ID: 1083810558

View in Genome Browser
Species Human (GRCh38)
Location 11:65103275-65103297
Sequence CCATTGCCTGCATTTTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 840
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 781}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083810558 Original CRISPR CCATTGCCTGCATTTTGTTG GGG (reversed) Intronic
900220617 1:1507587-1507609 ACTTTGCTGGCATTTTGTTGAGG + Intergenic
900817587 1:4860594-4860616 CCCTTGCCCACATTTTGATGGGG + Intergenic
902352301 1:15865727-15865749 CATTTGCCTGTTTTTTGTTGGGG + Intronic
904236146 1:29118605-29118627 CCACTGCCTGAGTTTTGTTTCGG + Exonic
906855872 1:49303810-49303832 CCTTTGCCTGCTTTTTAATGGGG + Intronic
907139356 1:52171822-52171844 CCTTTGCCTGCTTTTTGATGGGG + Intronic
907370223 1:53997304-53997326 CCTTTGCCCACTTTTTGTTGCGG - Intergenic
907374685 1:54026194-54026216 CCATTGCCTACTTTTTAATGGGG + Intergenic
907551203 1:55306218-55306240 CCATTCTCTGCATGTTGTTGAGG - Intergenic
907598226 1:55740145-55740167 CCCTTGCCTGCCTTTTTATGGGG + Intergenic
909038823 1:70626347-70626369 TCAATGCCTGCAGTCTGTTGAGG - Intergenic
909057220 1:70835545-70835567 CAATTGCATGAATTTTGTGGGGG + Intergenic
909178089 1:72385178-72385200 CCATTGCCCACATTTTAATGGGG + Intergenic
909307625 1:74101227-74101249 CCATTGCCCACTTTTTGATGGGG - Intronic
909371461 1:74887416-74887438 CCTTTGCCTACATTTTAATGGGG - Intergenic
909473026 1:76050747-76050769 CCTTTGCCCACATTTTGATGGGG + Intergenic
909499050 1:76312607-76312629 CCTTTGCCTACTTTTTGATGGGG - Intronic
909541430 1:76796271-76796293 CCTTTGCCCACATTTTGATGGGG - Intergenic
909750907 1:79159520-79159542 AGTTTGCCAGCATTTTGTTGAGG + Intergenic
910531662 1:88243089-88243111 CCATTGCCCACTTTTTGATGGGG - Intergenic
910612767 1:89163157-89163179 AGTTTGCCTGTATTTTGTTGAGG + Intronic
910822197 1:91363352-91363374 CCATTGCCCGCTTTTTAATGGGG - Intronic
911306756 1:96241595-96241617 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
911367881 1:96961536-96961558 CCATTGCCTTGATTTTGCTAAGG + Intergenic
911424100 1:97685091-97685113 CATTTGCCAGCATTTTATTGAGG - Intronic
911841732 1:102690543-102690565 CCATTGTGAGCATTTTGTTTTGG + Intergenic
912066281 1:105747706-105747728 CCTTTGCCCACATTTTGATGGGG + Intergenic
912076247 1:105879652-105879674 CCTTTGCCTACTTTTTGATGGGG + Intergenic
912183061 1:107241678-107241700 CCAATGACTGCATTTTCTTGAGG - Intronic
912223194 1:107701125-107701147 CCTTTGCCTGCTTTTTAATGGGG + Intronic
912615391 1:111095146-111095168 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
912647676 1:111410431-111410453 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
913466867 1:119151758-119151780 CCTTTGCCCGTATTTTGATGGGG + Intergenic
915060883 1:153183541-153183563 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
915819029 1:159001862-159001884 CAATTGTCTGCATTTTCTTTGGG - Intronic
915991741 1:160524479-160524501 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
916637288 1:166686373-166686395 CCTTTGCCTGCATTTTAATGGGG + Intergenic
917022839 1:170609057-170609079 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
917270799 1:173271516-173271538 CCTTTGCCTACTTTTTGATGGGG - Intergenic
917290260 1:173464906-173464928 AGTTTGCCTGTATTTTGTTGAGG - Intergenic
917463851 1:175256926-175256948 CCTTTGCCCACTTTTTGTTGAGG + Intergenic
918679343 1:187332518-187332540 CCTTTGCCTACTTTTTGATGGGG + Intergenic
918921182 1:190712327-190712349 CCTTTGCCTACTTTTTGATGGGG + Intergenic
918983534 1:191595205-191595227 CCTTTGCCTGAGTTTTGCTGGGG + Intergenic
919130612 1:193445801-193445823 CCTTTGCCTACTTTTTGATGGGG + Intergenic
919198196 1:194315646-194315668 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
919207428 1:194435845-194435867 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
919254079 1:195098265-195098287 GCTTTGCCAGTATTTTGTTGAGG + Intergenic
919445574 1:197700756-197700778 CCTTTGCCTACTTTTTGATGGGG - Intronic
919937211 1:202261906-202261928 CCTTTGCCTACTTTTTGATGGGG + Intronic
921717040 1:218428156-218428178 CCTTTGCCTACTTTTTGATGGGG + Intronic
922098785 1:222465257-222465279 CCCTTGCCTGCTTTTTGTTGGGG - Intergenic
922206522 1:223452178-223452200 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
922388215 1:225110078-225110100 GGTTTGCATGCATTTTGTTGAGG + Intronic
924298472 1:242612624-242612646 CCACTTCCTGCATTTCATTGTGG + Intergenic
924889692 1:248261271-248261293 CCTTTGCCTACATTTTTATGGGG - Intergenic
1063022095 10:2139406-2139428 TCCTTGCCTGCATGTTGATGAGG - Intergenic
1063537758 10:6901378-6901400 CCATTGGCTGCAATTTTTTAAGG - Intergenic
1064696448 10:17971200-17971222 CAATTGCTAGTATTTTGTTGAGG + Intronic
1065304863 10:24358294-24358316 CCATGGGCTGCACTTGGTTGGGG + Intronic
1065459576 10:25944293-25944315 AGTTTGCCTGTATTTTGTTGAGG + Intronic
1065694063 10:28363573-28363595 CTATTGTCAGCATTATGTTGAGG + Intergenic
1066525636 10:36276074-36276096 CCTTTGCCCGCTTTTTGATGAGG - Intergenic
1066655554 10:37696566-37696588 GGTTTGCCTGCATTTTATTGAGG - Intergenic
1066988376 10:42488494-42488516 CCATTTCCTGGAGTTTGTTGTGG + Intergenic
1067330941 10:45318385-45318407 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1067700700 10:48569281-48569303 GCACTGGCTGCATTTTGCTGAGG + Intronic
1068536658 10:58246973-58246995 CCTTTGCCTACTTTTTGATGGGG - Intronic
1068562950 10:58537312-58537334 CCATTTCTAGTATTTTGTTGAGG - Intronic
1068576845 10:58693683-58693705 CCTTTGCCCGCTTTTTGATGGGG + Intronic
1068718472 10:60215184-60215206 TCTTTGCCTGCTTTTTGATGGGG + Intronic
1069174172 10:65269766-65269788 TAATTGCATGCATTTTGGTGTGG + Intergenic
1069232641 10:66030863-66030885 CCTTTGCCCGCATTTTAATGGGG - Intronic
1069371608 10:67753634-67753656 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1070213538 10:74351174-74351196 CGTTTGCCAGCATTTTATTGAGG - Intronic
1070937227 10:80309344-80309366 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1071004420 10:80866023-80866045 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1071203268 10:83245107-83245129 CCTTCGCCTGCTTTTTGATGGGG - Intergenic
1074216224 10:111386946-111386968 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
1074247797 10:111712795-111712817 CCTTTGCCTGAGTTTTGTTTGGG + Intergenic
1074757991 10:116641403-116641425 GGTTTGCTTGCATTTTGTTGGGG + Intronic
1075058864 10:119240657-119240679 CCTTTGCCCGCTTTTTGATGGGG + Intronic
1075214340 10:120519107-120519129 CCACTGACTGCACTTTCTTGTGG + Intronic
1075496088 10:122920401-122920423 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1075497941 10:122943693-122943715 CCTTTGCCTACTTTTTGATGGGG - Intronic
1075858523 10:125652806-125652828 CCTTTGCCTACTTTTTGATGGGG - Intronic
1075899382 10:126027464-126027486 TGTTTGCCTGTATTTTGTTGAGG - Intronic
1076277689 10:129218278-129218300 CAATTCCCAGAATTTTGTTGAGG - Intergenic
1076666671 10:132097114-132097136 CCTTTGCCTGTATTTGGTGGTGG - Intergenic
1076785645 10:132748580-132748602 CCATTCCCTGCATTGTACTGAGG + Intronic
1077335448 11:2001585-2001607 CAATTGCCTGCCTTGTGCTGTGG - Intergenic
1078309598 11:10227147-10227169 CCTTTGCCCGCTTTTTGATGGGG + Intronic
1078395518 11:10978120-10978142 CCTTTGCCTACATTTTAATGAGG - Intergenic
1078574131 11:12484232-12484254 CCACTGCCTGCTTCTTATTGAGG + Intronic
1078742639 11:14081541-14081563 CCTATGCCTGCCTTTTGTTTGGG + Intronic
1078773520 11:14373142-14373164 CATTTGACTGCATTTTGATGTGG + Intergenic
