ID: 1083800865

View in Genome Browser
Species Human (GRCh38)
Location 11:65045598-65045620
Sequence CTCTTACAGCAGTGGCGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083800857_1083800865 6 Left 1083800857 11:65045569-65045591 CCGTCCACTTGTCTCTGAAGGCC 0: 1
1: 0
2: 2
3: 12
4: 186
Right 1083800865 11:65045598-65045620 CTCTTACAGCAGTGGCGGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 86
1083800859_1083800865 2 Left 1083800859 11:65045573-65045595 CCACTTGTCTCTGAAGGCCAGGG 0: 1
1: 0
2: 2
3: 24
4: 224
Right 1083800865 11:65045598-65045620 CTCTTACAGCAGTGGCGGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 86
1083800854_1083800865 8 Left 1083800854 11:65045567-65045589 CCCCGTCCACTTGTCTCTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1083800865 11:65045598-65045620 CTCTTACAGCAGTGGCGGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 86
1083800853_1083800865 9 Left 1083800853 11:65045566-65045588 CCCCCGTCCACTTGTCTCTGAAG 0: 1
1: 0
2: 2
3: 6
4: 115
Right 1083800865 11:65045598-65045620 CTCTTACAGCAGTGGCGGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 86
1083800856_1083800865 7 Left 1083800856 11:65045568-65045590 CCCGTCCACTTGTCTCTGAAGGC 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1083800865 11:65045598-65045620 CTCTTACAGCAGTGGCGGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083800865 Original CRISPR CTCTTACAGCAGTGGCGGTC GGG Intronic
917222516 1:172747192-172747214 ATCTGACAGCAGTGGCTGTCAGG - Intergenic
922570912 1:226634278-226634300 CTCTAACAGCACTGGCCGCCAGG + Exonic
1066210712 10:33234929-33234951 CTGTGACTGCAGTGGCAGTCAGG - Intronic
1069536925 10:69260600-69260622 CTCTGCAAGCAGTGGCAGTCTGG + Intronic
1070243605 10:74708431-74708453 CTCTTCCATCAGTGGAAGTCTGG - Exonic
1071499742 10:86194890-86194912 CACTTACAGCAGTTCCTGTCAGG + Intronic
1071882169 10:89911250-89911272 CTCTGACTGCAATGGTGGTCTGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1077482456 11:2822241-2822263 ATCTTGCAGCACTGGAGGTCAGG - Intronic
1078056170 11:8010583-8010605 CTCCTACAGCAGTGGTGGTATGG + Intergenic
1083006485 11:59351454-59351476 CTCCTACTGCAATGGTGGTCAGG + Intergenic
1083800865 11:65045598-65045620 CTCTTACAGCAGTGGCGGTCGGG + Intronic
1101039500 12:100740059-100740081 TTCTTACAGCAGTAGCAGCCAGG + Intronic
1101762253 12:107668586-107668608 CTCTTGCAGCAATGGTGGTAAGG + Intergenic
1103165284 12:118765126-118765148 CTGTTACAACAGTGGCAGACTGG + Intergenic
1104775378 12:131387540-131387562 CTCTTAGAGCAGTGGGAGTGGGG - Intergenic
1112637508 13:101232018-101232040 CTCTTACAGCAGTACCCGTTGGG - Intronic
1124839955 15:33232516-33232538 CAGTTAAAGCAGTGGCGGCCAGG + Intergenic
1125552294 15:40554548-40554570 CTCTTATAGCTGAGGCAGTCTGG + Intronic
