ID: 1083802882

View in Genome Browser
Species Human (GRCh38)
Location 11:65057160-65057182
Sequence CCTACAGCTCAGAGAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083802874_1083802882 11 Left 1083802874 11:65057126-65057148 CCAAACCTGAAAATTGTACTCAA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1083802882 11:65057160-65057182 CCTACAGCTCAGAGAGGGTCAGG 0: 1
1: 0
2: 2
3: 24
4: 216
1083802875_1083802882 6 Left 1083802875 11:65057131-65057153 CCTGAAAATTGTACTCAACCCCT 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1083802882 11:65057160-65057182 CCTACAGCTCAGAGAGGGTCAGG 0: 1
1: 0
2: 2
3: 24
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083802882 Original CRISPR CCTACAGCTCAGAGAGGGTC AGG Intronic
900660166 1:3778150-3778172 CTTACAGCTCTGGGAGGGTTGGG + Intergenic
900896545 1:5486904-5486926 CCTACAACCCACGGAGGGTCAGG + Intergenic
900926499 1:5709459-5709481 CCTGGAGCTCAGAGAGGGAAGGG + Intergenic
901192797 1:7422480-7422502 CCCCCAGCACAGAGGGGGTCTGG - Intronic
901215784 1:7554613-7554635 CCAACAGGTCAGAGATGATCAGG - Intronic
901639192 1:10684836-10684858 CCTACAGATGGGAGAGGCTCAGG - Intronic
903295098 1:22338726-22338748 CCTGAAGCTCAGTGAGGGGCAGG - Intergenic
903737709 1:25540913-25540935 CCTAAGGCCCAGAGAGGGACAGG - Intergenic
903942729 1:26942755-26942777 CGTCCAGCTCCGACAGGGTCTGG - Exonic
904200071 1:28813737-28813759 CCCACAGCCCAGAGAGGTTTAGG - Intronic
904465769 1:30706800-30706822 AACAGAGCTCAGAGAGGGTCAGG + Intergenic
904761389 1:32807024-32807046 CCTCCTGCTCAGAGGGAGTCTGG + Intronic
905995281 1:42376004-42376026 CTTACAGCGCAGGGAGGGTGGGG + Intergenic
906228306 1:44139660-44139682 CCTGCTCCTCACAGAGGGTCTGG + Intergenic
907083664 1:51648649-51648671 ATTACAGCTCAGATAAGGTCTGG + Intronic
907727629 1:57034486-57034508 CCTGCAGCTGGTAGAGGGTCTGG + Intronic
907963698 1:59308420-59308442 CAGACAGCACAGAGAGGGACAGG + Intronic
908112064 1:60907664-60907686 CCCACAGCTCATACAGAGTCAGG - Intronic
911497794 1:98651399-98651421 CCTCCAACTCAGAAAGGGGCGGG + Intergenic
912799021 1:112709785-112709807 TCTAAAGCTCAGGAAGGGTCTGG + Intronic
917120619 1:171641821-171641843 CCTACACAGCCGAGAGGGTCGGG + Intronic
919724025 1:200870492-200870514 CCTAGAGCTCACAGAGGGTTGGG - Intergenic
921289371 1:213642046-213642068 TCTAAAGCTCAGAGAGAGTGGGG - Intergenic
922790654 1:228309133-228309155 CGTGCAGCTCAGTGAGGGCCAGG + Exonic
923340069 1:232999379-232999401 CCTGCAGGTCAGAGAGGGAACGG + Exonic
923712810 1:236400509-236400531 CCTGCAGCTCTGAGAGCTTCTGG + Intronic
924243192 1:242059225-242059247 CTTACAGGTCAGAGTGGGGCCGG + Intergenic
1062917834 10:1255533-1255555 ACTACAACCCAAAGAGGGTCAGG + Intronic
1062944601 10:1450838-1450860 CCTTCAGCTCGTGGAGGGTCAGG - Intronic
1063150405 10:3331641-3331663 CCTACACCACACAGAGGGGCGGG + Intergenic
1063463382 10:6228472-6228494 CCTGCAGCCCTGAGAGGGTAGGG - Intronic
1063615905 10:7600416-7600438 CCTAGTGCTCAGAGATGTTCAGG - Intronic
