ID: 1083797586

View in Genome Browser
Species Human (GRCh38)
Location 11:65026419-65026441
Sequence GAAGCTGCTGAGATGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 15, 2: 8, 3: 52, 4: 446}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083797586_1083797592 5 Left 1083797586 11:65026419-65026441 CCCTTTCCCATCTCAGCAGCTTC 0: 1
1: 15
2: 8
3: 52
4: 446
Right 1083797592 11:65026447-65026469 AATTGTCGATGGTTCTTTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 154
1083797586_1083797590 -6 Left 1083797586 11:65026419-65026441 CCCTTTCCCATCTCAGCAGCTTC 0: 1
1: 15
2: 8
3: 52
4: 446
Right 1083797590 11:65026436-65026458 AGCTTCCTCAAAATTGTCGATGG 0: 1
1: 0
2: 1
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083797586 Original CRISPR GAAGCTGCTGAGATGGGAAA GGG (reversed) Intronic
900107928 1:993396-993418 GAAGCTGGTTTGTTGGGAAAGGG - Intergenic
900421064 1:2556156-2556178 GCAGAAGCTGAGATGGGAACAGG + Intronic
901198625 1:7454185-7454207 GAAGCTGAGGAGAGAGGAAATGG + Intronic
902360629 1:15940970-15940992 GAAGCTGTGGAGTTGGGACAGGG + Intergenic
903213941 1:21832972-21832994 GAAGGAGCAGAGATGGGGAAAGG + Intronic
903692706 1:25185569-25185591 GGAGGTGCTGAGATGGGAACTGG - Intergenic
903828382 1:26160855-26160877 AAAGCTGCTGGGTTGGGAAGAGG + Intronic
903949472 1:26987211-26987233 GAGGCAGCTGAGATGGGACCAGG - Intergenic
904573809 1:31488802-31488824 GAGGCTGCTGAGATGGGAAAAGG - Intergenic
904875970 1:33654812-33654834 GAAGCCCCTGAGCTGGCAAAGGG - Intronic
904992067 1:34601028-34601050 GTAGATGCTGAGATGTAAAAAGG - Intergenic
905120696 1:35679610-35679632 GAAGCAGCTGTTATGGGGAATGG - Intergenic
905648855 1:39643250-39643272 GAAGCTGGAGAGATGGGCAGGGG - Intergenic
906250274 1:44305737-44305759 GAAGCTGCTGAGGGGAGAAGGGG + Intronic
907336879 1:53705483-53705505 GAAGCTGCAGAGAAGAGAGAAGG - Intronic
907710946 1:56880903-56880925 GATGTGGCAGAGATGGGAAATGG + Intronic
907770114 1:57453064-57453086 GGAGCTGATTACATGGGAAAGGG + Intronic
907779783 1:57555855-57555877 GAAGATTCTCAGCTGGGAAATGG - Intronic
909418440 1:75434215-75434237 GAAGCTGCAGGTAAGGGAAATGG - Intronic
909928740 1:81470381-81470403 GAATCTGTTGGGAAGGGAAATGG - Intronic
910338347 1:86157250-86157272 GGGACTGCTGAGATGGGGAATGG - Intergenic
910767910 1:90800982-90801004 GAAGATGCTGGGAAAGGAAAAGG + Intergenic
910854538 1:91682572-91682594 GACAGTGCTGAGATTGGAAAAGG - Exonic
911070217 1:93826392-93826414 CCAGCTGCTGTGATGGGGAAGGG - Intronic
911323940 1:96447062-96447084 GAGGCTGCTGAGATGGGAAAGGG + Intergenic
911402153 1:97388856-97388878 GAAGCTCTTGAGAAGGGAAGAGG + Intronic
912364968 1:109125905-109125927 GAAGCAGCTGAGAAGGGATTTGG - Intronic
912444854 1:109727459-109727481 GGAGCTTCTGAGACAGGAAAAGG + Intronic
912504349 1:110145792-110145814 GAAGGGGCTGAGATGGAAATGGG - Intergenic
913115377 1:115692047-115692069 GCAGCTGCAGGGCTGGGAAAGGG - Exonic
914442637 1:147720701-147720723 GCAGCAGCTGAGATGGTAATAGG + Intergenic
914877002 1:151519431-151519453 AAAGCTGATGAGAAGGGAGAAGG - Intronic
914950482 1:152109652-152109674 GCAGCTGCTGAGAGAGGAACAGG - Exonic
914950495 1:152109742-152109764 GCAGCTGCTGAGAGAGGAACCGG - Exonic
914950509 1:152109832-152109854 GCAGCTGCTGAGAGAGGAACGGG - Exonic
914950525 1:152109922-152109944 GCAGCTGCTGAGAGAGGAACCGG - Exonic
914950553 1:152110102-152110124 GCAGCTGCTGAGAGAGGAACGGG - Exonic
914950564 1:152110192-152110214 GCAGCTGCTGAGAGAGGAACGGG - Exonic
914950590 1:152110372-152110394 GCAGCTGCTGAGAGAGGAACGGG - Exonic
915694568 1:157726392-157726414 GAAGCTGCTTAGAGAGGAAGAGG - Intergenic
915884948 1:159712621-159712643 GGAGCTGGGGAGATGGGAGATGG + Exonic
917104080 1:171474772-171474794 GAAGCTGGAAAGATGGGTAAGGG + Intergenic
917324528 1:173818464-173818486 AAAGGAGGTGAGATGGGAAAAGG - Intronic
918107388 1:181426373-181426395 GAAGCGGTTGAGATGGGAAGGGG - Intronic
918107393 1:181426389-181426411 GAAGTGGCTGAGATGGGAAGCGG - Intronic
918107426 1:181426550-181426572 GAAGTGGTTGAGATGGGAAGGGG - Intronic
918107444 1:181426630-181426652 GAAGGGGTTGAGATGGGAAGGGG - Intronic
918107460 1:181426694-181426716 GAAGGGGTTGAGATGGGAAGGGG - Intronic
918107465 1:181426710-181426732 GAAGGGGTTGAGATGGGAAGGGG - Intronic
918107488 1:181426806-181426828 GAAGGAGTTGAGATGGGAAGGGG - Intronic
918107526 1:181426981-181427003 GAAGGGGCTGAGATGGGAAAGGG - Intronic
918107530 1:181426997-181427019 GAAGAAGCTGAGGTGGGAAGGGG - Intronic
918107536 1:181427029-181427051 GAAGGGGTTGAGATGGGAAGGGG - Intronic
918181422 1:182088255-182088277 GAAGGTGCTGACATCAGAAATGG - Intergenic
918209332 1:182337227-182337249 AAAGCCCCTGAGATGAGAAAGGG + Intergenic
918224738 1:182471283-182471305 CAAGATGATGAGATGGAAAAAGG + Intronic