1078867840 11:15314630-15314652 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1079267505 11:18948200-18948222 CGATTGCCTGGATTTTCTTCTGG - Intergenic
1079726467 11:23886124-23886146 CATTTGCCTGAATTTTGTTTTGG + Intergenic
1079857313 11:25622182-25622204 CCTTTGCCCACATTTTGATGGGG + Intergenic
1079900976 11:26184432-26184454 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1080018889 11:27537805-27537827 GCTTTGCCAGTATTTTGTTGAGG + Intergenic
1080150195 11:29043733-29043755 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1080468652 11:32523904-32523926 CCTTTGCCTGCTTGTTGATGGGG + Intergenic
1081132510 11:39397561-39397583 AGTTTGCATGCATTTTGTTGAGG + Intergenic
1081220068 11:40449071-40449093 CCTTTGCCTACTTTTTGATGGGG + Intronic
1082305051 11:50562009-50562031 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1082568456 11:54709391-54709413 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1082654979 11:55843187-55843209 CCATTGCCCACTTTTTGATGGGG + Intergenic
1082660010 11:55898077-55898099 CCATTGCCCACTTTTTGATGGGG - Intergenic
1082712443 11:56569642-56569664 CTATTTCCTGCAGTTTTTTGGGG + Intergenic
1082885865 11:58081640-58081662 CCTTTGCCTACTTTTTGATGGGG + Intronic
1082903144 11:58278146-58278168 CCTTTGCCCACATTTTGATGGGG + Intergenic
1082966974 11:58976205-58976227 CCTTTGCCCACATTTTGATGGGG - Intronic
1083129007 11:60604114-60604136 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1083810558 11:65103275-65103297 CCATTGCCTGCATTTTGTTGGGG - Intronic
1085490254 11:76909438-76909460 CCTTTGCCCGCTTTTTGATGGGG - Intronic
1086031788 11:82368044-82368066 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1086266460 11:85004542-85004564 CCTTTGCCTACGTTTTGATGCGG + Intronic
1086322512 11:85664975-85664997 CCTTTCCCTGCATTTCGTTTCGG - Exonic
1086341190 11:85850344-85850366 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1086530956 11:87784556-87784578 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1086555778 11:88109686-88109708 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1086662087 11:89431519-89431541 CCTTTGCCTACTTTTTGATGGGG - Intronic
1086906665 11:92426206-92426228 CCTTTGCCCACTTTTTGTTGGGG + Intronic
1086985669 11:93246486-93246508 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1086995108 11:93347411-93347433 CATTTGCCAGTATTTTGTTGAGG + Intronic
1087186896 11:95209235-95209257 CCTTTGCCCACTTTTTGTTGAGG - Intronic
1087206426 11:95400778-95400800 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1087207357 11:95411118-95411140 CCTTTGCCTGCTTTTCGATGGGG - Intergenic
1088061463 11:105656155-105656177 CCTTTGCCTACTTTTTGATGAGG + Intronic
1088151679 11:106753189-106753211 CCTTTGCCTACTTTTTGATGGGG + Intronic
1088179907 11:107097658-107097680 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1088959097 11:114643082-114643104 CCTTTGCCCACATTTTGATGGGG + Intergenic
1089106444 11:116010212-116010234 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1090740639 11:129657004-129657026 GGATTGCCAGTATTTTGTTGAGG - Intergenic
1090879780 11:130823505-130823527 CCATCCCCTGCACCTTGTTGAGG + Intergenic
1202818432 11_KI270721v1_random:56767-56789 CAATTGCCTGCCTTGTGCTGTGG - Intergenic
1091977562 12:4837574-4837596 CAATTGCTTGCATGTTGGTGGGG + Intronic
1092298916 12:7226401-7226423 CCTTTGCCTTCTTTTTGATGAGG + Intergenic
1092314358 12:7394762-7394784 CCTTTGCCTACTTTTTGATGGGG - Intronic
1092812596 12:12285734-12285756 CCATGGCTAGCAGTTTGTTGTGG + Intergenic
1093418552 12:18948491-18948513 CCATTGCATGCATCTGGTTCAGG - Intergenic
1093521799 12:20059629-20059651 CCTTTGCCCACATTTTGATGGGG + Intergenic
1093546749 12:20357554-20357576 CCATGGCCTGAATTTGGTTTGGG - Intergenic
1093611233 12:21160828-21160850 CCTTTGCCTACATTTTAATGAGG - Intronic
1093695243 12:22151872-22151894 CCTTTGCCTGGTTTTTGATGGGG - Intronic
1094055167 12:26261782-26261804 CTTTTGCCTGCTTTTTGATGGGG - Intronic
1094284782 12:28780902-28780924 CAATTTACTGTATTTTGTTGTGG + Intergenic
1094393834 12:29982770-29982792 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1095415622 12:41973987-41974009 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1095442308 12:42249726-42249748 CCTTTGCCTACTTTTTGATGGGG + Intronic
1095779281 12:46041244-46041266 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1096029432 12:48399072-48399094 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1096856092 12:54484331-54484353 ACTTTCCCTGCATTCTGTTGTGG + Intergenic
1097414665 12:59300208-59300230 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
1097543735 12:60972890-60972912 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
1097975593 12:65683313-65683335 CCATTGCCTTCTTTTTGTTATGG + Intergenic
1098428684 12:70395247-70395269 CCATTGACTTCATTTGGTTAGGG - Intronic
1098475509 12:70897323-70897345 CCTTTGCCTCCTTTTTGATGGGG - Intronic
1098507087 12:71265465-71265487 CCTTTGCCCACATTTTGATGGGG - Intronic
1098623529 12:72635324-72635346 CCTTTGCCTACTTTTTGATGGGG + Intronic
1098736221 12:74109311-74109333 AGTTTGCCAGCATTTTGTTGAGG - Intergenic
1098993426 12:77091293-77091315 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1099275479 12:80570404-80570426 CCTTTGCCCACATTTTGATGGGG + Intronic
1100110736 12:91238852-91238874 CCTTTGCCTGCTTTTTGATGGGG + Intergenic
1100176027 12:92031817-92031839 CCTTCGCCTGCTTTTTGATGGGG - Intronic
1100195633 12:92241303-92241325 CAATTTGCTGCATTTTTTTGTGG + Intergenic
1100381835 12:94069570-94069592 CCTTTGCCCACATTTTGATGGGG - Intergenic
1100399236 12:94213475-94213497 CCTTTGCCTACTTTTTGATGGGG + Intronic
1100463917 12:94828122-94828144 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1100653283 12:96614109-96614131 CGTTTGCCAGCATTTTATTGAGG - Intronic
1100749169 12:97678252-97678274 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1100808768 12:98316073-98316095 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1100941579 12:99728293-99728315 CCTTTGCCCGCTTTTTGATGGGG - Intronic
1101118879 12:101558414-101558436 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1101851926 12:108410157-108410179 CCATTGAATGCATTTCTTTGGGG + Intergenic
1102521911 12:113483073-113483095 CCAATGACTGCATTCTCTTGGGG - Intergenic
1102602563 12:114043193-114043215 CTATTGCCTCCTTTTTGTTGGGG + Intergenic
1102730013 12:115100449-115100471 CCTTTGCCCACATTTTGATGGGG - Intergenic
1103047211 12:117746747-117746769 CCTTTGCCTACTTTTTGATGGGG - Intronic
1103186976 12:118966856-118966878 CCATTGCCCACTTTTTGATGGGG + Intergenic
1103622268 12:122194812-122194834 CCATTTCCTTCATGTTGTTATGG + Intronic
1104126521 12:125851761-125851783 CATTTGCTAGCATTTTGTTGAGG + Intergenic
1104137381 12:125953476-125953498 ACAATCCCTGCATTTTGATGTGG + Intergenic
1104321707 12:127757621-127757643 CCATTGCCCACTTTTTGATGGGG - Intergenic
1105292942 13:19064377-19064399 CATTTGCTGGCATTTTGTTGAGG - Intergenic
1106115789 13:26816422-26816444 CCATTTGTGGCATTTTGTTGCGG - Intergenic
1106653739 13:31719840-31719862 CTATTGCATGCATATTGTGGAGG + Intergenic
1106737505 13:32602916-32602938 CCTTTGCCTACTTTTTGATGGGG + Intronic
1107326814 13:39253124-39253146 CCATTGCTTGCTTTTAGTGGAGG - Intergenic
1107333957 13:39333534-39333556 CCTTTGCCCACATTTTGATGGGG - Intergenic
1108553773 13:51572644-51572666 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1108586496 13:51874602-51874624 CCTTTGCCTGCATTTGGGTGTGG - Intergenic
