ID: 1083800533

View in Genome Browser
Species Human (GRCh38)
Location 11:65044070-65044092
Sequence AGCCAAAGGCTGGCCCTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083800524_1083800533 13 Left 1083800524 11:65044034-65044056 CCTGAGGCCACTCATTCAAATAT 0: 1
1: 0
2: 0
3: 17
4: 249
Right 1083800533 11:65044070-65044092 AGCCAAAGGCTGGCCCTTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 107
1083800526_1083800533 6 Left 1083800526 11:65044041-65044063 CCACTCATTCAAATATAGGTTGG 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1083800533 11:65044070-65044092 AGCCAAAGGCTGGCCCTTAGAGG 0: 1
1: 0
2: 1
3: 19
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083800533 Original CRISPR AGCCAAAGGCTGGCCCTTAG AGG Intronic
900397853 1:2460540-2460562 AGCCAAAGGCAGGGGCTTAGTGG + Intronic
902698456 1:18155792-18155814 AGACAAAGGCTGGGCCTTCCAGG + Intronic
905785221 1:40750245-40750267 AGCCAAGCCCTGGCTCTTAGAGG + Intronic
906559535 1:46746093-46746115 AGCCAAAGACTGTCCCTTGAGGG - Intergenic
906743722 1:48207262-48207284 AGCCAAGTGCTGTCCCTCAGAGG + Intergenic
906796614 1:48701173-48701195 AGACTAAGGCTGGCTCTTAAAGG - Intronic
907384395 1:54116678-54116700 TCACAAGGGCTGGCCCTTAGAGG + Intergenic
910765947 1:90782365-90782387 AGCCAGATTCTGGCTCTTAGAGG - Intergenic
911676023 1:100658952-100658974 AACCAAAGGCTGGGCTTTAAAGG - Intergenic
912451139 1:109768497-109768519 ATGCAAGGGCTGGCCCTTAAAGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
915217627 1:154350581-154350603 TGCCAGAGGCTGGGCCTGAGGGG - Exonic
924452923 1:244195582-244195604 AGCCAGTGTCTGGCACTTAGAGG + Intergenic
1064217768 10:13415047-13415069 AGCAAGAGGCAGGACCTTAGAGG - Intergenic
1065189045 10:23193810-23193832 AGCCAAAGTCTGGACCCCAGAGG + Exonic
1065461818 10:25975017-25975039 AGCCAAAAGCAGGCACTTTGAGG + Intronic
1065951546 10:30656592-30656614 AGCCAAAGGCACTTCCTTAGGGG + Intergenic
1070427119 10:76299758-76299780 AGCCAAAGGTTAGCTCTTACTGG - Intronic
1075562596 10:123479225-123479247 ACCCAGAGGCTGGGCCTGAGCGG - Intergenic
1077234525 11:1473442-1473464 GGCCTCAGCCTGGCCCTTAGGGG - Intronic
1077393193 11:2309151-2309173 AGCCACTGGCTTGGCCTTAGGGG + Intronic
1077996011 11:7453330-7453352 AGCCAATGGCTGGCTCCTAGGGG - Intronic
1078093347 11:8281439-8281461 AGCCAAATGCTTTCCCTTGGTGG - Intergenic
1083623019 11:64058327-64058349 ATCCGAAGGCTGACGCTTAGAGG + Intronic
1083800533 11:65044070-65044092 AGCCAAAGGCTGGCCCTTAGAGG + Intronic
1083800620 11:65044450-65044472 AGGCAAGGTCTGGCCCTTGGGGG - Exonic
1085561982 11:77480039-77480061 AGCCAAAAGCTGTTCCTTAATGG + Intergenic
1087012846 11:93529784-93529806 AGGCGGAGGCTGGCCCTCAGCGG - Intronic
1087658503 11:100956485-100956507 AGCCACATACTGGCTCTTAGTGG + Intronic
1104732000 12:131112316-131112338 AGCCATAGGCTGGCAATGAGTGG - Intronic
1108025271 13:46170902-46170924 AGCCAAAGGCGGCCCCCTAGAGG + Intronic
1108417532 13:50213649-50213671 AGCCAAAGGTGGGACCTTTGAGG - Intronic
1113556292 13:111238396-111238418 AGCAAAGTGCTGGACCTTAGAGG + Intronic
1118459638 14:65976464-65976486 AGGCACATTCTGGCCCTTAGTGG - Intronic
1119563629 14:75610281-75610303 AGACCTAGGCTGGCCCTTTGTGG + Intronic
1122323073 14:100867071-100867093 GGCTAAGGGCTGGCCCTTAGAGG - Intergenic