1067031489 10:42880821-42880843 CCTGGAGCACAGACAGGGTCAGG + Intergenic
1069654616 10:70078543-70078565 CCTGGAGCTCAGAGAGGTTAAGG - Intronic
1070806527 10:79274160-79274182 CCTGCAGCACAGAGGGGCTCAGG + Intronic
1071494500 10:86158495-86158517 CCTACAGAGCAGAGAGAGTTTGG - Intronic
1073091411 10:100942960-100942982 CCTAAAGTTCAGAGAGCTTCTGG - Intronic
1075763486 10:124874452-124874474 CATAAAGATCAGAAAGGGTCCGG - Intergenic
1077068799 11:657798-657820 CCTGCAGTTCTGAGAGGGCCTGG - Intronic
1080687618 11:34528325-34528347 CCTAAAGCTCAGAGACAGACAGG - Intergenic
1081807524 11:45898689-45898711 ACTATAGGCCAGAGAGGGTCTGG - Intronic
1083626124 11:64072985-64073007 CCTGCAGCCCAGAGAGGGGTCGG + Intronic
1083688180 11:64390161-64390183 CATGCAGCTCATAGAGGGGCCGG + Intergenic
1083802882 11:65057160-65057182 CCTACAGCTCAGAGAGGGTCAGG + Intronic
1083814616 11:65125642-65125664 CCTTCAGCCCTGAAAGGGTCAGG - Intronic
1084178020 11:67433501-67433523 CCCACAGCCCAGAGAGACTCAGG - Intronic
1084936527 11:72589975-72589997 GCTGCAGCTGAGAGAGGGACAGG + Exonic
1086331093 11:85755208-85755230 CCTAAAGCAAAGAGGGGGTCAGG + Intronic
1087216669 11:95502448-95502470 CCTGCAGCACAGAGTGAGTCTGG + Intergenic
1088656489 11:112004701-112004723 CCTACAGCTGAGGGAGGGGAAGG + Intronic
1089931394 11:122316872-122316894 CCTGAAGCTCAGAGAGGTTAGGG - Intergenic
1091582466 12:1797799-1797821 CCCCCAGCTCAGTGAGGGCCAGG - Intronic
1092170029 12:6368768-6368790 CCTACATCTCAGAGAGGTTCTGG - Intronic
1093197775 12:16149076-16149098 TCCTCAGCTAAGAGAGGGTCAGG + Intergenic
1093769554 12:23002891-23002913 CCTTCAGTTCAGACAGGCTCAGG + Intergenic
1095965449 12:47864202-47864224 GCTCCAGCCCAGAGAGGGCCAGG + Intronic
1096232655 12:49904869-49904891 GCTGCAGCTCAGAGAGGTTAAGG - Intergenic
1102322078 12:111944766-111944788 CCTAAAGCTCACACAGGGCCAGG + Intronic
1103087088 12:118069844-118069866 ACTAAGGCTCAGAAAGGGTCAGG + Intronic
1103535457 12:121630634-121630656 TCTGCAGATCAGAGAGGGTCCGG - Intronic
1104349099 12:128029468-128029490 GCTAAGGCTCAGAGAGGGTAAGG + Intergenic
1104401588 12:128480914-128480936 CTGTCAGCTCAGAGAGGGTGGGG + Intronic
1110634543 13:77751496-77751518 CCAACAGCTCACAGAGTGTCTGG + Intronic
1118741227 14:68740829-68740851 CAAATAGCTCAGAGATGGTCTGG + Intergenic
1119280736 14:73405384-73405406 CCTACAGCTCAGAGAAGATGAGG + Intronic
1119726237 14:76923313-76923335 CCGAATGCTCAGGGAGGGTCAGG - Intergenic
1120979511 14:90277939-90277961 CCTTTATCTCAGAGAGGGCCTGG + Exonic
1122055313 14:99094107-99094129 CCTCAAGCTCAGACAGGGTCAGG - Intergenic
1122289345 14:100671597-100671619 ACTGCAGCCCAGAGAGGGTCAGG - Intergenic
1126415339 15:48412432-48412454 CCTAGAGCTCAGGGAATGTCTGG + Intronic
1126783883 15:52161115-52161137 CCTGGAGCTCAGAGAGGCTAAGG + Intronic
1128683448 15:69667466-69667488 CCTACAGCTCAGAGAGTGCCTGG - Intergenic
1129331931 15:74832270-74832292 CCTCCAGCTCTGAGAAGGTCAGG - Intergenic
1129788371 15:78323911-78323933 ACTAAAGCTCAGAGAGGTTGAGG - Intergenic
