ID: 1083794542

View in Genome Browser
Species Human (GRCh38)
Location 11:65007541-65007563
Sequence AGCTGCCAGCACGTGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083794537_1083794542 24 Left 1083794537 11:65007494-65007516 CCAGTTCTTTGCTTATTAATTAG No data
Right 1083794542 11:65007541-65007563 AGCTGCCAGCACGTGCTTGCTGG No data
1083794541_1083794542 -9 Left 1083794541 11:65007527-65007549 CCTACACTTGGGTAAGCTGCCAG No data
Right 1083794542 11:65007541-65007563 AGCTGCCAGCACGTGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083794542 Original CRISPR AGCTGCCAGCACGTGCTTGC TGG Intergenic