ID: 1083799382

View in Genome Browser
Species Human (GRCh38)
Location 11:65037772-65037794
Sequence CTCCCTGAGCAATACATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083799378_1083799382 0 Left 1083799378 11:65037749-65037771 CCCAGGTACTCTTCTGCTCTCTG 0: 1
1: 0
2: 3
3: 25
4: 284
Right 1083799382 11:65037772-65037794 CTCCCTGAGCAATACATGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 122
1083799376_1083799382 23 Left 1083799376 11:65037726-65037748 CCTTAACTCGAGTGTGCAGGTGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1083799382 11:65037772-65037794 CTCCCTGAGCAATACATGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 122
1083799379_1083799382 -1 Left 1083799379 11:65037750-65037772 CCAGGTACTCTTCTGCTCTCTGC 0: 1
1: 0
2: 3
3: 22
4: 330
Right 1083799382 11:65037772-65037794 CTCCCTGAGCAATACATGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083799382 Original CRISPR CTCCCTGAGCAATACATGGA GGG Intronic
905840198 1:41170093-41170115 CCCCAGGAGCAATACATAGAAGG - Intronic
913174037 1:116257493-116257515 CTCCCTGAGCAATACAACCCTGG - Intergenic
915428077 1:155843695-155843717 CTCCAGGACCAATACATGCAAGG + Intronic
922944004 1:229494791-229494813 CTCCCTGAGCAACAGAAAGAGGG + Intronic
923217274 1:231859902-231859924 CTGCTGGAACAATACATGGATGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924262521 1:242246876-242246898 ATCACAGATCAATACATGGAAGG + Intronic
1063095729 10:2907362-2907384 CTCTCAGAGCAAAACGTGGAAGG - Intergenic
1071909340 10:90213158-90213180 GTCCCTGAACAAGACTTGGAAGG - Intergenic
1073233751 10:101995293-101995315 CTACCTCTGCAATACATGTAAGG + Exonic
1073710471 10:106031555-106031577 TTCACTGAGTAATAAATGGAAGG - Intergenic
1074676264 10:115854857-115854879 CTCCCAGAACAAAGCATGGAGGG - Intronic
1075397014 10:122134709-122134731 CTCCCTTAGCAAAGCCTGGAAGG + Intronic
1083799382 11:65037772-65037794 CTCCCTGAGCAATACATGGAGGG + Intronic
1085160953 11:74344273-74344295 CTCCCTGAGTAATCAATGAAAGG + Intronic
1094645454 12:32319202-32319224 CACCCAGAGCAAAACAAGGATGG - Intronic
1097709830 12:62905816-62905838 CTCCATTAGTAAGACATGGAAGG - Intronic
1099949462 12:89284860-89284882 CTGTCTGAGGAATAAATGGAAGG - Intergenic
1102433045 12:112898466-112898488 CTCCCTGCACAATTCATGGGAGG + Exonic
1105605907 13:21926402-21926424 CACCCTGAGCAGTGCATGGAAGG + Intergenic
1107531122 13:41283222-41283244 CCACCTGAGGAATACAAGGAAGG - Intergenic
1112730217 13:102352367-102352389 CTCCTTGAGGAAAACATGGGGGG + Intronic
1113901707 13:113801502-113801524 CTCCCAGAGCAGTGCAGGGATGG + Intronic
1113964284 13:114143985-114144007 CACTCTGAGAAATACATGGCTGG - Intergenic
1117101810 14:52356075-52356097 CTCACTGAGCCAAACATGAATGG + Intergenic
1119091787 14:71789637-71789659 CTGCCTGAGGACTGCATGGAGGG - Intergenic
1121893574 14:97622768-97622790 TGCCCTGATAAATACATGGAAGG + Intergenic
1124655350 15:31502804-31502826 GTCCCTGAGCCACACAGGGAAGG + Intronic
1127335282 15:57978648-57978670 GTCCCTGTGCAGTACTTGGAGGG + Intronic
1128182835 15:65619993-65620015 GGCCCTGAGCTACACATGGATGG - Intronic
1129599529 15:76990331-76990353 TTTCCTGACCAATAAATGGATGG - Intergenic
1131635972 15:94233400-94233422 CTCTCTGTGTTATACATGGAAGG + Intronic
1136251501 16:29008521-29008543 ATCCCTGAGAAAGACAGGGAGGG + Intergenic
1137711747 16:50571563-50571585 CTCTCTGAGCAACAGATGAATGG - Intronic
1139692393 16:68649641-68649663 GTCCCTGTGCAGTACTTGGAGGG + Intronic
