ID: 1083794541

View in Genome Browser
Species Human (GRCh38)
Location 11:65007527-65007549
Sequence CTGGCAGCTTACCCAAGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083794541_1083794545 13 Left 1083794541 11:65007527-65007549 CCTACACTTGGGTAAGCTGCCAG No data
Right 1083794545 11:65007563-65007585 GTGCCTCTGTCACAGGCATGTGG No data
1083794541_1083794544 6 Left 1083794541 11:65007527-65007549 CCTACACTTGGGTAAGCTGCCAG No data
Right 1083794544 11:65007556-65007578 CTTGCTGGTGCCTCTGTCACAGG No data
1083794541_1083794542 -9 Left 1083794541 11:65007527-65007549 CCTACACTTGGGTAAGCTGCCAG No data
Right 1083794542 11:65007541-65007563 AGCTGCCAGCACGTGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083794541 Original CRISPR CTGGCAGCTTACCCAAGTGT AGG (reversed) Intergenic
No off target data available for this crispr