1109713963 13:66196138-66196160 CCATTGAATTCAGTTTGTTGAGG + Intergenic
1110086340 13:71385383-71385405 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1110397420 13:75047791-75047813 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1111313841 13:86525531-86525553 CCATTGTCTGCATCTTGATTTGG + Intergenic
1112448866 13:99491436-99491458 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1112860554 13:103825089-103825111 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1112983654 13:105419355-105419377 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1114361181 14:21975040-21975062 CCTTTGCCTACATTTTAATGCGG + Intergenic
1115107679 14:29780457-29780479 CCTTTGCCCACTTTTTGTTGGGG - Intronic
1115362765 14:32522507-32522529 CCTTTGCCCACTTTTTGTTGGGG - Intronic
1115390721 14:32851981-32852003 CCATTGCCCACTTTTTGATGGGG + Intergenic
1115446613 14:33498010-33498032 CCTTTGCCTACTTTTTGATGGGG - Intronic
1115461360 14:33664677-33664699 CCTTTGCCTACTTTTTGATGGGG - Intronic
1115763926 14:36603453-36603475 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1115778732 14:36745666-36745688 CCTTTGCCTACTTTTTGATGGGG + Intronic
1116109962 14:40565322-40565344 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1116136283 14:40928076-40928098 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1116197846 14:41752586-41752608 CCTTTGCCCACATTTTGATGGGG + Intronic
1116202333 14:41813984-41814006 CCTTTGCCCGCTTTTTGATGGGG + Intronic
1116362784 14:44022934-44022956 GGATTGCCTGTATTTTATTGAGG + Intergenic
1116537946 14:46059901-46059923 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1116714474 14:48410296-48410318 CCTTTGCCCACATTTTGATGAGG + Intergenic
1116766801 14:49082365-49082387 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1117170532 14:53090042-53090064 CCGTTGCCTACTTTTTGATGAGG - Intronic
1117452015 14:55860903-55860925 ACATTGCTAGCATTTTGTTGAGG + Intergenic
1117711204 14:58531006-58531028 CCTTTGCCCGCTTTTTGATGGGG - Intronic
1117836337 14:59810358-59810380 CTATTGCCTGCATATTATTTGGG + Intronic
1117852948 14:59994179-59994201 CCTTTGCCCGCTTTTTGATGGGG - Intronic
1118123230 14:62869357-62869379 CCTTTGCCTACTTTTTGATGGGG + Intronic
1118307700 14:64669099-64669121 GCAATGCCTGCATGTTTTTGTGG + Intergenic
1119558944 14:75574607-75574629 CCATTGTTTGCCTTTTGTGGCGG + Intergenic
1120065232 14:80032866-80032888 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1120081212 14:80218674-80218696 CCAAACACTGCATTTTGTTGAGG - Intronic
1120487594 14:85133916-85133938 TGAATGGCTGCATTTTGTTGAGG - Intergenic
1120599630 14:86485727-86485749 CCATTCCCTACATTTTTTTGTGG + Intergenic
1120971058 14:90207597-90207619 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1121222071 14:92293394-92293416 CAATGGCCTGCTTTTTGGTGAGG + Intergenic
1202846172 14_GL000009v2_random:178654-178676 CCTTTGCCCACATTTTGATGGGG + Intergenic
1202915631 14_GL000194v1_random:169259-169281 CCTTTGCCCACATTTTGATGGGG + Intergenic
1202877116 14_KI270722v1_random:13782-13804 CCTTTGCCCACATTTTGATGGGG - Intergenic
1125113919 15:36066871-36066893 CCTTTGCCTGAGTTTTGTTTGGG + Intergenic
1125124435 15:36202948-36202970 CTATTGCCTTTATTATGTTGAGG + Intergenic
1125331392 15:38586029-38586051 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1125774200 15:42196486-42196508 CCTTTGCCTACTTTTTGATGGGG - Intronic
1125837847 15:42769427-42769449 CCTTTGCCCACTTTTTGTTGGGG - Intronic
1126278002 15:46907343-46907365 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1126444935 15:48731851-48731873 CCTTTGCCCACTTTTTGTTGGGG - Intronic
1126967671 15:54073704-54073726 CCTTTGCCTACTTTTTGATGGGG + Intronic
1126979461 15:54226197-54226219 TCAGTGCCAGCATTTTATTGAGG + Intronic
1126995186 15:54434898-54434920 CCATTGCCCACTTTTTGATGGGG - Intronic
1127056839 15:55140823-55140845 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1127063297 15:55210390-55210412 CTATTGCCTGTATTTAGGTGTGG + Intronic
1127167307 15:56258651-56258673 TCCTTTCCTCCATTTTGTTGGGG + Intronic
1127317368 15:57809963-57809985 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
1127590513 15:60417560-60417582 CTATTGACTGCATTTTGCTTTGG + Intergenic
1128229444 15:66024559-66024581 CCTTTACATGCATTATGTTGTGG + Intronic
1129562105 15:76581404-76581426 CATTTGCTTGTATTTTGTTGAGG - Intronic
1130875364 15:88009083-88009105 TCATTGTCTGCATGTTTTTGAGG + Intronic
1131853967 15:96572428-96572450 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1131903181 15:97111654-97111676 CCTTTGCCTTCTTTTTGGTGTGG - Intergenic
1131912296 15:97221283-97221305 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1131941445 15:97570667-97570689 ACTTTGCCTGCTTTTTGATGGGG + Intergenic
1133471769 16:6082627-6082649 CTATTGCCAGCATTTGGTTTAGG - Intronic
1134265254 16:12686981-12687003 CCATTGCCCGCTTTCTGATGGGG + Intronic
1134382928 16:13745113-13745135 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1135865481 16:26097902-26097924 CCTTTGCCTACCTTTTGATGGGG - Intronic
1137052932 16:35728554-35728576 ACAATGCCTGCAGTTTGCTGAGG + Intergenic
1138776807 16:59733161-59733183 CATTTGCTAGCATTTTGTTGAGG - Intronic
1139053368 16:63152448-63152470 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1139075666 16:63444073-63444095 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1141047663 16:80730698-80730720 TTATTGCCAGTATTTTGTTGAGG - Intronic
1143947784 17:10609374-10609396 CCAATGCCTGCATTTTCCAGGGG - Intergenic
1144533749 17:16066498-16066520 TCATTGTCTTCATTTTGTAGTGG - Intronic
1145715249 17:27013465-27013487 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1146485640 17:33240407-33240429 CCAGTGGCTGCCTTTTGTTGAGG + Intronic
1146601149 17:34217647-34217669 CCTTTGCCCACATTTTGATGGGG + Intergenic
1148581956 17:48750260-48750282 CCATCGCCAGCATTTTGCCGGGG + Intergenic
1149246931 17:54720233-54720255 CCTTTGCCTACTTTTTGATGAGG - Intergenic
1149411626 17:56414082-56414104 CATTTGCCAGTATTTTGTTGAGG + Intronic
1149897268 17:60438004-60438026 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1150091172 17:62326526-62326548 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1150632820 17:66892099-66892121 CCTTTTCTTGCATTTTGTTTGGG - Intergenic
1150865601 17:68846209-68846231 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1153041522 18:816741-816763 CTGTTGCCTGAATTGTGTTGAGG - Intergenic
1153351905 18:4090412-4090434 CCTTTGCCCGCTTTTTGATGGGG - Intronic
1153454517 18:5265420-5265442 GGTTTGCCAGCATTTTGTTGAGG - Intergenic
1153506816 18:5808953-5808975 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1154933177 18:21022157-21022179 CTATAGCCTACATTTTTTTGTGG - Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1155756922 18:29509826-29509848 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1156143222 18:34141999-34142021 CCTTTGCCCACTTTTTGTTGGGG - Intronic
1156166260 18:34424785-34424807 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1156264322 18:35472425-35472447 CCTTTGCCCGCTTTTTGATGGGG + Intronic
1156538914 18:37890906-37890928 CCATTGCCTGCAATTCCCTGTGG + Intergenic
1156589026 18:38465205-38465227 CCATTGCCTCCATTTGGTGGGGG - Intergenic
1157630223 18:49087941-49087963 CCTGTGCCTGCTTTTTGATGGGG + Intronic
1157659340 18:49425714-49425736 CCTTTGCCTACTTTTTGATGGGG - Intronic
1157931696 18:51830862-51830884 CCATTGCCCACTTTTTGATGGGG - Intergenic
1157938554 18:51899849-51899871 CCTTTGCCTGCTTTTTAATGAGG + Intergenic