1130200265 15:81819535-81819557 CTCTTACAGGTCTGGAGGTCTGG + Intergenic
1135304621 16:21357368-21357390 CTCCAACAGCAGTGGCTGTTTGG - Intergenic
1139420011 16:66844371-66844393 CTCTTAAAGCAGCGGCTGGCGGG - Exonic
1142063061 16:88043192-88043214 CTCCAACAGCAGTGGCTGTTTGG - Intronic
1142342890 16:89535701-89535723 CTCTCCCAGCAGAGGCGGTGGGG - Intronic
1143502883 17:7349152-7349174 CTCTTACAGCAGCTGTGGCCTGG - Exonic
1144509206 17:15860856-15860878 CTCTTGCAGAGGTGGGGGTCTGG - Intergenic
1144864849 17:18328875-18328897 CTCTGACACCAGTGTCGCTCTGG + Exonic
1145173324 17:20678501-20678523 CTCTTGCAGAGGTGGGGGTCTGG - Intergenic
1145352965 17:22104954-22104976 CTCTTACAGACGTGGGGGTCTGG + Intergenic
1146958320 17:36950206-36950228 CCCTGGCAGCAGTGGCTGTCGGG - Exonic
1150248539 17:63693472-63693494 CTCTTTCTGCAGTGGTGGGCAGG + Intronic
1153871151 18:9321599-9321621 CTAAGACAGCAGTGGGGGTCAGG - Intergenic
1157609897 18:48949757-48949779 TTCTTCCAGCACTGGCGCTCCGG + Intronic
1157717953 18:49902104-49902126 ATCTTACAGCTCTGGAGGTCAGG + Intronic
1160005845 18:75068469-75068491 TTCTTACAGCAGAGGTGGGCTGG - Intergenic
1164700965 19:30284074-30284096 TTCTTAAAGCCGTGGTGGTCAGG - Intronic
1166075608 19:40412193-40412215 CTCTCATAGCAATGGGGGTCAGG + Intronic
1168554077 19:57323485-57323507 AAATTACAGCAGTGTCGGTCAGG - Intronic
928238298 2:29564443-29564465 CTCTTACAAGGGTGGCGGTGGGG - Intronic
928351877 2:30565186-30565208 CTCTTACAGTTGTGGAGGTTTGG + Intronic
930808868 2:55519955-55519977 CTCTCACACCAGCGGCGGGCAGG + Intronic
931947486 2:67326230-67326252 CTCATAGAGCAGTGGCCGGCAGG - Intergenic
934912702 2:98274226-98274248 CTCTCACAGCAGTGATGCTCTGG - Intronic
934937899 2:98478466-98478488 CTCTAACAGCAGCGCAGGTCTGG - Intronic
935695017 2:105763613-105763635 CTGTTACAGCAGTGGGGTTGGGG + Intronic
938231931 2:129668968-129668990 CTCCTGCAGCGGTGGGGGTCAGG + Intergenic
938377726 2:130819622-130819644 CACTTACAGAAGAGGGGGTCAGG - Intergenic
938993884 2:136657338-136657360 CTGTCACAGCAGAGCCGGTCTGG + Intergenic
1171371719 20:24666677-24666699 CTATTTCAGCAGTGGAGGCCTGG - Intergenic
1171563208 20:26149110-26149132 GTCTTACAGACGTGGGGGTCTGG + Intergenic
1173900487 20:46584000-46584022 CTCTTACAGGAGTCCCGGTGAGG - Intronic
1173973048 20:47167231-47167253 CTCTTACAGTTCTGGAGGTCAGG + Intronic
1175982333 20:62744994-62745016 CTGTGACAGCCGTGGTGGTCTGG - Intronic
1182164239 22:28156457-28156479 CTCTTACAGCTCTGGAGGTCAGG - Intronic
1184349857 22:43936421-43936443 CTCTTACAGCATTGGCACACTGG - Intronic
1184955754 22:47884925-47884947 TCGTTACAGCAGTGGCTGTCGGG - Intergenic
950316249 3:12004386-12004408 CGCAGACAGCAGCGGCGGTCTGG - Exonic
950772995 3:15327127-15327149 CTGAGACAGCAGTGGCGGTGGGG + Intronic