918344301 1:183592925-183592947 GAAGGTGCAGACATGGGAGAGGG - Intronic
919012917 1:191988422-191988444 GCAGCTGCTGAGGTTGGAAGGGG - Intergenic
919188797 1:194189099-194189121 GAGGCTGCTGAGATGGGAAAGGG + Intergenic
919444721 1:197688892-197688914 AAGACTGCTGAGATGGGAAAGGG + Intronic
919581932 1:199387222-199387244 GAGGCTGCTGACATGGGAAAGGG + Intergenic
920371739 1:205483458-205483480 GGAGCTGCTGAGGTGGAGAAGGG + Intergenic
920686495 1:208113081-208113103 AAAGCAGCTGGGATAGGAAATGG + Intronic
921393729 1:214645675-214645697 AAAGCTGCAGAGTTTGGAAAAGG + Exonic
921544912 1:216463338-216463360 GGTGCTGCTGAAATGGGAGAGGG - Intergenic
922795952 1:228339926-228339948 GAAGCTGCTGTGAAGGGGGATGG - Exonic
922801514 1:228366774-228366796 GAAGCGGCTGGTATGGGCAAAGG - Intronic
924306832 1:242698247-242698269 GTAGGTGCTGAGTTGGGAAATGG + Intergenic
1062829223 10:594238-594260 GAAGCTGTGCAGATAGGAAAGGG - Intronic
1063184380 10:3637355-3637377 TGAGTTGCTGAGAAGGGAAAGGG + Intergenic
1063331031 10:5159648-5159670 GGAGGTGCTGAGTTGGGAAATGG - Intergenic
1063342061 10:5275265-5275287 GAAGCTGCTGTCCTGGGGAAAGG - Intergenic
1063853832 10:10224155-10224177 GAAGTTGATGAGATAGAAAAAGG + Intergenic
1064450439 10:15437378-15437400 AAAGCTGTTGAAATGGAAAAAGG + Intergenic
1067086991 10:43247728-43247750 GAAGCTGGTGGGTTGGGGAAGGG + Intronic
1067528155 10:47050768-47050790 GAAGCTGCTGAGATAGGGATAGG + Intergenic
1069298341 10:66875234-66875256 GAAGCTGCAGACATGAGGAAGGG + Intronic
1069621538 10:69840512-69840534 GAAGCTGCTGAGGTGGGGAGGGG - Intronic
1070543201 10:77432132-77432154 GAAGGTGCTCAGAAGGGGAAAGG - Intronic
1070594859 10:77825504-77825526 GAAGCTGCAGAGATAGTACAGGG - Intronic
1070820445 10:79351016-79351038 AAAGCTGCTGGGCTGGGTAAGGG + Intronic
1071233731 10:83619707-83619729 AAAGCTGCTTGGAGGGGAAATGG - Intergenic
1071811729 10:89189435-89189457 GCAACTGTTGAGATGGGAAATGG - Intergenic
1071911837 10:90245154-90245176 GAATCTCCTGAGATAGGTAATGG + Intergenic
1072439302 10:95439621-95439643 GAGCCTGCTTAGAGGGGAAAAGG + Intronic
1072505089 10:96057739-96057761 GAAGCTGTTGAGTTGGGGATGGG + Intronic
1073317432 10:102592890-102592912 TAACCTGCTGAGATGGGAGAGGG + Intronic
1073733920 10:106324149-106324171 GAAACTGCTGTGCTGTGAAAAGG + Intergenic
1074192445 10:111149601-111149623 AAGTCTGTTGAGATGGGAAAAGG + Intergenic
1074454069 10:113582186-113582208 GATGCTGCTCAGAGGGGAAGGGG - Intronic
1075572236 10:123554595-123554617 GAAGCTGAGGAGATGGCAATTGG + Intergenic
1075807795 10:125202538-125202560 GAAGCCTGTGAGATGGGAAGTGG - Intergenic
1076469375 10:130708040-130708062 GCAGCTCCTGAGATTGGAACAGG + Intergenic
1076743656 10:132501193-132501215 GAGGCTGGGGAGATGGGAATGGG + Intergenic
1076766601 10:132638264-132638286 GAGGCTGCTGTGATGGAAAGTGG - Intronic
1078020510 11:7652631-7652653 CCAGGTGCTGAGATGGGAAAGGG + Intronic
1078103090 11:8341356-8341378 GAAGCTGCTGGGATGGGGTGAGG - Intergenic
1078317248 11:10304106-10304128 CTACCTGCTGAAATGGGAAAAGG + Intergenic
1078354460 11:10623777-10623799 GAAGCAGCTGAGCAGGAAAAAGG - Exonic
1078501441 11:11882775-11882797 GAAAATGCTGACATTGGAAATGG - Intronic
1078532570 11:12148468-12148490 GAAGCTGGTGAGTTGGGAAGGGG + Intronic
1079061454 11:17252389-17252411 GGAGCTGGTGAGATTGGGAAGGG + Intronic
1079188691 11:18259723-18259745 GAAGCTGCAGAGAAGATAAATGG - Intergenic
1079786510 11:24679982-24680004 GAAGATGCTGACAGGAGAAAAGG + Intronic
1080168965 11:29275787-29275809 GAGACTGCTGAGATGGAAAAGGG + Intergenic
1080267657 11:30418320-30418342 GAAGTTCCTGGGATGGAAAAAGG - Intronic
1080290377 11:30664430-30664452 GAAGCTGTGGAGATAGGATAGGG - Intergenic
1081562049 11:44226688-44226710 CATGCTGCCCAGATGGGAAAGGG - Intronic
1081611590 11:44566234-44566256 GAAGCAGGTGAGGCGGGAAATGG - Intronic
1081671894 11:44947117-44947139 GAAGCTGCTGCTGTGGGCAAGGG + Intronic
1083797586 11:65026419-65026441 GAAGCTGCTGAGATGGGAAAGGG - Intronic
1084451057 11:69238913-69238935 GCTGCAGCTGTGATGGGAAAAGG - Intergenic
1084900702 11:72307895-72307917 GAAGATGCTGGGAGGGGAAGAGG + Intronic
1084942963 11:72623660-72623682 GATGTTTCTGAGATGGGCAAAGG - Intronic
1085231425 11:74974555-74974577 GTAGCTGTGGAGATGGTAAATGG - Intronic
1085478810 11:76805254-76805276 GAAGCTGCTCAGAGGGGAGGAGG + Intergenic
1086192826 11:84100438-84100460 GTAGCTGTGGAGATGGGAGATGG - Intronic
1086566868 11:88237032-88237054 GAAGCAGCAAAGAAGGGAAAAGG + Intergenic
1087175458 11:95091170-95091192 GAGGCTGGTGAGAGGGCAAAGGG - Intronic
1088466099 11:110140437-110140459 GAAGAAGCTGAAATGGGATATGG - Intronic
1089214922 11:116829611-116829633 GAGGCTGGTGAGAGGGGAAATGG - Intergenic
1089505158 11:118957688-118957710 GTGGCCGCTGAGATGGGAAAGGG - Intronic