1158084468 18:53634623-53634645 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1158788173 18:60740721-60740743 CCATTGCCTGAGTTTAGTTCAGG - Intergenic
1158809388 18:61014267-61014289 GGTTTGCTTGCATTTTGTTGAGG + Intergenic
1158853904 18:61523236-61523258 CCTTTGCCCGCTTTTTGATGTGG - Intronic
1159102741 18:63973313-63973335 CCATTGCCCACTTTTTGATGGGG + Intronic
1159231770 18:65617255-65617277 GGTTTGCCAGCATTTTGTTGAGG + Intergenic
1159339312 18:67114556-67114578 CCTTTGACAGTATTTTGTTGAGG + Intergenic
1159514965 18:69446879-69446901 CCTTTGCCTACTTTTTGATGGGG + Intronic
1159722239 18:71906187-71906209 CCTTTGCCCACATTTTGATGGGG + Intergenic
1160070701 18:75625380-75625402 CCATTGTCTGCTTTTTGGTGTGG + Intergenic
1160264395 18:77327163-77327185 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1162100136 19:8334333-8334355 CAAGAGCCTGCAGTTTGTTGGGG - Exonic
1164124225 19:22296021-22296043 GGTTTGCCAGCATTTTGTTGAGG + Intronic
1164139410 19:22444438-22444460 GCTTTGCCAGTATTTTGTTGAGG + Intronic
1164439313 19:28260210-28260232 CCTTTGCCTACTTTTTATTGGGG - Intergenic
1164663147 19:29997004-29997026 AGTTTGCCAGCATTTTGTTGAGG + Intronic
1164984577 19:32638948-32638970 CCTTTGCCTGAGTTTTGTTCGGG - Intronic
1165236725 19:34428043-34428065 CCTTTGCCTATATTTTTTTGGGG + Intergenic
1165971378 19:39633803-39633825 CCATTGCCCACTTTTTGATGGGG + Intergenic
1166029413 19:40115633-40115655 CCATTTCCTTCTTTTTGTTTTGG + Intergenic
1166914369 19:46185070-46185092 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1167519317 19:49943862-49943884 CCTTTGCCTGCTTTTTAATGTGG - Intronic
1168484358 19:56748257-56748279 CAAGTGCCTGCATTTTATGGCGG - Intergenic
1168541502 19:57214955-57214977 CCTTTGTTTGTATTTTGTTGAGG + Exonic
1202673559 1_KI270710v1_random:19150-19172 CCTTTGCCCACATTTTGATGGGG + Intergenic
925117328 2:1390856-1390878 CCTTTGCCTACTTTTTGATGGGG + Intronic
925605946 2:5660127-5660149 CCTTTGCTTGCATTTTAATGGGG - Intergenic
925672700 2:6328305-6328327 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
925698746 2:6611688-6611710 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
926040701 2:9670559-9670581 CCCTTTCCTGGATTTTTTTGGGG + Intergenic
926392806 2:12411297-12411319 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
926474933 2:13309803-13309825 CCTTTGCCTACTTTTTGATGGGG + Intergenic
927045942 2:19278399-19278421 CCTTTGCCTACGTTTTGATGGGG + Intergenic
927622312 2:24674929-24674951 CCATTCCCTACATTTCTTTGTGG + Intronic
928492684 2:31800595-31800617 CCTTTGCCTACTTTTTGATGGGG - Intergenic
928569431 2:32588530-32588552 CCATTTCCTGCATTTTATTGTGG + Intronic
928766727 2:34655275-34655297 CCTTTGCCTACTTTTTGATGGGG - Intergenic
929280716 2:40075135-40075157 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
929759388 2:44794243-44794265 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
930175537 2:48297520-48297542 CCTTTGCCTACTTTTTGATGGGG + Intergenic
930247021 2:48994550-48994572 CCATTTCCTGTATTATCTTGGGG - Intronic
930359815 2:50363410-50363432 CCTTTGCCCGCCTTTTGATGGGG - Intronic
930958043 2:57227801-57227823 CCATTGCCTGCTTTTTGATGTGG - Intergenic
930965616 2:57320779-57320801 CCTTTGCCTACTTTTTGATGCGG + Intergenic
931125112 2:59266561-59266583 CCAATCCCAGCATCTTGTTGTGG - Intergenic
931532385 2:63230759-63230781 CCTTTGCCTACTTTTTGATGGGG + Intronic
932398105 2:71462060-71462082 CCTTTGCCTGAATTTTGCTTGGG + Intronic
932874502 2:75436309-75436331 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
933067147 2:77811669-77811691 CCTTTGCCTACTTTTTGATGAGG - Intergenic
933197530 2:79409121-79409143 CCTTTGCCCACTTTTTGTTGGGG + Intronic
933300313 2:80533330-80533352 ACATTGCCTTCTTTTTTTTGCGG - Intronic
934622104 2:95818344-95818366 CCTTTGCCCACATTTTGATGGGG + Intergenic
934636995 2:95998843-95998865 CCTTTGCCCGCTTTTTGGTGGGG + Intergenic
934700054 2:96431626-96431648 CCTTTGCCTGAGTTTTGTTTGGG - Intergenic
934890263 2:98061625-98061647 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
935711111 2:105899494-105899516 GGTTTGCCTGTATTTTGTTGAGG + Intergenic
935803171 2:106719202-106719224 GGATTGCCAGTATTTTGTTGAGG + Intergenic
935852571 2:107238717-107238739 CCTTTGCCTACTTTTTGATGGGG - Intergenic
936003549 2:108860697-108860719 CGTTTGCCAGTATTTTGTTGAGG + Intronic
936773784 2:115947724-115947746 CCTTTGCCTACTTTTTGATGGGG + Intergenic
936778325 2:116001244-116001266 CCATTCCCTTCATTTTTTTCTGG - Intergenic
937163887 2:119794287-119794309 CCTTTGCCTGAGTTTTGTTCTGG + Intronic
937297438 2:120818090-120818112 CCTGTGCCTGCATCTGGTTGAGG + Intronic
937397671 2:121552507-121552529 CCTTTGCCTGTATTTTAATGGGG - Intronic
937466980 2:122141718-122141740 CCTTTGCCTACTTTTTGATGGGG + Intergenic
937567597 2:123313733-123313755 CCTTTGCCTACTTTTTGATGGGG - Intergenic
937848365 2:126607285-126607307 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
938199471 2:129361469-129361491 CCTTTGCCAGCATATTATTGTGG - Intergenic
938254256 2:129842527-129842549 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
938272976 2:129992027-129992049 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
938312017 2:130298896-130298918 CCATTTCCTGCCTCTTGTGGTGG + Intergenic
938799447 2:134747333-134747355 CCTTTGCCCGCTTTTTGGTGGGG + Intergenic
939043054 2:137215253-137215275 CCTTTGCCTACTTTTTGATGGGG + Intronic
939058383 2:137390921-137390943 CATTTGCTTGCATTTTGATGAGG + Intronic
939594760 2:144109709-144109731 CCTTTGCCTACTTTTTGGTGGGG - Intronic
939832193 2:147086256-147086278 CCATTTCCCGTATTTTGTGGTGG - Intergenic
940392897 2:153153222-153153244 CCTTTGCCTGCTTTTTAATGAGG + Intergenic
940630019 2:156226410-156226432 TGTTTGCCAGCATTTTGTTGAGG - Intergenic
941054530 2:160771774-160771796 CCTTTGCCTACTTTTTGATGGGG - Intergenic
941797530 2:169616669-169616691 CCTTTGCCCGCTTTTTGATGGGG + Intronic
942127406 2:172841058-172841080 CCATAGCATGCATTTTTCTGGGG - Intronic
942576498 2:177369031-177369053 CCTTAGCCTGCTTTTTGATGGGG + Intronic
942827261 2:180193646-180193668 CCTTTGCCCACATTTTGATGGGG + Intergenic
942858940 2:180586442-180586464 CCTTTGCCTACTTTTTGATGGGG + Intergenic
943011480 2:182455075-182455097 CCTTTGCCCACATTTTGATGGGG - Intronic
943584058 2:189717255-189717277 CCTTTGCCCGCTTTTTGATGGGG - Intronic
943970141 2:194394015-194394037 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
944327723 2:198426448-198426470 CCTTTGCCTACTTTTTGATGGGG + Intronic
944485995 2:200206212-200206234 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
944612727 2:201427989-201428011 CCTTTGCCTACTTTTTGATGGGG + Intronic
944715394 2:202372296-202372318 ACATTGTCTGCCTTTTGTCGTGG + Intergenic
945110930 2:206358726-206358748 CATTTGCTGGCATTTTGTTGAGG - Intergenic
945355697 2:208836880-208836902 CCTTTGCCCACTTTTTGTTGGGG - Intronic
945484980 2:210384084-210384106 AGTTTGCCTGTATTTTGTTGAGG - Intergenic
946205565 2:218104948-218104970 GGTTTGCCTGTATTTTGTTGAGG + Intergenic
947137117 2:226986499-226986521 CCTTTACCTGCTTTTTGATGGGG - Intronic
1169700851 20:8444871-8444893 CCTTTGCCTACTTTTTGATGAGG + Intronic
1169796312 20:9466598-9466620 CCTTTGCCTACTTTTTGATGGGG - Intronic
1170082962 20:12496911-12496933 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1170186687 20:13598846-13598868 CCTTTGCCTACTTTTTGATGGGG - Intronic
1171193944 20:23182091-23182113 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1171937627 20:31290359-31290381 AGTTTGCCAGCATTTTGTTGAGG - Intergenic