951543803 3:23806538-23806560 CCCCTACAGGAGTGGCGATCGGG + Intronic
954542073 3:51400229-51400251 CTCTTACAGCAGAGGAGCTGAGG - Intronic
955793981 3:62616478-62616500 TTCCTACAGCAGTGGTGTTCAGG + Intronic
963967020 3:151383328-151383350 CTATCACAGCAGTGGTGGGCAGG - Intronic
964430956 3:156605681-156605703 ATCTTAAAGCAGTGGGGGTGGGG + Intergenic
964949889 3:162277153-162277175 CCCTTACAGCAGCTGAGGTCAGG + Intergenic
965805016 3:172533522-172533544 CTCTGACTGCAATGGTGGTCTGG + Intergenic
966736345 3:183189986-183190008 CTCCTACAGCAGAGGCAGACTGG - Intronic
966975271 3:185077337-185077359 CTCGTACATGAGTGGCAGTCAGG - Intergenic
968060228 3:195722220-195722242 CCCTTAAAGCAGTGGAGGTGGGG - Intronic
971326897 4:25652172-25652194 CTCTTGCAGCAGCTGCGGCCAGG + Intergenic
971988241 4:33855679-33855701 CTCTTACAGACATGGGGGTCTGG - Intergenic
972631989 4:40850119-40850141 ATGTTACAGCAGTGGCGTTGTGG - Intronic
973027675 4:45293236-45293258 CTCTGACTGCAATGGCGGTCTGG + Intergenic
981850061 4:149219158-149219180 CTCTATCTGCAGTGGCAGTCAGG - Intergenic
985713143 5:1441653-1441675 CACTGACAGCAGTGGAGGGCGGG - Intronic
987041614 5:14068296-14068318 CTCTTACAACAGTTGCAATCTGG + Intergenic
997083390 5:130767173-130767195 GACTTACAGCAGTGGCAGTCTGG - Intergenic
999128955 5:149267827-149267849 CTCTCACAGCATTTGCAGTCTGG + Intergenic
1000022834 5:157333431-157333453 CTCTTACCACAATGGAGGTCAGG - Exonic
1002133366 5:177094544-177094566 CTCCTACAGCAGTGGACGTGGGG - Intronic
1005744689 6:28825445-28825467 CTCTCGCAGCCGTGGCAGTCTGG - Intergenic
1011002935 6:82611401-82611423 CTCTTACAGTTATGGAGGTCAGG - Intergenic
1017137608 6:151162019-151162041 CTCTTATATCAGTGGCTGGCTGG - Intergenic
1020017910 7:4842253-4842275 CTCTCACAGCAGAGGCCGTAAGG + Intronic
1025274521 7:57565254-57565276 CTCTTACAGACGTGGGGGTCTGG - Intergenic
1036615205 8:10382369-10382391 CTCTTCCAGCAGTGTGGGTTGGG - Intronic
1044090152 8:87990110-87990132 CTCTTACAGCTGTGGCAGTGGGG + Intergenic
1051146384 9:14032013-14032035 CTCTTACATCAGTGGTTCTCAGG + Intergenic
1051852708 9:21528071-21528093 CTCTGACTGCAATGGTGGTCTGG + Intergenic
1054971371 9:71091444-71091466 CCCTTACAACAGTGGCTGTTTGG + Intronic
1057861335 9:98643205-98643227 ATCTCACAGCAGTGGCTGGCAGG - Intronic
1062106334 9:134757031-134757053 CCCTTCCAGCAGTGGCGAGCAGG + Intronic
1203625787 Un_KI270750v1:19080-19102 CTCTTACAGACGTGGGGGTCTGG - Intergenic
1188461726 X:30434794-30434816 CTCTTACAGCTTTGGAGTTCAGG - Intergenic
1189690716 X:43613989-43614011 ATCCTCCAGCAGTGGCAGTCTGG - Intergenic
1193703430 X:84791281-84791303 CTCTGACTGCAGTGGCAGTCTGG - Intergenic
1197141487 X:123122089-123122111 CTCTGACAGCAATGGCAGTGCGG - Intergenic
1200965116 Y:9028489-9028511 CTCTTACAGCTCTGACAGTCGGG - Intergenic