1090190559 11:124763646-124763668 GAAGCAGCTGAGAGGGCATATGG - Intergenic
1090233432 11:125127190-125127212 AAAGCTGCTGGAATGGGAAATGG - Intergenic
1090769767 11:129909603-129909625 AGAGGTGCTGAGAAGGGAAAGGG - Intronic
1091463803 12:666281-666303 GATGCTTATGAGATGGGGAAAGG - Intergenic
1091568461 12:1663967-1663989 CAAGCTGCTGAGATGGACCATGG + Intergenic
1093264854 12:16990802-16990824 GAGGCTGCTTAGATGGGAAAGGG + Intergenic
1093466778 12:19457494-19457516 GAGGCTGCTGAGATGGGAAAGGG - Intronic
1094147266 12:27243981-27244003 GAGGCTGGTGAGAGGGGAAGTGG + Intronic
1097432335 12:59525968-59525990 GAAGCTGATATCATGGGAAATGG + Intergenic
1097438190 12:59576616-59576638 GAAGCTTCTGAGAGTGCAAATGG - Intergenic
1098206342 12:68114194-68114216 GAAGCTGTTTAGTTGAGAAAAGG + Intergenic
1098289621 12:68945453-68945475 TGAGCTGGGGAGATGGGAAAAGG + Intronic
1098509892 12:71299466-71299488 TCAGATGCTGAAATGGGAAATGG - Intronic
1098864018 12:75741672-75741694 GAAGCTGCTGGTCTGGGAATGGG - Intergenic
1099145038 12:79032139-79032161 GAGGATGCTGTGTTGGGAAAGGG + Intronic
1099349770 12:81550855-81550877 GAAGAATCTGAGATGGGAAGAGG + Intronic
1100679441 12:96902541-96902563 GAAGCTGCTGAGATGGAAAAGGG - Intergenic
1100685193 12:96979839-96979861 GAAGCTGCCGCGAGAGGAAATGG + Intergenic
1101492246 12:105220514-105220536 GAAGCTCCTGGGATCTGAAATGG - Intronic
1102116171 12:110404739-110404761 GTAGGGGATGAGATGGGAAAAGG - Intergenic
1102471308 12:113161411-113161433 GAAGCCCCTGGGATGGGAGAAGG + Intronic
1102817035 12:115874870-115874892 GAAGCTGTTGAGATGTTAGAGGG + Intergenic
1102917009 12:116761590-116761612 GAACCTGCTGAGATGAGCAATGG - Intronic
1103273658 12:119694137-119694159 GCAGCTGGTGGGATGGCAAATGG + Intronic
1103451308 12:121031339-121031361 GAAGCTGCAGCCAGGGGAAATGG - Intronic
1103461680 12:121109789-121109811 GCAGCTGCTGAGACAGGGAAAGG + Intergenic
1104989009 12:132614373-132614395 GAGGCTGCAGAGAGGGTAAAAGG + Intergenic
1106017594 13:25884237-25884259 AAAGCTGCTGTGATGGAGAAGGG - Intronic
1106098096 13:26668283-26668305 GAAAGTGCTGAGCTGGGAGAAGG - Intronic
1106276580 13:28214646-28214668 GAGGCTGCTGAGATGGGAAAGGG + Intronic
1107576099 13:41724439-41724461 GAAGCTGCTGATACAGGAGAGGG + Intronic
1108048283 13:46404029-46404051 GAAGCTGAGGGGAGGGGAAATGG - Intronic
1109243807 13:59927980-59928002 GAAGGAGAAGAGATGGGAAAAGG - Intronic
1112563488 13:100533357-100533379 AGAGCTGCTGATCTGGGAAAAGG + Intronic
1112598508 13:100832018-100832040 GAGGCTGCTGAGATGGGAAGAGG - Intergenic
1112807162 13:103175584-103175606 GCAGATGCTGACATGGGGAAGGG - Intergenic
1113019942 13:105873703-105873725 GAAGATAATAAGATGGGAAATGG - Intergenic
1113667971 13:112154074-112154096 GAAGCTTCTCAGATGGAGAAAGG - Intergenic
1113935131 13:113989844-113989866 GAAGCTGAGGAGATGGGAGATGG + Intronic
1114625179 14:24124220-24124242 GAAGCTTCTGAAATTGGTAAGGG - Exonic
1114708939 14:24757472-24757494 GAAGCTGCAGAGAAAAGAAAGGG + Intergenic
1114808403 14:25864816-25864838 GAAGCTCCTGAAATAGGAATAGG - Intergenic
1115283550 14:31691810-31691832 GAAGCTGCAGAGGTTGGTAAAGG - Intronic
1116078209 14:40140266-40140288 GGTGCAGCTAAGATGGGAAATGG + Intergenic
1116605517 14:46988472-46988494 GAAGCTGCTGACGTGGGGCATGG + Intronic
1117083893 14:52179921-52179943 GATGCTGATGAAAGGGGAAAGGG - Intergenic
1117610872 14:57482073-57482095 GAAGCTGCTGAATGGTGAAATGG + Intronic
1118025456 14:61763417-61763439 GAAGCTGGAGAGATAGGCAAAGG - Intronic
1118980657 14:70713674-70713696 GAGGCTGCTGAGGTGGGGACGGG - Intergenic
1119071852 14:71593873-71593895 GAAGATGCTGTGATAGGGAAGGG + Intronic
1119494404 14:75066233-75066255 GAAGCTACTGGGGAGGGAAATGG + Intronic
1119759958 14:77143265-77143287 AAAGCTGCTCTGAAGGGAAAAGG - Intronic
1120074587 14:80141115-80141137 GATGTTACTGACATGGGAAAGGG - Intergenic
1120325220 14:83015384-83015406 GAGGCTGGAGAGATGGAAAAGGG - Intergenic
1121516730 14:94557038-94557060 CAAACTGCGGAAATGGGAAAGGG - Intergenic
1121813630 14:96912852-96912874 CAAGCTGCTGTGACGAGAAAGGG + Intronic
1123886563 15:24733013-24733035 GAAGCTGGTGAAGTGGGAGATGG - Intergenic
1124047824 15:26166639-26166661 GAAGCTGGTGGGAGGGGAAAAGG - Intergenic
1124436188 15:29651629-29651651 GAGGGTGCTGAGCTGGGAAGAGG - Intergenic
1125525239 15:40370173-40370195 CAAGCTGCTGTGATGGGAAGCGG - Exonic
1126866090 15:52938365-52938387 GAGGCTGCTGAGATGGGAAAGGG - Intergenic
1128713849 15:69892767-69892789 GAATCACCTGAGATGGGAGAGGG + Intergenic
1131510647 15:93047871-93047893 CAAGCTGCTCTGATGGGGAAGGG + Intronic
1131824932 15:96312771-96312793 CCAGCTTCTGAGTTGGGAAAAGG + Intergenic
1132036300 15:98487515-98487537 AAAGTTGCTGAGTTGGGACAAGG - Intronic
1132384583 15:101390989-101391011 GAAGGTGCTGAGTTCGGAAGAGG - Intronic