1172309897 20:33909600-33909622 CCATGGGCTCCATTTTGTTCGGG - Intergenic
1173068107 20:39734066-39734088 CCATAGTCTGCATTTCTTTGTGG - Intergenic
1173272310 20:41548811-41548833 CCTTTGCCTACTTTTTGATGGGG - Intronic
1173471642 20:43328020-43328042 CCTTTGGCTGCTTTTTGATGGGG + Intergenic
1174877494 20:54243311-54243333 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1175445164 20:59015004-59015026 GCAGTGCCTGCATTTAGGTGAGG - Intergenic
1176634983 21:9183906-9183928 CCTTTGCCCACATTTTGATGGGG + Intergenic
1176638387 21:9271226-9271248 CCTTTGCCCACATTTTGATGGGG - Intergenic
1176916702 21:14634485-14634507 CCTTTGCCTACTTTTTGATGGGG - Intronic
1177510725 21:22084198-22084220 TCACTGCCTACATTTTGCTGAGG + Intergenic
1177514725 21:22134606-22134628 CCAGTGGCTGAATTTTGATGTGG + Intergenic
1178937576 21:36876238-36876260 CCTTTGCCTGAGTTTTGTTCGGG - Intronic
1179032577 21:37733409-37733431 CCTTTGCCTGGGTTTTGTGGAGG + Intronic
1179322647 21:40307251-40307273 CCTTTGCCTACTTTTTGATGGGG - Intronic
1179770043 21:43608268-43608290 CCTTTGCCTGCTTTTTAATGAGG - Intronic
1180112278 21:45665867-45665889 CGATTGCTAGTATTTTGTTGGGG - Intronic
1180370587 22:12032185-12032207 CCTTTGCCCACATTTTGGTGGGG + Intergenic
1180377362 22:12106640-12106662 CCATTGCCCACTTTTTGATGGGG + Intergenic
1180422429 22:12878723-12878745 CCTTTGCCCACATTTTGATGGGG - Intergenic
1182811069 22:33116996-33117018 CCATTGCCAGCAGTTTCCTGGGG - Intergenic
1183165041 22:36141133-36141155 AAAATGCCTGCATTTTGTCGTGG + Exonic
1183516573 22:38270326-38270348 TCACTGTCTGCATTTTGTAGGGG - Intronic
1184494867 22:44833563-44833585 GCTTTGCTTGTATTTTGTTGAGG + Intronic
949406979 3:3724547-3724569 CCTTTGCCCACTTTTTGTTGGGG - Intronic
949421214 3:3868038-3868060 CCTTTGCCTGCTTTTTGATGGGG - Intronic
949597141 3:5559968-5559990 GCAGTGCCTGGAATTTGTTGAGG + Intergenic
949617958 3:5775783-5775805 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
949678492 3:6485733-6485755 CCTTTGCCTACTTTTTGATGGGG + Intergenic
950207759 3:11093501-11093523 CCTTTGCCTGCATTTTGCTCTGG - Intergenic
950408494 3:12819345-12819367 CCATTCACTGCATTGTGCTGGGG + Intronic
950637159 3:14323402-14323424 CCCTTGCCTGCATAATCTTGTGG + Intergenic
950989854 3:17421890-17421912 ATATTGCCTGTATGTTGTTGAGG - Intronic
951172484 3:19557829-19557851 CCTTTGCCTACTTTTTGATGGGG + Intergenic
953264627 3:41374383-41374405 CATTTGCCAGCATTTTGTTGAGG - Intronic
953491491 3:43356126-43356148 GGCTTGCCAGCATTTTGTTGAGG - Intronic
953565918 3:44031998-44032020 CCTTTCCTCGCATTTTGTTGTGG - Intergenic
954175732 3:48844155-48844177 CCTTTGCCCGCTTTTTGATGGGG - Intronic
954900788 3:54017675-54017697 CCGTTGCCTGCTTTTTAATGGGG - Intergenic
955174563 3:56600804-56600826 CCTTTGCCTACTTTTTGATGGGG + Intronic
955303514 3:57807188-57807210 CCTTTGCCTGCTTTTTGATGGGG + Intronic
955464424 3:59221659-59221681 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
955491913 3:59491300-59491322 CCTTTGCCTACATTTTTATGGGG + Intergenic
955813041 3:62811419-62811441 CCAATGCATGCATTTTCTTGAGG - Intronic
956079526 3:65543073-65543095 CCTTTGCCTACTTTTTGATGGGG - Intronic
956154018 3:66274569-66274591 CCTTTGCCTACTTTTTGATGGGG - Intronic
956583542 3:70840145-70840167 CCATTGTCTGGCTTTTGTTTTGG + Intergenic
956912848 3:73838125-73838147 GGTTTGCCAGCATTTTGTTGAGG - Intergenic
956965186 3:74451336-74451358 CCATTGCCCCCTTTTTGATGGGG + Intronic
957108129 3:75917859-75917881 CCTTTGCCTACTTTTTGATGGGG + Intronic
957126991 3:76174185-76174207 CCTTTGCCTGCTTTTTGATGGGG + Intronic
957696027 3:83638876-83638898 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
958064033 3:88519813-88519835 CCTTTGCTAGTATTTTGTTGAGG + Intergenic
958460293 3:94385927-94385949 CCTTTGCCTACTTTTTGATGGGG - Intergenic
958506467 3:94984922-94984944 CCATTGCCCACTTTTTGATGGGG + Intergenic
958554013 3:95650386-95650408 CCTTTGCCTACTTTTTGATGGGG - Intergenic
958744917 3:98121753-98121775 TGTTTGCTTGCATTTTGTTGAGG - Intergenic
958769126 3:98405770-98405792 GGTTTGCCAGCATTTTGTTGAGG - Intergenic
958924058 3:100138507-100138529 CCTTTGCCTACTTTTTGATGGGG - Intronic
959041472 3:101427086-101427108 GATTTGCCTGTATTTTGTTGAGG - Intronic
959365495 3:105452895-105452917 CCTTTGCCCGCTTTTTGATGGGG + Intronic
960227025 3:115180240-115180262 TAATTGGCTGGATTTTGTTGAGG - Intergenic
960304022 3:116039500-116039522 CCAGTGCCTGTATTTTATGGAGG + Intronic
960415870 3:117384026-117384048 ATATAGCCTGTATTTTGTTGAGG - Intergenic
960476659 3:118138733-118138755 CCGTTGCCCACATTTTGATGGGG + Intergenic
961485356 3:127212046-127212068 CCATTCCCAGCATTTTCTTAAGG - Intergenic
961561382 3:127732794-127732816 ACATTGGCTGCCATTTGTTGTGG - Intronic
961996480 3:131249758-131249780 TCATTCCCACCATTTTGTTGAGG - Intronic
962180600 3:133202122-133202144 CCTTTGCCTACTTTTTGATGGGG + Intronic
962513969 3:136131331-136131353 CCTTTGCCTACTTTTTGATGGGG - Intronic
962645593 3:137435845-137435867 CCTTTGCCTACTTTTTGATGGGG - Intergenic
962667169 3:137665881-137665903 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
962944765 3:140157141-140157163 AGATTGCTAGCATTTTGTTGAGG + Intronic
963580866 3:147125026-147125048 CCTTTGCCTACTTTTTGGTGGGG + Intergenic
963657437 3:148075060-148075082 CCATGGGCTGCATTTTGCAGGGG + Intergenic
963695299 3:148559739-148559761 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
963839075 3:150086598-150086620 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
964007302 3:151847095-151847117 CCTTTGCCTACTTTTTGATGGGG + Intergenic
964254903 3:154765648-154765670 CCTTTGCCTGAGTTTTGCTGAGG + Intergenic
964516136 3:157510542-157510564 CCTTTGCCTACTTTTTGATGGGG - Intronic
964779977 3:160326421-160326443 ACTTTGCCAGTATTTTGTTGAGG - Intronic
965039274 3:163485277-163485299 CCTTTGCCTACTTTTTGATGGGG - Intergenic
965076238 3:163980274-163980296 CCTTTGCCTACTTTTTGATGGGG + Intergenic
965654583 3:170970287-170970309 CCTTTGCCTACTTTTTGATGGGG + Intergenic
965739479 3:171858741-171858763 CCTTTGCCTACTTTTTGATGTGG - Exonic
966010490 3:175069330-175069352 CCTTTGCCCGCTTTTTGATGGGG - Intronic
966250159 3:177856867-177856889 CTTTTGCCAGCATTTTATTGAGG + Intergenic
966644190 3:182224872-182224894 AGCTTGCCAGCATTTTGTTGAGG + Intergenic
967373664 3:188776611-188776633 CCATTGGCTGTGTTTTCTTGTGG - Intronic
967604042 3:191423216-191423238 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
967758563 3:193198013-193198035 CCTTTGCCTACTTTTTGATGGGG + Intergenic
967830462 3:193914614-193914636 CCCTTGCCTGAAGTTTATTGAGG - Intergenic
968017772 3:195354504-195354526 CCTTTGCCTGCTTTTTAATGGGG + Intronic
968072258 3:195792299-195792321 CCTTTGCCTGCTTTTTGATGGGG - Intronic
968072734 3:195796723-195796745 TCTTAGCCTGCATTTTTTTGTGG - Intronic
1202748509 3_GL000221v1_random:133795-133817 CCTTTGCCCACATTTTGATGGGG + Intergenic
969123691 4:4929913-4929935 CCTTTGCCTACTTTTTGATGGGG - Intergenic
969165658 4:5308746-5308768 GTATGGCCTTCATTTTGTTGAGG - Intronic
969899075 4:10331873-10331895 CCTTCGCCTGCTTTTTGATGGGG + Intergenic
970027918 4:11643376-11643398 CCTTTGCCTACTTTTTGATGGGG + Intergenic
970572277 4:17394536-17394558 CAATTGCCTTCATTTTTCTGTGG - Intergenic
971587899 4:28428909-28428931 ATATGGCCTGCATTATGTTGAGG + Intergenic
971648156 4:29234942-29234964 CCTTTGCCCACATTTTGATGGGG - Intergenic
973010073 4:45061904-45061926 CCTTTGCCTACTTTTTGATGGGG - Intergenic