1130599340 15:85265144-85265166 CCAACGGCTCAGAGAATGTCTGG + Intergenic
1131567524 15:93500249-93500271 CATCCAGCTCAGGAAGGGTCTGG + Intergenic
1132038521 15:98505676-98505698 GGCACAGCCCAGAGAGGGTCTGG + Intronic
1132065100 15:98724620-98724642 TCTCCAGCTCAGAGCAGGTCTGG + Intronic
1132948677 16:2547795-2547817 CCTGGGGCTCAGAGAGGGACAGG - Intronic
1132965910 16:2654332-2654354 CCTGGGGCTCAGAGAGGGACAGG + Intergenic
1133862664 16:9610864-9610886 CACAGAGCTCAGAGAGCGTCTGG - Intergenic
1138110265 16:54318228-54318250 CATACAGCTAATAGAGGCTCAGG + Intergenic
1138431065 16:56969552-56969574 CCTCCAGCCCAGAGAGGGCCAGG - Intronic
1139309304 16:66014812-66014834 GCTAGATATCAGAGAGGGTCTGG - Intergenic
1140299019 16:73738302-73738324 ACTTCAGCTTAGAGAGGGGCAGG + Intergenic
1145902827 17:28499149-28499171 AGTCCGGCTCAGAGAGGGTCAGG + Intronic
1146642384 17:34551041-34551063 TCTGGGGCTCAGAGAGGGTCAGG - Intergenic
1146691335 17:34878148-34878170 TCTACAGCTAAGAGAGGTTCAGG - Intergenic
1146911012 17:36648557-36648579 CCCACAGCCTAGAGAGGGTGTGG - Intergenic
1148085661 17:44992434-44992456 ACTCCTGCTCAGAGACGGTCAGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1152040848 17:77901715-77901737 CATACAGCTCAGAGCTGGCCAGG - Intergenic
1152106210 17:78330639-78330661 ACTAAGGCTCAGAGAGGTTCAGG + Intergenic
1203183228 17_KI270729v1_random:85809-85831 CACACAGCTCAGAGAGGAGCAGG + Intergenic
1155116740 18:22776390-22776412 CCTACAGTCCACACAGGGTCTGG - Intergenic
1155427772 18:25724095-25724117 CCTACAGCTAAGAGAGCATGGGG + Intergenic
1155626036 18:27835533-27835555 CCTGCTGGTGAGAGAGGGTCAGG + Intergenic
1157748841 18:50160616-50160638 CCTCCAGCAATGAGAGGGTCGGG + Intronic
1160365599 18:78323621-78323643 CATATAGCTCAGAGAGGTTGTGG + Intergenic
1161016902 19:1987692-1987714 CCTGCAGCACAGGGAGGGTGTGG + Exonic
1162966533 19:14158863-14158885 CTCACAGCTCAGAGAGGATGGGG - Intronic
1163158812 19:15452960-15452982 ACTGAAGCTCAGAGAGGGTCGGG + Intronic
1165338909 19:35196391-35196413 CCTAAAGTTCAGAGAGAGTGGGG - Intergenic
1166671237 19:44710660-44710682 CCAACAGCTCAGCGAGGGAGTGG - Exonic
1167529066 19:50003527-50003549 CCTATAGCTCAGCGAGGCCCGGG + Intronic
925054617 2:847415-847437 CCTACTGCACACAGAGGCTCTGG + Intergenic
925628115 2:5862389-5862411 CCTACAGCTCAGCAAGTTTCCGG - Intergenic
927491582 2:23524597-23524619 CCTTCAACTCAGAGAGGGGGTGG + Intronic
928030834 2:27777556-27777578 CCTAAAGGTCAGAAAGGGACAGG - Intronic
930714420 2:54579554-54579576 GCTTCAGCTCAGTGAGGATCTGG - Intronic
938271506 2:129976067-129976089 CCTCCAGCTGGGAGAGGCTCAGG - Intergenic
939145759 2:138412696-138412718 ACTCCAGATCAGAGATGGTCAGG - Intergenic
939871059 2:147526389-147526411 CCTTATGCACAGAGAGGGTCAGG - Intergenic
940908530 2:159190157-159190179 CCTAAAGCACAGAGAGGTTGAGG + Intronic
941387360 2:164869706-164869728 ATTACAGCACAGAGAGGTTCAGG - Intergenic
942527814 2:176874054-176874076 CCTAACACTCAGAGAGGGTGAGG - Intergenic