1133043919 16:3075788-3075810 GAGGCTGCTGTGGTGGGAACAGG + Intronic
1134409081 16:13988383-13988405 GAAACTGCTGAAGTAGGAAAAGG + Intergenic
1135979336 16:27135025-27135047 GAGGCTGCTGAGATGGGAAAGGG - Intergenic
1136155964 16:28382367-28382389 GAAGTAGCAGCGATGGGAAAGGG - Intronic
1136207121 16:28732921-28732943 GAAGTAGCAGCGATGGGAAAGGG + Intronic
1137398041 16:48130973-48130995 AAACTTGCTGAGATGAGAAATGG + Intronic
1137408004 16:48205389-48205411 TAAGCTCCTGGGAGGGGAAAGGG - Intronic
1137811670 16:51358603-51358625 GAACCTGCTAAGATGTGAAAGGG + Intergenic
1137905584 16:52318801-52318823 GCAGCTGCTGAGTTGGGAATGGG - Intergenic
1138405506 16:56789556-56789578 GGATCTGCTGAGCTGGCAAATGG + Intronic
1140233182 16:73134743-73134765 GATGTTGATGAGATGGGAGAAGG - Intronic
1140239739 16:73190179-73190201 GAAGCTGCTGACATGTGTAATGG + Intergenic
1140533845 16:75691118-75691140 GAAGGAGAAGAGATGGGAAAAGG - Intronic
1141284632 16:82660143-82660165 GAAGCTGCTGAGAAAAGAGAGGG + Intronic
1142198825 16:88751385-88751407 GAAGCTGTTGAGAGTGGGAAGGG - Intronic
1142867320 17:2798731-2798753 GGAGAGGCTGAGATGGGAGATGG - Intronic
1143047649 17:4095063-4095085 GCAGCTGGAGAGCTGGGAAAGGG - Intronic
1143595565 17:7911710-7911732 GGAGCTGCAGAGAGGGGCAAAGG - Exonic
1143732238 17:8887694-8887716 GAAGATGGTGAGAAGGGGAATGG + Intronic
1144341066 17:14310669-14310691 GAGGCTGCTTAGCTAGGAAAAGG - Intronic
1144410073 17:14992254-14992276 GGAGGGACTGAGATGGGAAAGGG - Intergenic
1145964949 17:28910394-28910416 AAAGCAGCTGAGATGGGAAGTGG + Intronic
1146679680 17:34798024-34798046 GAAGCGCCTGAGATGGGGAAGGG - Intergenic
1146927161 17:36753130-36753152 GGAGCTGCTGAGATGAGATGGGG - Intergenic
1148201910 17:45755036-45755058 GAAGTGGCGGAGGTGGGAAAGGG - Intergenic
1148210316 17:45804628-45804650 GAAGGTCCTGAGATCCGAAAAGG + Intronic
1148484377 17:47981328-47981350 GAAGCTGGTGAGATGGGAAAGGG + Exonic
1149523819 17:57338829-57338851 GGGGCTGCCGAGATGGGGAAGGG + Intronic
1150437979 17:65168739-65168761 CCAGCAGCTGAGATGGGAGAAGG + Intronic
1150498539 17:65628214-65628236 GAAGCTGCTGAAATAGAAATGGG - Intronic
1150597232 17:66616855-66616877 GGAGCTGCTGTCATGGGCAATGG + Intronic
1150631372 17:66882690-66882712 GAAGATGCTTGGATGGAAAATGG + Intronic
1151135659 17:71943731-71943753 GAACCTGCTGAGGGAGGAAAAGG + Intergenic
1151462474 17:74262753-74262775 AATGCAGCTGAGATGAGAAAGGG - Intergenic
1151739535 17:75970615-75970637 GTAGCTGCTGAGAAGTGAAGGGG - Intronic
1152760078 17:82103206-82103228 GAAGAAGCTGAGATGGGAAGAGG - Intronic
1152817606 17:82417688-82417710 AAAGCAGCTGAGATGAAAAAGGG + Intronic
1154022329 18:10675550-10675572 CAAGCTGCAGAATTGGGAAAAGG - Intronic
1154321443 18:13356700-13356722 GAAGATGGTGTGACGGGAAAGGG - Intronic
1155207010 18:23567877-23567899 CAAGCTGATGAGGTGTGAAATGG + Intronic
1155300487 18:24424933-24424955 GAAGCTGCAGAAATATGAAAAGG + Intergenic
1156449466 18:37258842-37258864 CAACCTACTGAGAAGGGAAAGGG - Intronic
1157093195 18:44660670-44660692 GATGCTCATGAGCTGGGAAATGG + Intergenic
1158086492 18:53657477-53657499 GAAGCTATTGAGATGGGATCTGG + Intergenic
1159942594 18:74419952-74419974 CAAGCTGCTGAAATGGGCAGAGG - Intergenic
1160429373 18:78801047-78801069 GAATCTCCTGGCATGGGAAAGGG + Intergenic
1162200281 19:9015050-9015072 GACGCTGCTGAGTAGAGAAAAGG + Intergenic
1162902121 19:13801313-13801335 CAGGCTGCTGAGCTGGGGAATGG + Intronic
1164475540 19:28573149-28573171 GAAGCTGGAGAGATGGTCAAGGG - Intergenic
1164601508 19:29566429-29566451 GAAGCTGGTGTGATGGGCACGGG + Intergenic
1164601614 19:29566824-29566846 GAAGCTGGTGTGATGGGCACAGG + Intergenic
1164601784 19:29567452-29567474 GAAGCTGGTGTGATGGGCACAGG + Intergenic
1164601826 19:29567608-29567630 GAAGCTGGTGTGATGGGCACAGG + Intergenic
1164781529 19:30897110-30897132 GAATCTGCTGAGTGGGGAAGTGG - Intergenic
1165317814 19:35067209-35067231 GAAGCTGCCCAGATGGAGAAAGG - Intergenic
1165368096 19:35382304-35382326 AAGGCTGCTGAGATGGGAAAGGG + Intergenic
1165431545 19:35775989-35776011 GAAGGTGCTGGGATGGGAGCTGG - Intronic
1166905561 19:46106180-46106202 AAAGGTGCTGAGATAGGTAACGG + Intergenic
1167160995 19:47767006-47767028 AAAGCAGCTGAGATGGGGGAGGG - Intergenic
1167393247 19:49210738-49210760 GAAGCTGCTAACGTGGGAATCGG + Exonic
1168270274 19:55245969-55245991 GAAGCCGCTGAGAGGCAAAAGGG - Intronic
925906805 2:8544645-8544667 CTAGGTGCTGAGATGGGAAGAGG + Intergenic
926843491 2:17107871-17107893 GCTGGTGCTCAGATGGGAAATGG + Intergenic
927520770 2:23696725-23696747 GCAGTCGCTGAGATGGGAGATGG + Intronic
928102840 2:28449470-28449492 GAAGTTCCTGAGATGGTGAAGGG - Intergenic
928135556 2:28685030-28685052 GAACCTCCGGAGATGGGAGATGG - Intergenic
928436288 2:31256759-31256781 GAAGCTGCAGAGAAGGGAAGAGG - Intronic