973032879 4:45365811-45365833 CCAGTACCTGAATTTTGGTGGGG + Intergenic
973116321 4:46464544-46464566 CCTTTGCCCACTTTTTGTTGGGG + Intronic
973224620 4:47768571-47768593 GGTTTGCCAGCATTTTGTTGAGG - Intronic
974218150 4:58928194-58928216 CCTTTGCCTACTTTTTGATGGGG + Intergenic
974248660 4:59357177-59357199 AGATTGCCAGTATTTTGTTGAGG + Intergenic
974346811 4:60692990-60693012 CCTTTGCCTACTTTTTGATGGGG - Intergenic
974845210 4:67343479-67343501 TCATTTCCTGCCTTTTTTTGTGG - Intergenic
975016396 4:69425941-69425963 CCTTAGCCTACATTTTGTTGGGG + Intergenic
975069217 4:70112241-70112263 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
975479784 4:74865120-74865142 CCTTTGCCTACTTTTTGATGGGG - Intergenic
975680474 4:76870427-76870449 CCTTTGCCTGCTTTTTAATGAGG - Intergenic
975750639 4:77519540-77519562 CCTTTGCCTACTTTTTGATGGGG + Intronic
975842750 4:78492972-78492994 CCTTTGCCTACTTTTTGATGGGG - Intronic
975935759 4:79578006-79578028 CCATTGCCTTTATTTCATTGAGG + Intergenic
975935801 4:79578689-79578711 CCATTGCCAGAACTTTGTTGTGG - Intergenic
976330329 4:83824112-83824134 CCTTTGCCTACTTTTTGATGGGG - Intergenic
976953947 4:90870581-90870603 TGTTTGCCAGCATTTTGTTGAGG + Intronic
977155657 4:93569514-93569536 CCATTTTCTGCATTTTCCTGAGG + Intronic
977519218 4:98059659-98059681 CATTTGCCAGTATTTTGTTGAGG - Intronic
977631013 4:99243043-99243065 CCTTTGCCTACTTTTTGATGGGG + Intergenic
977946950 4:102924723-102924745 CCTTTGCCTACTTTTTGATGGGG - Intronic
979148688 4:117279400-117279422 CCCTTGCCAGCTTTTTGATGGGG + Intergenic
979925417 4:126557003-126557025 CCTTTGCCTACTTTTTGATGGGG - Intergenic
979967430 4:127091925-127091947 AGCTTGCCAGCATTTTGTTGAGG - Intergenic
980147814 4:129011313-129011335 CATTTGCCAGTATTTTGTTGAGG + Intronic
980201070 4:129656813-129656835 CCTTTGCCTACTTTTTGATGGGG - Intergenic
980306125 4:131063958-131063980 CCTTTGCCTGGCTTTTGTTCTGG + Intergenic
980531744 4:134065416-134065438 CCTTTGCCTGCTTTTTCATGAGG + Intergenic
980548037 4:134295276-134295298 GGTTTGCCTGTATTTTGTTGAGG - Intergenic
980574250 4:134665484-134665506 CCTTTGCCTGCATTTTGCTTGGG + Intergenic
980730812 4:136823043-136823065 CCTTTGCCTGAATTTTGCTTGGG + Intergenic
980848435 4:138352534-138352556 CCTTTGCCTACTTTTTGATGGGG - Intergenic
981132043 4:141168113-141168135 CCTTTGCCCGCTTTTTGATGGGG - Intronic
981202714 4:142000238-142000260 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
981221803 4:142245481-142245503 CCATTGCCAGTATTTTATTGAGG + Intronic
981376992 4:144027397-144027419 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
981409089 4:144406801-144406823 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
981889062 4:149715139-149715161 CCTTTGCCTGAGTTTTGCTGGGG + Intergenic
982120908 4:152142841-152142863 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
982181230 4:152750331-152750353 CCTTTGCCTGCTTTTTGATGGGG - Intronic
982924489 4:161318849-161318871 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
983000426 4:162408305-162408327 CCTTTGCCTGAATTTTGCTCTGG + Intergenic
983081601 4:163392037-163392059 TCATTTCCTGCATTTAATTGAGG + Intergenic
983673377 4:170264101-170264123 CCTTTGCCTGCTTTTTGATGGGG + Intergenic
983899310 4:173116595-173116617 GGTTTGCCAGCATTTTGTTGAGG - Intergenic
984163309 4:176280225-176280247 CCCTTGCCTCCTTTTTGATGGGG + Intergenic
984522478 4:180818138-180818160 TCATTGCCTGGATGTTTTTGAGG + Intergenic
985205004 4:187526048-187526070 ACTTTGCCTACTTTTTGTTGGGG - Intergenic
1202753282 4_GL000008v2_random:29638-29660 CCTTTGCCCACATTTTGATGGGG - Intergenic
1202758970 4_GL000008v2_random:92099-92121 CCATTGCCCACTTTTTGATGGGG + Intergenic
986467818 5:8044503-8044525 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
986932515 5:12843776-12843798 CCTTTGCCTGATTTTTGATGGGG + Intergenic
987157005 5:15098754-15098776 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
987174885 5:15297257-15297279 CCTTTGCCTACTTTTTGATGGGG - Intergenic
987180370 5:15361419-15361441 CCATTGCCCACTTTTTGATGGGG - Intergenic
987238602 5:15969293-15969315 CCATTCCCTGCATGGTCTTGAGG - Intergenic
987653533 5:20775869-20775891 CCTTTGCCTACTTTTTGATGGGG + Intergenic
987725692 5:21696137-21696159 CCCTTGCCTACTTTTTGATGGGG + Intergenic
987808871 5:22806798-22806820 CCTTTGCCTACTTTTTGATGGGG + Intronic
988270210 5:29004096-29004118 ATCTTGCCTGCATTTTTTTGTGG - Intergenic
988614067 5:32756425-32756447 CCTTTGCCTACTTTTTGATGGGG + Intronic
988665235 5:33320036-33320058 GCATTTCCTGTATTTTGCTGAGG + Intergenic
988719664 5:33864156-33864178 CCTTTGCCTACTTTTTGATGGGG - Intronic
988742040 5:34085607-34085629 CCTTTGCCTACTTTTTGATGGGG - Intronic
989784362 5:45309761-45309783 TGTTTGCCAGCATTTTGTTGAGG + Intronic
989951780 5:50307920-50307942 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
990163655 5:52971490-52971512 CCTTTGCCCGCTTTTTGATGCGG + Intergenic
990195107 5:53305981-53306003 CCTTTGCCTACTTTTTGATGGGG + Intergenic
990381850 5:55227063-55227085 GCAGTGCCAGCATTCTGTTGGGG + Exonic
991199208 5:63971499-63971521 CCTTTGCCCACATTTTGATGGGG + Intergenic
991219562 5:64197487-64197509 CCATTGCCTTGATTTTGCTAAGG - Intronic
991224051 5:64248422-64248444 CCTTTGCCTGCTTTTTGATGAGG - Intronic
991633979 5:68684592-68684614 CGATGCCTTGCATTTTGTTGGGG + Intergenic
991951527 5:71951048-71951070 CCTTTGCCTACTTTTTGATGGGG + Intergenic
992316489 5:75561328-75561350 CCTTTGCCTGCTTTTTGATGGGG + Intronic
992453926 5:76898694-76898716 GGTTTGCCAGCATTTTGTTGAGG + Intronic
992634561 5:78715052-78715074 CCTTTGCCTACTTTTTGATGGGG - Intronic
993079083 5:83273247-83273269 CCTTTGCCTACTTTTTGATGGGG + Intronic
993268875 5:85767179-85767201 GATTTGCCTGTATTTTGTTGAGG + Intergenic
993359653 5:86958549-86958571 CCTTTGCCTACTTTTTGATGGGG - Intergenic
993779448 5:92047886-92047908 CGTTTGCTTGAATTTTGTTGAGG + Intergenic
994160784 5:96554721-96554743 CCTTTGCCCGTTTTTTGTTGGGG - Intronic
994262400 5:97675383-97675405 GCTTTGCCAGTATTTTGTTGAGG - Intergenic
994785047 5:104148786-104148808 GCTTTGCCAGTATTTTGTTGTGG - Intergenic
995268266 5:110190645-110190667 CCATTGCTAGTATTTTGTTAAGG + Intergenic
995335311 5:110991762-110991784 CCATTGCTTGTTTTTTTTTGGGG - Intergenic
995593593 5:113725090-113725112 CCTTTGCCTACTTTTTGATGGGG + Intergenic
995897656 5:117033435-117033457 CCTTTGACTGCATATTGTTCAGG + Intergenic
997190233 5:131926431-131926453 CAATTGCTAGTATTTTGTTGAGG + Intronic
997886251 5:137632824-137632846 CCTTTGCCTGCTTTTTAATGGGG - Intronic
999027153 5:148246511-148246533 ACACTGCCTTTATTTTGTTGAGG + Intergenic
999134487 5:149309410-149309432 CAATTGCTAGCATTTTGTTCAGG + Intronic
999995105 5:157084802-157084824 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1001149244 5:169212441-169212463 CCTTTGCCCACTTTTTGTTGGGG + Intronic
1001354418 5:171005914-171005936 CCTTTGCCTACTTTTTGATGGGG - Intronic
1002409625 5:179063203-179063225 CCATTTCCTCAATTTTGGTGGGG + Intronic
1003200334 6:3954207-3954229 GGTTTGCCTGCATTTTGTTGAGG + Intergenic
1003371802 6:5535672-5535694 ACATTGTCTTTATTTTGTTGAGG + Intronic
1003797867 6:9625615-9625637 CTTTTTCCTGCATTTTCTTGTGG + Intronic
1004103760 6:12643763-12643785 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1004190522 6:13459668-13459690 CCTTTGCCTACTTTTTGATGGGG - Intronic
1004198756 6:13529118-13529140 GCATTGCCTGTATTGTTTTGGGG - Intergenic
1004289845 6:14356562-14356584 CCTTTGCCCACATTTTGATGGGG + Intergenic
1004977431 6:20984001-20984023 CCATTGCCACCATTGTGCTGTGG + Intronic