1122984279 14:105205163-105205185 AGCCAGGGGCCGGCCCTTTGTGG - Intergenic
1126179174 15:45768196-45768218 AGCCAAAGTCTGGCCTATAGTGG - Intergenic
1126665156 15:51069178-51069200 AGCCAAAGGCAGGATCTCAGGGG - Intronic
1127393776 15:58527479-58527501 AATCAAAGGCTGGCCCTGATGGG - Intronic
1129391741 15:75224214-75224236 AGACAAACACTGGCCCTTTGGGG - Intergenic
1135041373 16:19119831-19119853 TGCCAAAAACTGGCCCTAAGTGG - Exonic
1138347422 16:56328549-56328571 AGCCAAGGGCTCTCCCCTAGCGG - Intronic
1141266876 16:82505767-82505789 AGGCAAAGGCAGGCTCTGAGCGG + Intergenic
1141551412 16:84809041-84809063 AGCTAAGGGCTGGCCCATGGAGG - Intergenic
1142483341 17:231694-231716 AGCCAGAGGCTGGCCCTTGGGGG + Intronic
1142513308 17:411193-411215 AGTCCAAGGCTGCCCCTTGGTGG - Intronic
1147187572 17:38720910-38720932 AGCCAATGGCTGGCACTAAGTGG - Intronic
1147703375 17:42409802-42409824 AGCCAAAGGAAGGACCTCAGGGG + Intronic
1148106893 17:45123776-45123798 GGCCACAGGCTGGCCCCAAGGGG - Intronic
1149460388 17:56824782-56824804 AGCCCAAAGCTGGCCCTTTTGGG - Exonic
1151733241 17:75923215-75923237 CGCCAAATGCAGGCCCTCAGAGG + Exonic
1152379819 17:79936624-79936646 AGCCAGAGGCATGCCCTTGGGGG - Exonic
1155168067 18:23247199-23247221 AGCCTGATGGTGGCCCTTAGAGG - Intronic
1156454685 18:37286391-37286413 AGCCACAGGCTGACCCTTATGGG + Intronic
1161206940 19:3046490-3046512 GGCCAGAGCCTGGCCCTTTGGGG + Intronic
1162567109 19:11450692-11450714 AGCCACAGGCAGGCCCAGAGGGG - Exonic
1163153769 19:15429292-15429314 AGCCAAGAGCTGCCCCTCAGTGG + Intronic
1167279832 19:48560445-48560467 AGTCAGAGGCTGCCCCTCAGTGG + Intronic
932607125 2:73172778-73172800 GGCCAGAGGCTGCCCCTTAGAGG - Intergenic
933773616 2:85758864-85758886 AGGGAAAGGCTGGCCTTGAGGGG + Intronic
934669961 2:96205476-96205498 AGCCAAAGGCTGTGATTTAGGGG + Intronic
935638721 2:105270669-105270691 AGCCAAGGGCTGGCCCTGCAAGG + Intronic
936038921 2:109134328-109134350 AGGAAAAGGCTGGCACTTGGGGG + Intronic
937682703 2:124661537-124661559 AGCCTCAGGCAGGCCCTTCGGGG - Intronic
937747288 2:125429914-125429936 AGACAAATTCTGGACCTTAGGGG - Intergenic
938023760 2:127927096-127927118 AGCCAGAGGCAGGCCCGGAGCGG + Intergenic
940679221 2:156763122-156763144 AGCCAAAGTCTGGACCATAGTGG + Intergenic
944673485 2:202015743-202015765 AGCCAAAGGCTGGGAGTTGGGGG + Intergenic
947698814 2:232215739-232215761 AGCCAAAGCCTGGCACACAGGGG - Intronic
948811026 2:240478516-240478538 AGCCACAGGCTGCCCCTGGGAGG - Intergenic
1171231416 20:23489788-23489810 TGCCCAGGCCTGGCCCTTAGTGG - Intergenic
1176076872 20:63252648-63252670 ACCCAGAGGCTGGCCCTGAGAGG + Intronic
1178772394 21:35517922-35517944 AGACAAAGGCTGACCTTCAGAGG + Intronic
1179795128 21:43778138-43778160 ACCCAAGGGCTGTCCCTCAGGGG + Intergenic
1180145176 21:45914734-45914756 GGCCACAGACTGGCCCTGAGTGG - Intronic
1180180248 21:46115705-46115727 TGACAGAGGCTGGCCCTTTGGGG + Intronic
1180720230 22:17902502-17902524 AGCCAAAGCCTGTGCCTTTGGGG - Intronic
1180859751 22:19071033-19071055 TACCAAAGGCTGGCCCTCCGCGG - Intronic
1181553013 22:23651798-23651820 AGCCAAAGGCTGCCTCATATTGG - Intergenic
1183406895 22:37634612-37634634 AGACAGAGGCTGGCCCCTGGAGG + Intergenic
1184757761 22:46526534-46526556 AGCCAAGGGCAGGTCCTTGGTGG - Intronic
