ID: 1083794547 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:65007581-65007603 |
Sequence | TGTGGTCCAAAAAATAAGAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1083794543_1083794547 | 12 | Left | 1083794543 | 11:65007546-65007568 | CCAGCACGTGCTTGCTGGTGCCT | No data | ||
Right | 1083794547 | 11:65007581-65007603 | TGTGGTCCAAAAAATAAGACTGG | No data | ||||
1083794546_1083794547 | -8 | Left | 1083794546 | 11:65007566-65007588 | CCTCTGTCACAGGCATGTGGTCC | No data | ||
Right | 1083794547 | 11:65007581-65007603 | TGTGGTCCAAAAAATAAGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1083794547 | Original CRISPR | TGTGGTCCAAAAAATAAGAC TGG | Intergenic | ||