946481060 2:220057241-220057263 CTTTCAGCTCAGAGAGTTTCAGG + Intergenic
947446100 2:230163706-230163728 CCTACAGCTCAGAGAGTCTGGGG + Intergenic
947551147 2:231047724-231047746 CCCCCAGAGCAGAGAGGGTCAGG + Exonic
947613005 2:231535457-231535479 CCTAAAGCTAAGAGAAGGCCAGG + Intergenic
1169927168 20:10795222-10795244 CCTGCATCTCAGATAAGGTCTGG - Intergenic
1170921726 20:20685765-20685787 CCTACAGCCCTGAGAGGCTGTGG - Intronic
1171788506 20:29496961-29496983 CGTCCAGCCCAGACAGGGTCAGG + Intergenic
1174362344 20:50036958-50036980 ACTGCAGCTCAGAGAGGGTGGGG - Intergenic
1174545777 20:51324119-51324141 CCTACAGCTCAGTGAGGCCCTGG + Intergenic
1174605612 20:51759232-51759254 CCTCCAGCCCAGAGAGGGGAAGG + Intronic
1176171612 20:63698877-63698899 CCTGAAGCTCAGCGAGGGTCAGG + Exonic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1179281395 21:39937214-39937236 CCTAAGGCTCAGAGAGGATGAGG + Intergenic
1179555561 21:42173298-42173320 CTTCAAGCTCAGAGAGGTTCCGG - Intergenic
1180045717 21:45304210-45304232 CTTGGAGCTCAGAGAGCGTCTGG - Intergenic
1180624993 22:17188447-17188469 CCTGCAGGACAGAGAGGGACAGG + Exonic
1180742618 22:18064440-18064462 ACAAAACCTCAGAGAGGGTCTGG - Intergenic
1181130380 22:20727864-20727886 CCTACAGTGCACAGAGGGTATGG + Exonic
1181372176 22:22427408-22427430 CCCAGAGCTTAGAGAGGGGCTGG + Intergenic
1181390948 22:22580237-22580259 CCTGGAGCCCAGAGATGGTCAGG - Intergenic
1181412666 22:22735014-22735036 CCTGGAGCCCAGAGATGGTCAGG - Intronic
1181416002 22:22759136-22759158 CCTGGAGCCCAGAGATGGTCAGG - Intronic
1181420292 22:22792928-22792950 CCTGGAGCCCAGAGATGGTCAGG - Intronic
1181424342 22:22823214-22823236 CCTGGAGCCCAGAGACGGTCAGG - Intronic
1181460461 22:23083153-23083175 CCTGCAGCTCGGAGAGGGGCAGG + Intronic
1181993299 22:26854744-26854766 CCTGAGGCTCAGAGAGGGTTAGG + Intergenic
1182041572 22:27242330-27242352 CCTAGGGCTCAGAGAGGGGCCGG - Intergenic
1182322257 22:29485578-29485600 CCTACAGCTCTGGCAGGGTTGGG + Intronic
1182691142 22:32164288-32164310 GCAACAGCCCAGAGAGGGCCTGG + Intergenic
1182696659 22:32203219-32203241 CCCACAGCACAGAGCGGGTTTGG - Exonic
1182943780 22:34303070-34303092 CCTGGAGCTCAGAGAGGGTAAGG + Intergenic
1183254979 22:36756426-36756448 TCTGCAGCTCAGAGAGCATCCGG + Intergenic
1184334539 22:43845422-43845444 CCTCCAGCTGACAGAGGCTCAGG + Intronic
1185119561 22:48957875-48957897 CCTCCAGCTCTGACAGGGCCTGG + Intergenic
949931616 3:9082970-9082992 CCTCCAGCTTCGAGAGGGTGTGG + Intronic
950572430 3:13809668-13809690 CCTGCAGCTCAGAGAGGTGGAGG + Intergenic
954290272 3:49646072-49646094 TCTACAGCTCAGAAATGTTCAGG - Intronic
959875866 3:111381050-111381072 CCTACAGCTAAAAGAGAGTGGGG + Intronic
960617934 3:119613212-119613234 ACAGAAGCTCAGAGAGGGTCAGG - Intronic
961511450 3:127406330-127406352 GCTGCAGCTCAGAGAGGTACAGG + Intergenic
962659558 3:137587214-137587236 CCCTCACCTCTGAGAGGGTCTGG + Intergenic
964719999 3:159761863-159761885 CCCAGAGCTCAGAGGGAGTCTGG + Intronic
