ID: 1083792488

View in Genome Browser
Species Human (GRCh38)
Location 11:64994897-64994919
Sequence GTAGTGCAGCGGCTCTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100855
Summary {0: 1, 1: 3, 2: 254, 3: 7765, 4: 92832}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083792482_1083792488 21 Left 1083792482 11:64994853-64994875 CCTTTTTTTTTGAGACAGAGTCT 0: 222
1: 619
2: 1120
3: 1266
4: 1416
Right 1083792488 11:64994897-64994919 GTAGTGCAGCGGCTCTATCTTGG 0: 1
1: 3
2: 254
3: 7765
4: 92832

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083792488 Original CRISPR GTAGTGCAGCGGCTCTATCT TGG Intronic
Too many off-targets to display for this crispr