1140641018 16:76973055-76973077 CTCTCTCAGCAATAAAAGGAGGG - Intergenic
1142160090 16:88552855-88552877 CTCCCTGAGCCCTGCAGGGAGGG + Intergenic
1146716788 17:35092840-35092862 CTCCCTAAGAAATCAATGGAAGG + Intronic
1151782311 17:76255527-76255549 ATCCCTGAGCAATGCATTGTGGG + Intergenic
1155989432 18:32264450-32264472 CTCCCTGAGAAGTCCAGGGATGG - Intronic
1156370371 18:36467372-36467394 CTCCCTCAGGAATACAGGGTTGG - Intronic
1160596790 18:79981143-79981165 GTCCCTGAGCAAGGCATTGAAGG - Intronic
1162192097 19:8955022-8955044 CTCCCTGAGCCCTAAATTGAGGG - Exonic
1162718181 19:12646977-12646999 CTCCCAGAACTAGACATGGATGG + Intronic
1163223347 19:15937306-15937328 CTCCCTGAGCCTAACAGGGATGG - Intergenic
1167714886 19:51136907-51136929 CTCACTGAGATCTACATGGAAGG + Intergenic
1167986390 19:53320950-53320972 AAGCCTGAGCAAGACATGGAGGG - Intergenic
927172254 2:20379924-20379946 GTCCCTGAGAGAGACATGGATGG - Intergenic
929063585 2:37949196-37949218 CTACATGAGCCATACATGTAAGG + Intronic
929615503 2:43304104-43304126 CTCTCTGAGCACTAGATGAAGGG - Intronic
934980277 2:98833744-98833766 CTGCCTGAACAATAGGTGGAAGG + Intronic
937278830 2:120703665-120703687 CTCCTTGAGCATTAAAGGGAAGG - Intergenic
938304855 2:130246184-130246206 CTGCCTGAGCAAAACCAGGAGGG - Intergenic
938449157 2:131401016-131401038 CTGCCTGAGCAAAACCAGGAGGG + Intergenic
939549911 2:143602427-143602449 CTCCCTGGGAAATGCAAGGAGGG + Intronic
946773330 2:223111881-223111903 CTGCCTGAGAAATCCAGGGAAGG + Intronic
947156815 2:227170965-227170987 ATCCCACAGCAATACAAGGATGG - Intronic
948408178 2:237738524-237738546 CTTCCTGAGCAAGGCATGGTGGG - Intronic
1171254593 20:23679864-23679886 ATCCCTGAGCAAGACAGAGACGG + Intergenic
1172994578 20:39060587-39060609 CTCCCTGCACAATACATCGTGGG - Intergenic
1174213636 20:48899424-48899446 CTCACTGAGAAAAAAATGGAAGG - Intergenic
1174516349 20:51095319-51095341 GTCCCTGAGGAATACAAGAAGGG - Intergenic
1175990849 20:62788203-62788225 CTCCATGAGGACAACATGGAAGG - Intergenic
1176135228 20:63519628-63519650 GCCCCTGAGCAAGACTTGGAGGG - Intergenic
1176258987 20:64169119-64169141 GTCCCTGAGGGAGACATGGAGGG - Intronic
1177776858 21:25577533-25577555 ATCCCTGAGCATTACAGAGAAGG - Intergenic
1178151689 21:29802018-29802040 CTCCCTGAGGCAAAAATGGATGG + Intronic
1178583848 21:33857099-33857121 GTCCCTGAGCAGTTGATGGATGG + Intronic
1178989301 21:37339161-37339183 ATCCCTAAGCAGTGCATGGATGG - Intergenic
1180716486 22:17876069-17876091 CTCTCTGAGCACTAAGTGGAAGG - Intronic
1181821184 22:25476986-25477008 CTCCCTGGGCAACTCATGTAGGG - Intergenic
1184296411 22:43528032-43528054 ATCCCTGAGCAAGACAGCGATGG + Intergenic
950113215 3:10433718-10433740 CACCTTCAGCAATCCATGGAAGG + Intronic
950156502 3:10725093-10725115 ATCCCTGAGCAAGTCATGCAAGG + Intergenic
950551479 3:13668790-13668812 CTCCCTGAGGAAGCCATGGTAGG - Intergenic
950702717 3:14761291-14761313 CTCCCTGGGCAACTCAGGGAGGG + Intronic
952805771 3:37350086-37350108 CTCCCTAAGGAATACCTGGCAGG + Intronic
954892471 3:53943795-53943817 CTCTCTGAGCAGTATAAGGATGG - Intergenic
956306172 3:67828863-67828885 CTCCCTGAGAAATTCCTGTAGGG - Intergenic
961285323 3:125797723-125797745 TTCCCAGAGCAATACATGACAGG - Intergenic
965132653 3:164721835-164721857 TTCCCAGAGGAAAACATGGAGGG - Intergenic
969888756 4:10240289-10240311 CTCCCTGACCGCCACATGGACGG - Intergenic
970202181 4:13621106-13621128 CTCCCTGAGGGGAACATGGAGGG + Intronic