964747557 3:160026513-160026535 CCTGGAGCACAGAGAGGCTCAGG - Intronic
965118739 3:164522646-164522668 CCTTCAACTCAGAGGGGGCCAGG + Intergenic
966904695 3:184513740-184513762 CCTACAGCGCAGTCAGGGTCGGG - Intronic
967462506 3:189762806-189762828 CCTACAACTTAGAGTGGGTGAGG + Intronic
967989595 3:195121148-195121170 CCTGCAGCTCAGGGAGGCTTTGG - Intronic
968088741 3:195886565-195886587 CCCAGAGATTAGAGAGGGTCAGG + Intronic
968862318 4:3182678-3182700 CCCACAGCTCCGAGAGGTTATGG + Intronic
969106074 4:4807996-4808018 CCTACAGGTGAGGGAGGGGCAGG + Intergenic
969130511 4:4987709-4987731 CCTACAGCCCAGCTGGGGTCGGG + Intergenic
969336915 4:6516434-6516456 GCTGCACCTCAGAGAGGGCCTGG + Intronic
969686042 4:8674821-8674843 TCCCCAGCTCAGAGAGGGTGGGG + Intergenic
969866695 4:10080944-10080966 ACTAAGGCTCAGAGAGGGTGAGG + Intronic
970359761 4:15297254-15297276 CCAGCAGCTCAAAGAGGGTGTGG - Intergenic
972265574 4:37455726-37455748 TTTCCGGCTCAGAGAGGGTCTGG - Intronic
972334632 4:38096526-38096548 ACTGGAGCTCAGAGAGGGTGAGG - Intronic
974117844 4:57602348-57602370 CTGACAGCTCAGACAGGTTCTGG + Intergenic
976025752 4:80686343-80686365 CCTTTGGCTCAGAGAGTGTCAGG + Intronic
980115051 4:128671470-128671492 CCTACAGCTAAAAGAGGCTGGGG + Intergenic
981127285 4:141121207-141121229 CCTGCTGGGCAGAGAGGGTCTGG - Intronic
985686462 5:1284118-1284140 CCTCCAGCTCACCGAGGGCCTGG + Intronic
985686491 5:1284239-1284261 CCTCCAGCTCACCGAGGGCCTGG + Intronic
985686520 5:1284360-1284382 CCTCCAGCTCACCGAGGGCCTGG + Intronic
985686670 5:1285038-1285060 CCTCCAGCTCACCGAGGGCCTGG + Intronic
985686699 5:1285159-1285181 CCTCCAGCTCACCGAGGGCCTGG + Intronic
985774413 5:1833419-1833441 CCCACAGCTCTGAGAAGGCCAGG - Intergenic
985781316 5:1873400-1873422 CTTAAAGCCCAGAGCGGGTCTGG + Intergenic
985832319 5:2242793-2242815 CCTTCAGCAGAGAGAGGCTCTGG - Intergenic
987898894 5:23984803-23984825 TCCACAGCTCAGAGAGGCTCAGG - Intronic
989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG + Intergenic
990490422 5:56297877-56297899 CCTAAAGCTCAGAGAGGTTATGG + Intergenic
993119054 5:83753401-83753423 GGTACAGCCCAGAGAGGGTGAGG + Intergenic
997443415 5:133924864-133924886 CCTCCAGCTCAGGGTGGGTTGGG - Intergenic
998923248 5:147094551-147094573 ACTAAAGCACAGAGAGGTTCAGG + Intergenic
999243888 5:150143307-150143329 ACTGAGGCTCAGAGAGGGTCAGG - Intronic
999799256 5:155018016-155018038 CTTACAATTCAGAGGGGGTCAGG - Exonic
1001030625 5:168259966-168259988 CCTAAGGCTCAGAGTGGGGCTGG + Intronic
1002565774 5:180112451-180112473 TCTATAGCCCAGAGAGGGGCTGG - Intronic
1002603929 5:180370884-180370906 GCCACAGCTCAGGGAGGGGCAGG + Intergenic
1005636728 6:27759829-27759851 CCTGTAGCTGAAAGAGGGTCTGG - Intergenic
1006740000 6:36301358-36301380 CCTACAGCCCTGACATGGTCCGG + Intronic
1006836160 6:36999954-36999976 CCTACAGCTCAGATGGGGGAAGG - Intergenic
1007820497 6:44557403-44557425 GCTACAGCTCAGAGGGGCTAGGG - Intergenic
1008958303 6:57239973-57239995 CATACAGCTCAGAGACTGTAGGG + Intergenic