928443348 2:31311861-31311883 TAAGCTGTGGAGGTGGGAAAGGG - Intergenic
928931211 2:36626220-36626242 TGAGCTACAGAGATGGGAAAAGG + Intronic
929065525 2:37969939-37969961 GAAACTGTTGAAAAGGGAAAGGG - Intronic
929394317 2:41505056-41505078 GAAGGTGCTGAAATGGGAGTTGG - Intergenic
930125258 2:47791265-47791287 AAAGCTTCTGGCATGGGAAAGGG + Intronic
931992896 2:67809143-67809165 CCAGCTGCAGAGGTGGGAAAGGG + Intergenic
932067619 2:68583150-68583172 AAAACTGATGAGATGGGAGAGGG - Intronic
932114978 2:69037912-69037934 GGAGCTGGGGAGATGGGGAAGGG - Intronic
932611516 2:73203262-73203284 CACGCTGCTGAGGTGGGAGAGGG + Intronic
935801241 2:106698522-106698544 GAGGCTGCTGAGATGGGAAAGGG - Intergenic
937625862 2:124043152-124043174 GAGACTGCTGGGTTGGGAAAAGG + Intronic
937642861 2:124233489-124233511 GAAGCTGGTGAAATAGGAAAGGG - Intronic
937963971 2:127486910-127486932 GAAGCTGAGGAGAGGAGAAAAGG - Intronic
938186073 2:129233093-129233115 AAAGCTGCTGAGAGGCGAATAGG + Intergenic
938555120 2:132416976-132416998 GACGCTGCTGGGAGGAGAAAGGG + Exonic
939132991 2:138259927-138259949 GAATATGCTGAGATGGGACTGGG + Intergenic
939297820 2:140292524-140292546 GAAGCTAAGGAGATGAGAAAGGG - Intronic
939326127 2:140690806-140690828 GAAGTTGCTAAGATAGGAAAAGG - Intronic
939441234 2:142252924-142252946 AGAGCTGATGAGATGTGAAATGG - Intergenic
939613086 2:144332784-144332806 GGTGCTGACGAGATGGGAAAGGG - Intergenic
942559181 2:177202178-177202200 GCAGCTGTGTAGATGGGAAATGG - Intergenic
942598656 2:177618269-177618291 GCAGCTGCTGAGTGGGGAAGGGG - Exonic
942651821 2:178177153-178177175 GCAGCTGGAGAGATGAGAAAAGG + Intergenic
944464878 2:199991163-199991185 GAGGGTGATGAGATGGGAACAGG - Intronic
945201322 2:207284700-207284722 GAAGCAGCTGAGCTTGGCAAAGG + Intergenic
946153142 2:217789645-217789667 AAGGCAGATGAGATGGGAAACGG + Intergenic
946201173 2:218071629-218071651 GAAAATGCTGAGATGGGGGATGG - Intronic
946402009 2:219473129-219473151 GGAGCTGCTGGGATGGGGAATGG + Intronic
946418210 2:219551124-219551146 GAACTTGCTGAGATGGGCAGAGG + Intronic
946722164 2:222620976-222620998 ACAGCTGCTGAGATGGAGAATGG + Intronic
946772115 2:223099630-223099652 CTGGCTGCTGGGATGGGAAAAGG + Intronic
946930365 2:224664502-224664524 GATGGAGCTCAGATGGGAAAAGG - Intergenic
947070738 2:226285434-226285456 GATACTTCAGAGATGGGAAATGG - Intergenic
947744335 2:232499887-232499909 GGGGGTGCTGAGGTGGGAAATGG + Intergenic
947869826 2:233428417-233428439 AAAGATGCTCACATGGGAAAGGG + Intronic
948377676 2:237532413-237532435 TAAGGGGCTGAGATGGGAGACGG + Intronic
948778248 2:240301150-240301172 GATGATGCAGAGATGGGAAGAGG - Intergenic
1168962091 20:1876863-1876885 AAAGCTGCTGAGCAGGGACAGGG - Intergenic
1168986881 20:2056549-2056571 GTACCTGCTAATATGGGAAAAGG + Intergenic
1169157942 20:3349651-3349673 AAAGCAGCTGGGATGGGGAATGG - Intronic
1169542744 20:6618191-6618213 TAAGCTGCTGAGATTTGAGATGG - Intergenic
1169981134 20:11385177-11385199 GAAACTGCTCAGATGGGGCAAGG - Intergenic
1170352163 20:15453664-15453686 GAAGGGGCTGAGGTGGGACAAGG + Intronic
1170710190 20:18783635-18783657 GTGGCTGCTCAGACGGGAAAGGG - Intergenic
1170928065 20:20743963-20743985 GAAACAGCTGACAAGGGAAAGGG - Intergenic
1171180748 20:23088816-23088838 GAAGCAGCTCAGATGTGGAATGG + Intergenic
1171273436 20:23834575-23834597 GAAGCTGGTGAGAAGGCAGATGG + Intergenic
1172500706 20:35424681-35424703 GAAGCTGCTCAAATGGGTAGAGG + Intergenic
1172872980 20:38147322-38147344 GAAGCTGCAGAGGTGGGCAGGGG - Intronic
1173117829 20:40263019-40263041 GAAGCTGTTGACTTCGGAAATGG - Intergenic
1173951759 20:46998924-46998946 GAGGTTGCTGGGGTGGGAAAGGG + Intronic
1174315228 20:49694626-49694648 GGCCCTGCTGAGAAGGGAAAGGG + Intronic
1174411510 20:50339620-50339642 GCAGCTGATGGGATGGGAAGAGG + Intergenic
1177091936 21:16780292-16780314 GTACCTGCTGAGATGGTACAAGG + Intergenic
1177874881 21:26619805-26619827 GAAACTCTTGAGATGGGCAAGGG - Intergenic
1178775947 21:35550842-35550864 GCAGCTGCAAAGGTGGGAAATGG - Intronic
1179541362 21:42085215-42085237 AAAGCTGCTGGGGTGGGAGAGGG - Intronic
1180905890 22:19411258-19411280 GGAGATGCTGAGATGGCAGACGG - Intronic
1181507683 22:23371430-23371452 GAAACTGATGAGAAGAGAAATGG - Intergenic
1181582298 22:23835037-23835059 GCACCTGCTGGGGTGGGAAAGGG - Intronic
1182702707 22:32253421-32253443 GAGGCTCCTCAGATGAGAAAGGG + Intronic
1183095309 22:35548477-35548499 GAAGTTGCTGAGCAGGGATAAGG + Intronic
1183634534 22:39052958-39052980 TATGCTGGGGAGATGGGAAAAGG - Exonic
1184087618 22:42274577-42274599 GAAGCTGCGGAGTTGGGCAAGGG + Intronic
1185201175 22:49506351-49506373 AAACCTGCTGAGCTGGGTAAAGG + Intronic
1185356050 22:50371378-50371400 GAACCAGCTGAGGTTGGAAATGG + Intronic
