGTAAGAAGAGGAGATGAGG - Intergenic
1186146784 X:6632424-6632446 CCTTATAAGAAGAGAAGATGAGG - Intergenic
1186186816 X:7028957-7028979 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1186187838 X:7039516-7039538 CCTTACAAGAAGAGGAGATGAGG + Intergenic
1186188642 X:7046275-7046297 CCTTGTAAGAAGAGGAGATGAGG + Intergenic
1186197091 X:7120308-7120330 CCTTATAAGAGGCGGCCAGGAGG + Intronic
1186371686 X:8953357-8953379 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1186410308 X:9340697-9340719 CCTTATAAGAAGAGGCGATGAGG + Intergenic
1186894880 X:13995736-13995758 CCTTATAAGAGGGAGGGAGGTGG - Intergenic
1186925384 X:14328249-14328271 CCTTATAAGCACATGGAAGCTGG - Intergenic
1187597454 X:20788798-20788820 CCTTATAAGAAGAGGATATTAGG + Intergenic
1187949306 X:24456229-24456251 CATTATAATAAGAGGGAAAAAGG - Intergenic
1188032884 X:25284106-25284128 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1188121069 X:26308587-26308609 CCTTATAGGAAGAGGAAATTTGG - Intergenic
1188384942 X:29544933-29544955 CCTTATAAGAAGATGAAATTAGG + Intronic
1188577552 X:31670762-31670784 TTTTATAAGAAGAGGAAAAGAGG - Intronic
1188646685 X:32577142-32577164 CCTTATGAGAAGAGGAAATTTGG + Intronic
1189108764 X:38265082-38265104 CCTTATAAAAAGAGGAAATGTGG + Intronic
1189211818 X:39290277-39290299 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1189249243 X:39587318-39587340 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1189288470 X:39868517-39868539 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1189388737 X:40558247-40558269 CCTTATAAGAAGGAGAAATGTGG - Intergenic
1189532674 X:41902464-41902486 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1189547552 X:42057331-42057353 CCTTATTAGAAGAGGAAGTGAGG - Intergenic
1189650817 X:43187733-43187755 CCTTATAAGTAGTGTGAAAGAGG + Intergenic
1190139889 X:47833550-47833572 CTTTATAAGAAGAGGAAGAGAGG + Intergenic
1190224369 X:48534029-48534051 CCTTATAAGAAGAGGGACACTGG - Intergenic
1190395206 X:49975440-49975462 CCTTATAGGAAGAGGGTAAATGG - Intronic
1190444492 X:50509892-50509914 CCTTATAAGAAGAGGGGATTTGG + Intergenic
1190636203 X:52436467-52436489 CCTTATAAGAAGAGGAAATGAGG - Intergenic
1190643611 X:52504370-52504392 CCTTACAAGAAGAGGAAATGAGG - Intergenic
1190792207 X:53710970-53710992 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1190962374 X:55265155-55265177 CCTCATAAATAGAGGGAAGAGGG + Intronic
1191755536 X:64588524-64588546 CCTTATAAAAAGAAGGCAGGAGG - Intergenic
1191767817 X:64719646-64719668 TCTTATAAGAATAGTGAAGGAGG - Intergenic
1192843340 X:74880384-74880406 GCCTAAGAGAAGAGGGAAGGAGG + Intronic
1193543595 X:82800469-82800491 CCTTATGAGAAGAGGAAATTTGG + Intergenic
1193758120 X:85433753-85433775 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1193988165 X:88272927-88272949 ACTGATAAGAAGAGGGAATGTGG - Intergenic
1193992355 X:88323609-88323631 TAGTATCAGAAGAGGGAAGGTGG - Intergenic
1194458318 X:94132492-94132514 CCTTATAAGAAGAGGCAATTAGG + Intergenic
1194794542 X:98194958-98194980 CCTTATAAAAAGAGGAAAATTGG - Intergenic
1194812038 X:98398919-98398941 CCCTATAAGAAGAGGAAGAGAGG + Intergenic
1194910185 X:99631758-99631780 GCTCATAAGAAGAAGGAAGATGG - Intergenic
1195174100 X:102297994-102298016 CTTTATAAGAAGAGGAAAATTGG + Intergenic
1195184765 X:102389099-102389121 CTTTATAAGAAGAGGAAAATTGG - Intronic
1195929606 X:110061439-110061461 CCTACTAAGAAGATGGAAGGAGG - Intronic
1196183625 X:112722106-112722128 CCTTATAAAAAGAGTTAGGGAGG - Intergenic
1196477618 X:116107121-116107143 TCTTATAAGAAGGAGGAATGTGG + Intergenic
1196654076 X:118198776-118198798 CCTTACAAGAAAAGGAAATGTGG + Intergenic
1196717019 X:118822013-118822035 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1197333436 X:125181700-125181722 CCACAGAAGGAGAGGGAAGGAGG + Intergenic
1197968131 X:132086537-132086559 CCTTATAAGAAGAAGAAATTTGG + Intronic
1198073367 X:133171164-133171186 CCTTATATGAAGAGGAGATGAGG - Intergenic
1198281769 X:135149681-135149703 CATTATAAGAAGAGGGATATTGG - Intergenic
1198286499 X:135196511-135196533 CCTTATATGAAGAGGGATATTGG - Intergenic
1198289190 X:135222841-135222863 CATTATAAGAAGAGGGATATTGG + Intergenic
1198512821 X:137371390-137371412 CCTTATAAGAAGAGGAAATGTGG - Intergenic
1198761522 X:140038066-140038088 ACTTATAAGAAGCAAGAAGGAGG + Intergenic
1198895076 X:141444692-141444714 CCTTTTAAGAAGAGGAAATTAGG - Intergenic
1198959298 X:142167364-142167386 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1199228940 X:145412223-145412245 CCTTATAAGGTGAAGGCAGGAGG - Intergenic
1199381613 X:147178741-147178763 CTTTGTAAGAACATGGAAGGGGG + Intergenic
1199383488 X:147197269-147197291 CCTTATAAGTAGGAGAAAGGCGG - Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199412137 X:147536372-147536394 CCTTATAAAAAGAGGGAATTTGG + Intergenic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199845758 X:151692173-151692195 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1199948757 X:152688640-152688662 CCTTATAAGAAGAGGACATTAGG + Intergenic
1199960919 X:152779809-152779831 CCTTATAAGAAGAGGACATTAGG - Intergenic
1200298712 X:154950064-154950086 CCTTATAAGAAGAGGAAATGTGG - Intronic
1200807697 Y:7449120-7449142 CCTTATAAGAACAGGAGATGAGG + Intergenic
1201231370 Y:11867942-11867964 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1201265920 Y:12206449-12206471 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1201293616 Y:12445744-12445766 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1201299835 Y:12496023-12496045 CCTCATAAGAAGAGGAGATGAGG - Intergenic
1201477178 Y:14395178-14395200 CCTTATAAGAAGAGAACATGAGG - Intergenic
1201625064 Y:16005829-16005851 CCTTATAAGAGGAAGGCAGTAGG + Intergenic
1201671212 Y:16522868-16522890 CCTTGTAAGAAGAGGACATGAGG + Intergenic
1201720611 Y:17093013-17093035 CCTTATAAGAAGAGACACAGGGG - Intergenic
1202105334 Y:21358021-21358043 CCTCATAAGATGAGTTAAGGAGG - Intergenic