1009623337 6:66103790-66103812 CTTACAGCTGATAGAGAGTCAGG - Intergenic
1018936361 6:168276286-168276308 CCTTTAGCTCAGAGAGGCCCGGG + Intergenic
1022332044 7:29389116-29389138 CCCATAGCTCAGAGAGTGTTGGG + Intronic
1022510151 7:30929865-30929887 CCTCCAGGTCAGGGAGGGACTGG - Intergenic
1027051042 7:75021479-75021501 CCCCCAGCTCAGAGAGGTGCAGG + Intronic
1028472966 7:91224417-91224439 CCCACAGTTCAGGGAGGATCTGG + Intergenic
1030111301 7:106029391-106029413 CCTAAAGCTCAGAGAGGCCAAGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032081918 7:128863413-128863435 ACTAAAGCTCGGAGAGGGTAAGG + Intronic
1032900083 7:136297188-136297210 CCTGAAGCTGAGAGAGGCTCAGG + Intergenic
1033892688 7:146034622-146034644 CATACAGATCAGACAAGGTCAGG - Intergenic
1034237399 7:149583048-149583070 CTCACAGCTCCAAGAGGGTCTGG - Intergenic
1034240419 7:149606419-149606441 CTCACAGCTCCAAGAGGGTCTGG - Intergenic
1034967217 7:155398826-155398848 CCAGCAGCTAAGAGAGGGCCTGG + Intergenic
1035273868 7:157735935-157735957 CCTTCAGCTCAGAAAGGGCCTGG - Intronic
1035275970 7:157748144-157748166 CCTACAGCTCAGAGACGCAGGGG - Intronic
1036421619 8:8601148-8601170 CATACAGCTCAGAGGGAATCAGG - Intergenic
1037005089 8:13768177-13768199 CCTACACAACAGAAAGGGTCAGG + Intergenic
1037528341 8:19749734-19749756 TCCCCAGCTCAGAGGGGGTCAGG + Intronic
1041136464 8:54764265-54764287 CCTACAGCTCAGCCAGGGCCTGG + Intergenic
1042955315 8:74244141-74244163 CCTAGAGCTCTGAGAGCGGCTGG + Intronic
1048542966 8:135359594-135359616 ACTGAAGCTCAGAGAGGTTCAGG - Intergenic
1048639070 8:136332666-136332688 AATACAGCTCAGAGAGGTTAAGG - Intergenic
1049957751 9:709171-709193 CCTACAGTTAAGACAGGGTTTGG + Intronic
1050124892 9:2346792-2346814 GCTTCAGCTCAGAGGGGCTCAGG - Intergenic
1052731845 9:32295528-32295550 CCTGCCTCTCAGAGATGGTCTGG - Intergenic
1056400250 9:86220457-86220479 CCTACTCCTCAGAGAGAGTTTGG + Exonic
1057548395 9:96034805-96034827 CCAAGAGCACAGAGAGGCTCGGG - Intergenic
1057892917 9:98882690-98882712 CCTGAGGCCCAGAGAGGGTCAGG + Intergenic
1058106566 9:100978679-100978701 CCAACAGCTAACACAGGGTCTGG - Intergenic
1059375435 9:113876793-113876815 CCCCGAGCGCAGAGAGGGTCAGG - Intronic
1060050029 9:120371952-120371974 CTGACAGCTCAGAGAGGGAAAGG - Intergenic
1060516851 9:124271311-124271333 CCCAGAGATCAGAGAGGGTGAGG + Intronic
1061873998 9:133534969-133534991 CCCACTGCTCAGAGTGGGGCTGG + Intronic
1062110027 9:134777261-134777283 CGCACAGCCCAGAGAGGGACAGG - Intronic
1062168949 9:135123743-135123765 CCTGCAGCTCTGACAGGGCCAGG - Intergenic
1187473269 X:19588216-19588238 CCTGCAGAGCAGTGAGGGTCAGG + Intronic
1189683397 X:43539474-43539496 CATACAGCTCCCAGAGGCTCAGG + Intergenic
1194546280 X:95239093-95239115 CCTAGTGCTCAGAGAGGCTACGG - Intergenic
1194976206 X:100398849-100398871 TCTACAGCTCATAAAGGGACTGG + Intronic
1198795183 X:140387007-140387029 TATACAGCTCACAGGGGGTCTGG - Intergenic
1200235524 X:154466128-154466150 CCTAGGGCTCAGAGAGCGTCAGG - Exonic