ID: 1083794545 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:65007563-65007585 |
| Sequence | GTGCCTCTGTCACAGGCATG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1083794543_1083794545 | -6 | Left | 1083794543 | 11:65007546-65007568 | CCAGCACGTGCTTGCTGGTGCCT | No data | ||
| Right | 1083794545 | 11:65007563-65007585 | GTGCCTCTGTCACAGGCATGTGG | No data | ||||
| 1083794541_1083794545 | 13 | Left | 1083794541 | 11:65007527-65007549 | CCTACACTTGGGTAAGCTGCCAG | No data | ||
| Right | 1083794545 | 11:65007563-65007585 | GTGCCTCTGTCACAGGCATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1083794545 | Original CRISPR | GTGCCTCTGTCACAGGCATG TGG | Intergenic | ||