ID: 1083794551 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:65007608-65007630 |
Sequence | CTAGATTGTCTTATCAGAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1083794548_1083794551 | -2 | Left | 1083794548 | 11:65007587-65007609 | CCAAAAAATAAGACTGGCATCCT | No data | ||
Right | 1083794551 | 11:65007608-65007630 | CTAGATTGTCTTATCAGAGAGGG | No data | ||||
1083794546_1083794551 | 19 | Left | 1083794546 | 11:65007566-65007588 | CCTCTGTCACAGGCATGTGGTCC | No data | ||
Right | 1083794551 | 11:65007608-65007630 | CTAGATTGTCTTATCAGAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1083794551 | Original CRISPR | CTAGATTGTCTTATCAGAGA GGG | Intergenic | ||