949887208 3:8705667-8705689 GAAGCAGAGGAGGTGGGAAAAGG - Intronic
950179239 3:10899550-10899572 CAAGAGGCTGAGAGGGGAAATGG - Intronic
950583132 3:13876038-13876060 GAAGATGCTGGGATGGCAACTGG + Intronic
951661166 3:25068253-25068275 GAAGCAGATGAAAGGGGAAAGGG - Intergenic
952619682 3:35322674-35322696 GGAGCTACAGAGATGGGAAAAGG + Intergenic
953072888 3:39540438-39540460 AAAGCTGGTGGAATGGGAAAGGG - Intergenic
953235484 3:41102806-41102828 GAAGCTGGTGGGATTGGAGAAGG - Intergenic
954412054 3:50375057-50375079 GAGGCTGCTGGGAGGGGAGATGG - Intronic
954413779 3:50383001-50383023 GATCATGCTGAGTTGGGAAAGGG + Intronic
954853603 3:53624453-53624475 GAAGGTGGTGGGATGGGCAAAGG - Intronic
955153559 3:56393057-56393079 GGAGCTGATGAGATGGGGAAGGG - Intronic
955567847 3:60268756-60268778 GAATATGCTTACATGGGAAAGGG + Intronic
955650916 3:61192962-61192984 GAAGTTTTTGAGATGCGAAAGGG - Intronic
955754178 3:62211336-62211358 GAGGCTGATGAAAGGGGAAATGG + Intronic
955799777 3:62673736-62673758 GCAGCTGATTTGATGGGAAATGG + Intronic
956584851 3:70853367-70853389 TTAACTGCTGAGCTGGGAAAAGG - Intergenic
956708256 3:72018068-72018090 CAAGCTGGTGAGATAAGAAATGG + Intergenic
956712148 3:72048295-72048317 GAGGATGTTGAGATGGGGAAGGG + Intergenic
956719975 3:72109071-72109093 GAATCTCCAGAGATGGGACAAGG + Intergenic
957482501 3:80816464-80816486 GCTGCTGCTGAGATGAGAGAAGG + Intergenic
959954863 3:112224932-112224954 GAAGGAGAAGAGATGGGAAAAGG + Intronic
960703312 3:120458360-120458382 GAAACAGCAGAGCTGGGAAAGGG + Intergenic
962408768 3:135122994-135123016 GAAGCTGCTGAGATGCCTCAGGG + Intronic
962463724 3:135638070-135638092 AAAGCTACTGAGATGGGAGTAGG - Intergenic
962971834 3:140408533-140408555 GAAGCTGCTGAGTTCCGTAATGG - Intronic
963526447 3:146421045-146421067 GAAGCAGCTGTGATGGGCCATGG + Intronic
964073585 3:152665545-152665567 GAAGGTGATGAGAGGGTAAATGG + Intergenic
965465829 3:169029602-169029624 GAATATGCTGAGAAGGGAGATGG - Intergenic
965627161 3:170692745-170692767 AAAGCTGCTGACATGAGAAAAGG - Intronic
966201285 3:177361518-177361540 GAAGCTGCTGAAGTGGGGAAGGG + Intergenic
967862749 3:194164529-194164551 GAATCTGCCCAGATTGGAAATGG + Intergenic
967942968 3:194780399-194780421 GAAGCTGCTCAGAGGTGAAGTGG - Intergenic
968082470 3:195856207-195856229 GAAGCTTCTGAGGTCGAAAAAGG - Intergenic
968951979 4:3700064-3700086 GAAGCTGCTGTGCTTGGAATGGG + Intergenic
969177955 4:5413760-5413782 GAGGCTGATCACATGGGAAACGG + Intronic
969268217 4:6080061-6080083 GATGCTGCTGAGCTGGGTCAGGG - Intronic
969410147 4:7022652-7022674 GAAGCTCATGGGATTGGAAATGG + Intronic
970209201 4:13690115-13690137 GCAGCTGCTCTGATGGGAAGTGG + Intergenic
973176167 4:47208324-47208346 GAGGCTGAAGAGATGGGGAATGG + Intronic
975609282 4:76188516-76188538 GAAACCTCTGAGATGGGGAAGGG - Intronic
977942081 4:102869452-102869474 GAAGGTGCTGAGTTGGGAACAGG + Intronic
980106234 4:128591353-128591375 AAAGGTGCGGAAATGGGAAAAGG - Intergenic
980602696 4:135045596-135045618 GAGGCTGCTGAGATGGGAAAGGG + Intergenic
981440472 4:144776486-144776508 GATGGGGATGAGATGGGAAAGGG + Intergenic
981531108 4:145754451-145754473 GAAGCAATTGGGATGGGAAATGG + Intronic
981849933 4:149218418-149218440 GAAGGTGCTGAGAGTGGATAGGG + Intergenic
982911782 4:161150957-161150979 GAAGCTGAAGAGATAGAAAATGG + Intergenic
983186579 4:164707311-164707333 GACCCTGCGGAGATGGGAAGAGG - Intergenic
986012424 5:3728223-3728245 GCAGCTGCTGAAATGACAAACGG - Intergenic
986076337 5:4341388-4341410 AAAGGTGCTGACATGGGCAAGGG - Intergenic
986296666 5:6445072-6445094 GAATCTTCTGAGATGGAAGAAGG + Intergenic
987040792 5:14060548-14060570 GAAGGACTTGAGATGGGAAAGGG + Intergenic
987107359 5:14653172-14653194 GAGACTGCTGAGATGGGAAAGGG - Intergenic
987797652 5:22650783-22650805 GAAACTACTAAGAAGGGAAATGG + Intronic
989173173 5:38493746-38493768 CAAGTTGTTGGGATGGGAAAGGG - Exonic
989353274 5:40513327-40513349 GAAGCTGAAGAGATCTGAAATGG - Intergenic
989511228 5:42289814-42289836 GGAGCTGATGAGATGAGAAGGGG - Intergenic
989718884 5:44501012-44501034 GAAGCTGCAGAGATAAGACATGG + Intergenic
989789680 5:45382046-45382068 ACAGCCGCTGAGATGGGAAGAGG - Intronic
991492569 5:67197176-67197198 GCACCTGCTGAGCTGGGAACTGG + Intergenic
991971814 5:72148665-72148687 GGAGATGTTGAGGTGGGAAAAGG + Intronic
992190495 5:74286852-74286874 GGAGTTGCTGAGAAGTGAAAGGG - Intergenic
993220012 5:85081981-85082003 GAAGCTAGTGATAGGGGAAATGG - Intergenic
993347304 5:86800219-86800241 CATCCTGCTGAGAGGGGAAAAGG + Intergenic
993638005 5:90369234-90369256 GAAGATGTTGAGAAGTGAAATGG + Intergenic
994169832 5:96646990-96647012 GAAGATGGTGAAATGGGAGATGG - Intronic
994188504 5:96841479-96841501 CAAGCTGCTGAGATGGAGCAGGG + Intronic
995093352 5:108207206-108207228 GAAACTGCAGATAAGGGAAAAGG + Intronic