973942693 4:55926430-55926452 CTCCATCAGCAATTCAGGGAGGG - Intergenic
975056379 4:69936447-69936469 ATCCCTAAGGAATACATGAATGG + Exonic
975184781 4:71388743-71388765 CACCCTGAGCAACACAGTGAGGG - Intronic
975190849 4:71460397-71460419 CTGGATGAGCAAGACATGGAGGG - Intronic
975948924 4:79744234-79744256 GTACATGAGGAATACATGGAAGG - Intergenic
978310691 4:107382275-107382297 CTCCCTGAGCAATTCACTCAGGG - Intergenic
979730634 4:124018756-124018778 TTCCCTAAGCAATACAATGAGGG - Intergenic
980178988 4:129381359-129381381 CTCTCTGATCAACACGTGGAGGG + Intergenic
982383689 4:154777285-154777307 CTCTCTTAGCACTCCATGGATGG - Intergenic
983330631 4:166323186-166323208 CTCCCTTATCAATACATAGAGGG + Intergenic
985278134 4:188258757-188258779 CTACCTGAGGGATACATGGAAGG - Intergenic
986015099 5:3750820-3750842 CTCACTGAACAATACTTTGAGGG - Intergenic
990879926 5:60527887-60527909 CACCCTGAGCAATAGAAGAATGG + Intergenic
990906354 5:60807399-60807421 CTCACTGAGCAATAGTTTGAGGG - Intronic
995903981 5:117101215-117101237 CTCTATGAGCAACTCATGGATGG + Intergenic
998030781 5:138865916-138865938 CTCGCTGTCAAATACATGGAGGG - Intronic
998381755 5:141730713-141730735 CTTTCTGAGCAATGCATGAAGGG + Intergenic
1004079167 6:12374054-12374076 CTGCCTCAGTCATACATGGATGG - Intergenic
1007982774 6:46176087-46176109 CTCCCTGCCCAATTCCTGGATGG + Intergenic
1013982914 6:116154677-116154699 CTCCCTGAGAAATATTTGGATGG + Intronic
1017721999 6:157249885-157249907 CTCCCTTTGGAATACACGGAAGG + Intergenic
1019814472 7:3189531-3189553 CTCCCAGAGCCATACAAAGAGGG - Intergenic
1019919040 7:4151143-4151165 GTCCCTGAGCAGTCCAAGGAGGG + Intronic
1020434307 7:8146296-8146318 CTCCCTGAGCTTCACATGGCTGG - Intronic
1022557016 7:31308376-31308398 CTACCTCAGCAGTACATGGCTGG - Intergenic
1028909667 7:96194018-96194040 CTCACTGTGCACTATATGGAAGG + Intronic
1032650591 7:133873890-133873912 TTCCCTGGGCAGTACATGGGTGG + Intronic
1033563099 7:142552911-142552933 CTCCCTGAGCCATGGCTGGAGGG + Intergenic
1034825182 7:154255664-154255686 CTCCCTGACTAGTACATGGTCGG + Intronic
1037053027 8:14401059-14401081 CTCCCTGTGTAATTAATGGAAGG + Intronic
1040708336 8:50156401-50156423 CTCATTGAGCAATACATAAAAGG + Intronic
1049576708 8:143393071-143393093 CAGCCTGAGCAATTCATGGCTGG - Intergenic
1050064827 9:1748616-1748638 CTCCTTGAGCAATATAATGAAGG - Intergenic
1050797936 9:9568594-9568616 CTCACTGAGTCATACATGTATGG + Intronic
1052953677 9:34234959-34234981 CTTCAGGAGCAATACATGCATGG - Intronic
1053528912 9:38858534-38858556 CTGACTGAGCAATACCTGGAAGG - Intergenic
1054201140 9:62082969-62082991 CTGACTGAGCAATACCTGGAAGG - Intergenic
1054637219 9:67505395-67505417 CTGACTGAGCAATACCTGGAAGG + Intergenic
1055696866 9:78894401-78894423 TTACCTGTGCAAGACATGGAAGG - Intergenic
1057176626 9:93004861-93004883 CTCCCTGAGCAACAGGTGAAGGG - Intronic
1061544745 9:131298270-131298292 CTCCCTGGGCAGTATATGGCTGG + Intronic
1203777568 EBV:82200-82222 CTCCCTCAGCAACCGATGGAGGG + Intergenic
1186389946 X:9148798-9148820 CTTCCCGAGCAAAACAAGGAAGG - Intronic
1186841754 X:13491654-13491676 ATCCCAAAGCAATACCTGGAGGG + Intergenic
1187458100 X:19460649-19460671 GTCCCTGAGCAATACAAGATGGG + Intronic
1191673098 X:63767222-63767244 CTGCCTAAACAATACGTGGATGG + Intronic
1195369930 X:104163661-104163683 CTCACTGAGAAATATATGGAGGG + Intergenic
1202257824 Y:22939690-22939712 CTCCCTTAGCCACACAAGGAAGG - Intergenic