ID: 1083794543

View in Genome Browser
Species Human (GRCh38)
Location 11:65007546-65007568
Sequence AGGCACCAGCAAGCACGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083794543_1083794545 -6 Left 1083794543 11:65007546-65007568 CCAGCACGTGCTTGCTGGTGCCT No data
Right 1083794545 11:65007563-65007585 GTGCCTCTGTCACAGGCATGTGG No data
1083794543_1083794547 12 Left 1083794543 11:65007546-65007568 CCAGCACGTGCTTGCTGGTGCCT No data
Right 1083794547 11:65007581-65007603 TGTGGTCCAAAAAATAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083794543 Original CRISPR AGGCACCAGCAAGCACGTGC TGG (reversed) Intergenic