1005745273 6:28831373-28831395 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1006041053 6:31255299-31255321 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1006999276 6:38293990-38294012 CCTTTGCATGCTTTTTGATGGGG - Intronic
1007284437 6:40737495-40737517 CCAATGTCTCCATTTTGCTGTGG - Intergenic
1007338609 6:41173600-41173622 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1008083316 6:47217488-47217510 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1008183179 6:48358896-48358918 ACTTTGCCAGTATTTTGTTGAGG - Intergenic
1010298144 6:74224784-74224806 ACATTTCCTGCATTTTGCTAAGG + Intergenic
1010626945 6:78148874-78148896 ATATGGCCTGCATTGTGTTGAGG - Intergenic
1010820231 6:80406678-80406700 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1010997192 6:82547375-82547397 GCTTTGCCAGCATTTTATTGAGG + Intergenic
1011098463 6:83694203-83694225 GCATTTCCTGCATTTGGATGAGG + Intronic
1011174488 6:84544944-84544966 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1011297812 6:85842265-85842287 CCTTTGCCCACATTTTGATGGGG + Intergenic
1011380360 6:86736398-86736420 CCTTTGCCCACATTTTGATGGGG - Intergenic
1011874392 6:91939110-91939132 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1011925602 6:92640874-92640896 CCTTTGCCCACATTTTGATGGGG - Intergenic
1012020236 6:93908722-93908744 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1012190308 6:96271507-96271529 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
1012489475 6:99764867-99764889 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1012598592 6:101068419-101068441 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1012770625 6:103429036-103429058 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1012931680 6:105323839-105323861 CCATTGCTGGCATTTGGTTGTGG - Intronic
1013009162 6:106104611-106104633 CCATTGTCCGCATTTTGCTGAGG + Intronic
1013390793 6:109684569-109684591 CCTTTGCCTACTTTTTGATGGGG - Intronic
1013860252 6:114626895-114626917 CCTTTGCCTGCTTTTTAATGGGG + Intergenic
1014192564 6:118514618-118514640 CCAATGTCTGCCTTTTGTTTGGG - Intronic
1014227878 6:118868584-118868606 CCTTTGCCCGCTTTTTGATGGGG - Intronic
1014364814 6:120525933-120525955 AGTTTGCCTGCATTTTGTTGAGG + Intergenic
1014368944 6:120580994-120581016 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1014418602 6:121214293-121214315 CCTTTGCCTGAATTTTGCTCAGG + Intronic
1014462083 6:121708244-121708266 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1015007403 6:128300041-128300063 CCTTTGCCCACTTTTTGTTGGGG - Intronic
1015096065 6:129416678-129416700 CCTTTGCCTGAGTTTTGCTGAGG + Intronic
1015983373 6:138861552-138861574 CCTTTGCCCACATTTTGATGGGG + Intronic
1016140069 6:140597505-140597527 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1016249471 6:142022386-142022408 CCAGTTCCTGCAGTTAGTTGAGG + Intergenic
1017204272 6:151788271-151788293 CCTTTGCCTGCTTTTTAATGAGG - Intronic
1018659824 6:166076014-166076036 CCTTTGCCTGAGTTTTGCTGAGG + Intergenic
1019787318 7:2985369-2985391 CCAGTGCCTCCCTTTTGCTGTGG - Intronic
1020491845 7:8795483-8795505 ACATTGCCTGGATATTGTTTTGG - Intergenic
1020620055 7:10506259-10506281 CCTTTGCCTGCTTGTTGATGGGG - Intergenic
1020649407 7:10855918-10855940 CCTTTGCCTGAATTTTGCTTGGG - Intergenic
1020735552 7:11944829-11944851 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1020775411 7:12448240-12448262 ACATGGCCTTCATTATGTTGAGG - Intergenic
1021321543 7:19218767-19218789 CCTTTGCCCACATTTTGATGGGG - Intergenic
1023035166 7:36125271-36125293 CCTTTGCCCACATTTTGATGGGG - Intergenic
1023348726 7:39298330-39298352 CCTTTGCCCACATTTTGATGGGG - Intronic
1024944325 7:54793534-54793556 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1025045516 7:55688971-55688993 CCACTGCCTGCCTTTTTCTGGGG + Intergenic
1027127708 7:75568614-75568636 CTATTGCCTGCATTTGTTTTAGG + Intronic
1027946544 7:84753140-84753162 GAATTGCTAGCATTTTGTTGAGG - Intergenic
1028048594 7:86153840-86153862 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
1028083296 7:86603322-86603344 ACTTTGCCAGTATTTTGTTGAGG - Intergenic
1028181099 7:87725913-87725935 CCTTTGCCCACTTTTTGTTGGGG + Intronic
1028287142 7:89016159-89016181 CCTTTGCCTACTTTTTGATGGGG + Intronic
1028544490 7:91983008-91983030 CCTTTGCCTGTTTTTTGATGGGG + Intronic
1028633370 7:92960569-92960591 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1030477781 7:110059549-110059571 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1031411961 7:121450013-121450035 CAATTGCCTTCACTTTGTTGTGG - Intergenic
1032824086 7:135552226-135552248 CCATTTGCTGCATTGTGCTGTGG + Intergenic
1033612675 7:142980638-142980660 CATTTGCCAGTATTTTGTTGAGG + Intergenic
1034039634 7:147863752-147863774 CCTTTGCCCGCTTTTTGATGGGG + Intronic
1034225157 7:149475802-149475824 CCATTCCCTGCACTGTGGTGGGG - Intronic
1035492170 7:159289828-159289850 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1037137389 8:15479104-15479126 CCTTTGCCTGCTTTTTAATGGGG + Intronic
1037422164 8:18714450-18714472 CCTTTGCCTGCTTTTTGATGGGG - Intronic
1038074169 8:24051252-24051274 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1038212162 8:25528895-25528917 CCTTTGCCCACATTTTGATGTGG - Intergenic
1039018912 8:33183953-33183975 CCATAGCATGCATATTGTAGGGG - Intergenic
1040864103 8:52030936-52030958 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1041240367 8:55844215-55844237 TCATTGGCTACATTTTGCTGAGG + Intergenic
1041580819 8:59457652-59457674 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1041805593 8:61845818-61845840 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1041891625 8:62876142-62876164 CCTTTGCCCGCTTTTTGATGGGG - Intronic
1041972143 8:63755907-63755929 CCTTTGCCTACTTTTTGATGAGG + Intergenic
1042288297 8:67139161-67139183 CCTTTGCCTACTTTTTGATGGGG - Intronic
1042489849 8:69384791-69384813 GGTTTGCCTGTATTTTGTTGAGG - Intergenic
1043497856 8:80822869-80822891 CCTTTGCCTACTTTTTGATGGGG + Intronic
1043616781 8:82135217-82135239 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1043802875 8:84633018-84633040 CAATTGGCTGCATTTTTTTCTGG + Intronic
1043829652 8:84972179-84972201 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1043831830 8:84998568-84998590 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1044127655 8:88477942-88477964 GGTTTGCCTGTATTTTGTTGAGG - Intergenic
1044252862 8:90024540-90024562 CCTTCGCCTACTTTTTGTTGGGG + Intronic
1044786189 8:95796061-95796083 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
1045103763 8:98870664-98870686 CCTTTGCCCACTTTTTGTTGGGG + Intronic
1045610933 8:103840406-103840428 ACATTGCATTCATATTGTTGTGG + Intronic
1045794665 8:106028614-106028636 CCTTTGCCTGCTTTTTGGTGGGG - Intergenic
1045795500 8:106038751-106038773 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1045882746 8:107060516-107060538 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1046167386 8:110454331-110454353 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1046863514 8:119120674-119120696 CCTTTGCCCACATTTTGATGGGG - Intergenic
1047549433 8:125853781-125853803 ACAATGCCTGCTTTTTGATGAGG - Intergenic
1047842158 8:128765152-128765174 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1047895196 8:129358785-129358807 ACATTGCGTGGATTGTGTTGAGG - Intergenic
1048824018 8:138406036-138406058 CCTTTGCCTACTTTTTGATGGGG + Intronic