995171209 5:109114828-109114850 GAAGCTGATGAGAGGGGGAGTGG - Intronic
996819302 5:127608423-127608445 GAAGCTGCTGAGACAGGTAAGGG - Intergenic
996944799 5:129054471-129054493 GAATGTGCTCAGTTGGGAAAGGG + Intergenic
997227401 5:132219426-132219448 TGGGCTGCTGACATGGGAAAGGG + Intronic
997316757 5:132942929-132942951 AAGGCTACTGTGATGGGAAAGGG + Intronic
997421284 5:133768769-133768791 GAAGCTTCTGTTATGGAAAAAGG + Intergenic
997434024 5:133861191-133861213 GAAGTTGCTCACATGAGAAAAGG + Intergenic
997613933 5:135233457-135233479 GAAGCTGGGGAGATGGAAGATGG + Intronic
997698548 5:135880353-135880375 GAAGCTGCTGGAAGGGGAAACGG - Intronic
998663615 5:144269141-144269163 GAAGGAGAAGAGATGGGAAAAGG + Intronic
999265568 5:150264817-150264839 GAGGCAGCAGAGATGGGAAAGGG - Intronic
999364492 5:151013172-151013194 GAACCTTTTGAGTTGGGAAAGGG + Intergenic
999498597 5:152124733-152124755 CCACCTGCTGAGATGGGAGAAGG - Intergenic
999547329 5:152644294-152644316 GGAACAGCTGAGAAGGGAAAGGG + Intergenic
999931878 5:156442370-156442392 AAAGGTCCAGAGATGGGAAATGG - Intronic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1001569792 5:172723052-172723074 GAAGCTGCAGATATGGAAAAGGG + Intergenic
1003733512 6:8852272-8852294 GAAACTGCTGAGTTAGGAAAGGG - Intergenic
1003874500 6:10423961-10423983 CCAGATGCTGAGATGCGAAAGGG - Intergenic
1004412951 6:15398736-15398758 GAAGCAGTGGAGATAGGAAAGGG + Intronic
1004521745 6:16367248-16367270 GAGGGGGCAGAGATGGGAAAGGG + Intronic
1004747619 6:18526999-18527021 GAAGCTAATGAGATTAGAAAAGG - Intergenic
1006791163 6:36702166-36702188 CAAGCTGCTGGGATAGGAAGGGG + Intronic
1007104603 6:39274838-39274860 GAACCTGCAGAGATGAGGAAAGG - Intergenic
1007282219 6:40721014-40721036 GCCACTGCTCAGATGGGAAAAGG + Intergenic
1008747963 6:54696200-54696222 AAAGCAGCTGTGATGAGAAAAGG + Intergenic
1009312202 6:62169609-62169631 GAAGCTCCCCATATGGGAAAGGG + Intronic
1011430895 6:87285438-87285460 TGAGCTGCTGATATGGGATATGG - Intronic
1011894003 6:92201280-92201302 TGAGCCACTGAGATGGGAAAAGG - Intergenic
1013831058 6:114273292-114273314 CCATCTACTGAGATGGGAAAAGG + Intronic
1014505354 6:122248103-122248125 GCAGATGCTTAGATGGGAAGAGG - Intergenic
1014634517 6:123828745-123828767 GAAGCTCCTGAGATGAGAGAGGG - Intronic
1015020005 6:128461785-128461807 AAATCTGCAGAGATGGGAAGTGG - Intronic
1015355410 6:132272106-132272128 AAGTCTGCTGAGATGGGAAAGGG + Intergenic
1015653350 6:135488747-135488769 GAACAGGCTGAGATGAGAAATGG - Intronic
1016284037 6:142452628-142452650 GAAGCTGTGGAGAAGGGAAGGGG + Intergenic
1016357642 6:143235515-143235537 GAAGCTTCTGGAATGGAAAATGG + Intronic
1016844397 6:148556688-148556710 GTGGCTGTTGAGATGGGAGAGGG - Intergenic
1016984844 6:149887376-149887398 GAATATGCTGAGATAGGAAGGGG - Intronic
1017951491 6:159138624-159138646 GAAGATGCTGGGATGGGAGTAGG + Intergenic
1018065023 6:160118717-160118739 GCAGGTGCTGGGATGGGAGAGGG + Intergenic
1018123987 6:160664438-160664460 GGAGCAGCTGAGGGGGGAAATGG - Intergenic
1018229924 6:161665828-161665850 GGGGCTGCTGAGAGGGTAAAGGG - Intronic
1020265262 7:6556296-6556318 GAAGCTGCAGAGTTGGGGACTGG + Intergenic
1020983123 7:15096654-15096676 CAAGAGGCTGAGATGGGAGAAGG + Intergenic
1021616989 7:22511845-22511867 GAGGCTGCTGAGATGGGAAAGGG - Intronic
1021619543 7:22537680-22537702 CCATCTGCTGAGATGGGCAATGG - Intronic
1021678056 7:23100815-23100837 AAAGCTGCTGAGTGTGGAAAGGG + Intergenic
1024632436 7:51260993-51261015 GAAGCAGGAGAGATGGGCAATGG - Intronic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1028259078 7:88639145-88639167 GAGGCTGCTGAGATGGGAACGGG + Intergenic
1028422025 7:90643817-90643839 GAGGCTGTTGAGATGTGAACAGG - Intronic
1029957775 7:104657729-104657751 GAAGCTCCAGAGATGGAAGATGG - Intronic
1030343570 7:108408446-108408468 CAAGCTGCTGAGCTGGGCACAGG + Intronic
1031532331 7:122889709-122889731 AAAGCTGATGAGATGGACAAAGG + Intergenic
1031720075 7:125163425-125163447 CAAGACGCTGAGATGGGAAAGGG - Intergenic
1032176687 7:129635197-129635219 TAATCTTCAGAGATGGGAAAAGG + Intronic
1033403564 7:141050509-141050531 TGAGCTACAGAGATGGGAAAAGG + Intergenic
1033484752 7:141777542-141777564 GTACTTGCTCAGATGGGAAATGG - Intronic
1034260081 7:149749750-149749772 GGGACTGCTGTGATGGGAAAAGG - Intergenic
1037076174 8:14721672-14721694 AAAGTTGCTGAAATAGGAAAAGG - Intronic
1037327927 8:17712841-17712863 TAGGCTGCTGAACTGGGAAAAGG + Intronic
1037421307 8:18706030-18706052 AAAGCTGCTGGAATGGGACATGG - Intronic
1037781417 8:21871754-21871776 CAAACTGCAGAGATGGGAGAGGG + Intergenic
1038164057 8:25067748-25067770 GCAGCTGCTGAGATGGGGGCCGG - Intergenic
1039971372 8:42324221-42324243 GAAGCTGCTGAGGTAGGCAAGGG + Intronic
1040338208 8:46426887-46426909 GGGGCTTCTGAGATGGGAGAGGG - Intergenic