953248904 3:41225068-41225090 AGCCAAACGCTGGACATTAGTGG - Exonic
955475927 3:59335997-59336019 AGCCAAATCCTGGCTCTTGGTGG + Intergenic
962828934 3:139122876-139122898 AGCCAAAGGCAGCCCCTCAAAGG + Intronic
963800368 3:149670036-149670058 AGGCAACAGCTGACCCTTAGGGG + Intronic
965483545 3:169249790-169249812 ATCCAAAAGGTGGCCCTCAGGGG + Intronic
965913318 3:173810006-173810028 AGCCAAAGGCTGTCCTTGATAGG + Intronic
970063896 4:12068875-12068897 AGGCAAAGGCCAGCCCATAGAGG + Intergenic
970372737 4:15424431-15424453 AGCCAAATGCTGGCTCTTTCGGG + Intronic
971444673 4:26730776-26730798 GGCCAAAGGCTGGCTATTTGTGG - Intronic
971486913 4:27169955-27169977 ATCCAAAGTCTGGCCCATAGAGG - Intergenic
974849346 4:67386136-67386158 ACGTAGAGGCTGGCCCTTAGAGG - Intergenic
977249248 4:94671025-94671047 AGCCCCAGGCTGTCCTTTAGAGG - Intergenic
979966251 4:127079494-127079516 AGAGGAGGGCTGGCCCTTAGTGG - Intergenic
986501883 5:8409476-8409498 TCCCACAGGCTGGCCCTGAGAGG + Intergenic
988033541 5:25796961-25796983 ATCCCATGGCTGCCCCTTAGTGG - Intergenic
989247147 5:39266893-39266915 AGCCCAGGACTGGCCTTTAGGGG - Intronic
994499076 5:100551398-100551420 AAGCAAAGGCTGCCCATTAGCGG - Intronic
995778800 5:115754316-115754338 AGCCAATGCCTGGCCCTGAGAGG + Intergenic
996823886 5:127659956-127659978 AGGCAGAGGCTGGACCTCAGAGG + Intergenic
997648089 5:135494434-135494456 AGACAAAGGCTGGCCCTCCAAGG + Intergenic
997791229 5:136764188-136764210 AGCCATAGTATGGCCCTGAGAGG - Intergenic
998172641 5:139881494-139881516 AGCCACAGAGTGCCCCTTAGTGG - Intronic
999259968 5:150232326-150232348 GGCCAAAGCCTGGCACATAGTGG + Intronic
999440558 5:151597416-151597438 AGGAAGAGGCTGGCCCTGAGGGG + Intergenic
1001438757 5:171721567-171721589 AGACAAAGCCTGGCCTTTGGAGG + Intergenic
1002318133 5:178357573-178357595 AGTCAAAGGCTGGCCCCTGGAGG - Intronic
1003973765 6:11323736-11323758 AGCGGAAGGCTGTCCCTCAGAGG - Intronic
1007516249 6:42413912-42413934 AGCCAAAAGTTGGCCCTTTGGGG + Intronic
1022769539 7:33454423-33454445 ATCCAAAGGCTTACTCTTAGAGG + Intronic
1026045566 7:66903677-66903699 AGCCAAAGGCAGGGCCTGAAAGG - Intergenic
1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG + Intergenic
1033020337 7:137718354-137718376 ACCCAAAGGTGGCCCCTTAGAGG + Intronic
1041699584 8:60773540-60773562 AGTCACAGGCTTGCACTTAGGGG - Intronic
1046915171 8:119672064-119672086 TGCCAAAGGTTGGCCCTCAGAGG + Intronic
1048023130 8:130559195-130559217 TTCCAAAGGCTGGCCTTTAGGGG + Intergenic
1051674889 9:19548805-19548827 ATCCCAGGGCTGGCCCTTGGCGG - Intronic
1052784928 9:32819543-32819565 AGCCAAAGGCTGGCTGCTTGAGG - Intergenic
1056684403 9:88747511-88747533 AGCCAGAGGCTGGCCATGGGTGG + Intergenic
1057040189 9:91842459-91842481 ACCCAAATGCTGGCCCTTGGGGG + Intronic
1058110707 9:101028715-101028737 AGCAAAAGGCTGGCGCGGAGGGG - Exonic
1060545093 9:124454770-124454792 AGCCCAAGTGTGGCCCTTGGGGG + Intronic
1189997591 X:46653797-46653819 AGGGAAAGGCTAGCCCTTTGGGG - Intronic
1192522750 X:71816070-71816092 AGCCACAGGCAGGCCCTGGGAGG - Intergenic
1197330419 X:125146897-125146919 AGCCAAAGATTGGACCTGAGAGG - Intergenic
1201178005 Y:11321642-11321664 AGCCAAAGGGAGGCCCTGCGAGG + Intergenic
1201190348 Y:11438653-11438675 AGCCAAAGGCTGGCCCTGGTTGG + Intergenic