1040517710 8:48148145-48148167 GCAGCAGGTGAAATGGGAAAGGG - Intergenic
1041184615 8:55286256-55286278 GAAGATGGTGAGATGGGAGTTGG + Intronic
1041911607 8:63094959-63094981 GTATCTCCTGAGATGGGCAAAGG - Intergenic
1042358161 8:67852588-67852610 GAGGCTGCTGTTATGGAAAATGG + Intergenic
1042669945 8:71250401-71250423 GGAGCTGCGGAACTGGGAAAGGG - Intronic
1043169272 8:76944373-76944395 GAAGATACTGAGATGTGGAAGGG - Intergenic
1044729808 8:95220721-95220743 GAAAGGGCTGAGAAGGGAAATGG - Intergenic
1045417074 8:101978024-101978046 GAAGCTGCTGAGAGGGGACAAGG - Intronic
1046978138 8:120306315-120306337 GAAGCAGCAGAGATGTGAAAGGG + Intronic
1047106884 8:121741995-121742017 GAAGTTGCTGGGAAAGGAAATGG + Intergenic
1048292532 8:133191664-133191686 GATGCTGCGAAGATGGGAGATGG + Intronic
1049123513 8:140763181-140763203 GAAGCTCCTGAAAGGGGACATGG + Intronic
1050319374 9:4435462-4435484 GGAGATGCGGAGAAGGGAAAGGG - Intergenic
1050431589 9:5568037-5568059 GAAACCACTGAAATGGGAAAGGG - Intronic
1050566365 9:6888661-6888683 GAAGCAGCTGATATGAAAAAAGG + Intronic
1051253055 9:15181560-15181582 GAAGCAGCTGATGTGGTAAAAGG - Intronic
1052212233 9:25919004-25919026 GAAGCAGCTTATATGGGAACAGG + Intergenic
1052268107 9:26597196-26597218 CAAGCAGATGAGATGGGAAATGG - Intergenic
1052396964 9:27950063-27950085 GAGGCTGCGGAGGTGGGAGAGGG + Exonic
1052610961 9:30773583-30773605 GAAGCTGCTGGAGTGGGACACGG - Intergenic
1052741793 9:32400344-32400366 TATCCTGCTGAGATTGGAAAGGG + Intronic
1053150082 9:35737715-35737737 GATGGTGGAGAGATGGGAAAAGG + Intronic
1053351309 9:37415065-37415087 GCAGCAGCTGAGATGGGCAGTGG - Intergenic
1053362208 9:37496445-37496467 GAAGCTGTTTTAATGGGAAAGGG - Intronic
1055220382 9:73922416-73922438 GAATTTGCTGAAATGGGACAAGG - Intergenic
1055860970 9:80748499-80748521 GACGCTGCAGAGATGGGATGGGG + Intergenic
1055973089 9:81930860-81930882 GAAGCTGTTGGGGTGGGGAATGG - Intergenic
1055974842 9:81945952-81945974 GAAGCTGTTGGGGTGGGGAATGG - Intergenic
1055977359 9:81968265-81968287 CAAGCTGTTGGTATGGGAAATGG - Intergenic
1055979885 9:81991178-81991200 GAAGCTGTTGGGGTGGGGAATGG - Exonic
1058622198 9:106895420-106895442 GCAGCTGCTGAGATGGTCCAGGG - Intronic
1058623321 9:106906201-106906223 CCAGCTGCAGAAATGGGAAAGGG - Intronic
1059773685 9:117452852-117452874 GGAGCTACTGAAATGTGAAAGGG + Intergenic
1060247448 9:121958387-121958409 GAAGGTGGTTATATGGGAAAGGG - Intronic
1060281161 9:122216599-122216621 GGAGCTGCTAGGATAGGAAATGG + Intronic
1060600067 9:124871318-124871340 GAAGATGCTGAGTTGTGAAAGGG - Intronic
1061237902 9:129352714-129352736 GGAGCTGCTGAGAGGGGAAGTGG + Intergenic
1061255791 9:129453736-129453758 GAAGATGGAGAGATGGGGAATGG + Intergenic
1061784651 9:133019618-133019640 GAGGCTGCTGAGATGGGAAAGGG + Intergenic
1061973980 9:134059216-134059238 GAAGCTGCTCAGAGGGAAGAGGG + Intronic
1185931704 X:4211010-4211032 GAAGATGCTGAGATCGTAGAGGG - Intergenic
1187299828 X:18037456-18037478 GAGGCTGCTGAGATGGCAGCAGG - Intergenic
1187464090 X:19513680-19513702 AAAGCTGATGAGATAGGATATGG - Intronic
1188740065 X:33767263-33767285 GAAGCTTTTAAGATGGTAAAAGG + Intergenic
1188930213 X:36100019-36100041 GGAACTGCTGAGATGTGAGAGGG + Intronic
1189797918 X:44663567-44663589 GTAGCTACTGGGATGGGAGAGGG - Intergenic
1189928557 X:45983501-45983523 GAAGCTGGTGAAGTGGGACACGG - Intergenic
1191227127 X:58055108-58055130 GATGCTGTTGTGATGGGAAAGGG - Intergenic
1191654843 X:63585560-63585582 GTTGCTTCAGAGATGGGAAAGGG - Intergenic
1192266421 X:69541408-69541430 GAAGCAGCAAAGATGGTAAAGGG + Intergenic
1192434058 X:71131766-71131788 GGAGCTGATGATAAGGGAAATGG + Intronic
1192494306 X:71604771-71604793 GAAGTTGCTGAAATGGCACAGGG - Intronic
1194584508 X:95716365-95716387 GAAACTGCTGAGATAAGAAAGGG + Intergenic
1194811240 X:98389624-98389646 GACGCTGCTGAGATGGGAAAGGG + Intergenic
1196882641 X:120212563-120212585 AAGGCTGCTGAGATAGGAAAGGG - Intergenic
1196992160 X:121341941-121341963 GAAGAGGCTGAAATGGGAAGTGG + Intergenic
1197176695 X:123493707-123493729 AAAGCTGCTGACATGGGGAGAGG - Intergenic
1197244204 X:124151344-124151366 TGAGCTACAGAGATGGGAAAAGG + Intronic
1197518801 X:127472508-127472530 CAAACTGCTGAAGTGGGAAAGGG + Intergenic
1198175019 X:134146416-134146438 GAAGCTGAGGAGCTGGGGAAGGG - Intergenic
1198715896 X:139557917-139557939 GAAGGTGGTGAGAAGTGAAATGG - Intronic
1199481990 X:148307850-148307872 GAAGCTGCTCAGCTAGGAAGGGG - Intergenic
1200002532 X:153069409-153069431 GAAGAAGCTGAGAAAGGAAATGG + Intergenic
1200005192 X:153080601-153080623 GAAGAAGCTGAGAAAGGAAATGG - Intergenic
1200295826 X:154918949-154918971 GAACCTGCTGAGATGGGAAAGGG - Intronic
1201306137 Y:12552184-12552206 GAAGATGCTAACATGGAAAATGG - Intergenic