1048932239 8:139324393-139324415 CCAAAGCCTGCATTTAGATGAGG + Intergenic
1049133384 8:140870640-140870662 CCTTTGCTTGCAGTTTGTTAAGG - Intronic
1049384721 8:142337340-142337362 CAAATGTTTGCATTTTGTTGTGG - Intronic
1050294073 9:4186821-4186843 CCATTGCCCACTTTTTGATGGGG + Intronic
1050481707 9:6094791-6094813 CATTTGCCAGTATTTTGTTGAGG + Intergenic
1050492873 9:6207842-6207864 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1050656702 9:7836542-7836564 CCTTTGCCTACGTTTTGATGGGG + Intronic
1051290223 9:15537973-15537995 ACATTGCTTGCATTTTAGTGAGG - Intergenic
1051324774 9:15953571-15953593 CAGTTGCTTGTATTTTGTTGAGG + Intronic
1051387476 9:16524483-16524505 CCATTTCCTGTTTTTTTTTGGGG + Intronic
1051479893 9:17548302-17548324 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1051492458 9:17681865-17681887 CCTTTGCCTACTTTTTGATGGGG - Intronic
1051528335 9:18072402-18072424 CATTTGCCTGCATCTTGTAGAGG + Intergenic
1051615695 9:19004052-19004074 CCTTTGCCTGCTTTTTGATGGGG - Intronic
1051943245 9:22534415-22534437 CCATTGCCCACTTTTTGATGGGG - Intergenic
1052276533 9:26683002-26683024 CATTTACCTGCATTTTGTTTGGG - Intergenic
1052584609 9:30410545-30410567 ACATAGCCTTCATTGTGTTGAGG + Intergenic
1052601460 9:30637587-30637609 CCTTTGCCCACATTTTGATGGGG + Intergenic
1052722964 9:32194450-32194472 CCATTACTTGCATTTGGTAGAGG - Intergenic
1053571222 9:39309935-39309957 CCTTTGCCCACATTTTGATGGGG - Intergenic
1053837112 9:42150548-42150570 CCTTTGCCCACATTTTGATGGGG - Intergenic
1054092788 9:60868638-60868660 CCTTTGCCCACATTTTGATGGGG - Intergenic
1054114260 9:61144544-61144566 CCTTTGCCCACATTTTGATGGGG - Intergenic
1054125923 9:61309077-61309099 CCTTTGCCCACATTTTGATGGGG + Intergenic
1054593493 9:67037968-67037990 CCTTTGCCCACATTTTGATGGGG + Intergenic
1055494699 9:76842652-76842674 CCTTTGCCTAGTTTTTGTTGGGG - Intronic
1056592873 9:87978104-87978126 GCATGGCCTGTATTATGTTGAGG - Intergenic
1056618133 9:88186236-88186258 GCATTGGCTGCCTTTTGTTCTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057599877 9:96449019-96449041 CCAGAGCCTGTATTTTGTTCAGG - Intergenic
1057984204 9:99693058-99693080 CCATTGACTTCATTCTGTTGCGG - Intergenic
1058353617 9:104056562-104056584 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1058386104 9:104437676-104437698 CCTTTGCCCACATTTTGATGGGG + Intergenic
1058529903 9:105895246-105895268 CCTTTGCCCACATTTTGATGGGG + Intergenic
1059056092 9:110981792-110981814 CCTTTGCCTACTTTTTGATGAGG - Intronic
1059070088 9:111126218-111126240 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1059596713 9:115728682-115728704 CCATTGCTTGGGTTTTGGTGAGG - Intergenic
1060177622 9:121508626-121508648 CCACTGACTGCCTTTTGTTCTGG + Intergenic
1060680575 9:125559772-125559794 CTACTGCCTGCATATTGCTGAGG - Exonic
1203757765 Un_GL000218v1:151208-151230 CCTTTGCCCACATTTTGATGGGG + Intergenic
1203408552 Un_KI270538v1:71080-71102 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1203717147 Un_KI270742v1:163885-163907 CCTTTGCCCACATTTTGATGGGG + Intergenic
1203534068 Un_KI270743v1:14347-14369 CCTTTGCCCACATTTTGATGGGG - Intergenic
1203539753 Un_KI270743v1:76998-77020 CCATTGCCCACTTTTTGATGGGG + Intergenic
1203651375 Un_KI270751v1:127472-127494 CCTTTGCCCACATTTTGATGGGG + Intergenic
1186130563 X:6461236-6461258 CCAGTGGATGCATTTTGTGGGGG - Intergenic
1186240135 X:7556571-7556593 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1186730979 X:12409130-12409152 CCATTACATGCCTTCTGTTGTGG - Intronic
1187222573 X:17343303-17343325 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1187316304 X:18198371-18198393 CCTTTGCCTACTTTTTGATGGGG - Intronic
1188150899 X:26673752-26673774 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1188198172 X:27264695-27264717 CCTTTGCCCACTTTTTGTTGGGG - Intergenic
1188474391 X:30574573-30574595 CCATTGCCTCCATTTGTGTGTGG - Intronic
1188664380 X:32801347-32801369 CCTTTGCCTACTTTTTGATGGGG + Intronic
1188711470 X:33405860-33405882 GGCTTGCCAGCATTTTGTTGAGG + Intergenic
1188712863 X:33422975-33422997 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1188738503 X:33747800-33747822 GCTTTGCCAGTATTTTGTTGAGG + Intergenic
1188954296 X:36415926-36415948 CCATTGCCCACTTTTTGATGGGG + Intergenic
1188977825 X:36696710-36696732 CCTTTGCCCACATTTTGATGAGG + Intergenic
1189270428 X:39747669-39747691 CCATTGCCTGCATCATTTGGAGG + Intergenic
1189611181 X:42737699-42737721 CCTTTGCCTGCTTTTTAATGGGG - Intergenic
1189939731 X:46109163-46109185 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1190080108 X:47350053-47350075 TCATTGCCTTTCTTTTGTTGTGG + Intergenic
1190375017 X:49780640-49780662 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1190424641 X:50322737-50322759 CCTTTGCCCGCTTTTTGATGGGG - Intronic
1190599401 X:52074233-52074255 GGATTGCCAGTATTTTGTTGAGG + Intergenic
1190609423 X:52179840-52179862 GGATTGCCAGTATTTTGTTGAGG - Intergenic
1191003982 X:55690630-55690652 CGTTTGCCAGTATTTTGTTGAGG - Intergenic
1191049196 X:56172928-56172950 CCTTTGCCTGGTTTTTGATGGGG + Intergenic
1191118289 X:56874294-56874316 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1191181450 X:57568104-57568126 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1191190733 X:57664359-57664381 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1191209167 X:57866889-57866911 AGTTTGCCAGCATTTTGTTGAGG - Intergenic
1191218271 X:57955929-57955951 CCTTTGCCCGCATTTTGATGAGG - Intergenic
1191625743 X:63269242-63269264 CCTTTGCCCGCTTTTCGTTGGGG - Intergenic
1191639720 X:63416983-63417005 CCTTTGCTTGTATTTTGTTGAGG + Intergenic
1191756850 X:64602268-64602290 CCTTTGCCCACATTTTGATGGGG + Intergenic
1191977312 X:66887612-66887634 CCTTTGCCTGCTTTTTGATGGGG + Intergenic
1192031345 X:67516083-67516105 ACTTTGCCTGCATTTTATTTGGG - Intergenic
1192199216 X:69054206-69054228 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1192663300 X:73064979-73065001 CCATTGCCCACTTTTTGATGGGG - Intergenic
1192669246 X:73122095-73122117 CCTTTGCCCACATTTTGTTGGGG - Intergenic
1192717314 X:73658011-73658033 GGATTGCCAGTATTTTGTTGAGG + Intronic
1192728271 X:73775750-73775772 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1193110588 X:77725792-77725814 CCTTTGCCTACTTTTTGATGGGG - Intronic
1193160777 X:78226758-78226780 CCTTTGCCTGCTTTTTGATGAGG + Intergenic
1193414014 X:81200042-81200064 CCTTTGCCCACATTTTGATGGGG - Intronic
1193427551 X:81357695-81357717 CCCTTGCCTGCTTTTTGATAGGG + Intergenic
1193445314 X:81594165-81594187 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1193574887 X:83185075-83185097 CCTTTGCCTGAATTTTGCTCAGG + Intergenic
1193773557 X:85617015-85617037 CATTTGCCAGTATTTTGTTGAGG + Intergenic
1193785216 X:85752543-85752565 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1193869898 X:86784294-86784316 CCTTTGCTTACTTTTTGTTGGGG - Intronic
1193970823 X:88049927-88049949 AGTTTGCCTGTATTTTGTTGAGG - Intergenic
1194039993 X:88928992-88929014 CCTTTGCCTGCTTTTTGATGGGG - Intergenic
1194536808 X:95115727-95115749 GCTTTGCCAGTATTTTGTTGAGG + Intergenic
1194548022 X:95262232-95262254 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1194652218 X:96529724-96529746 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1194747844 X:97649001-97649023 CCATTGCCCACTTTTTGATGGGG - Intergenic
1194883750 X:99287069-99287091 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1195272707 X:103248628-103248650 CCTTTGGTTGCATTTTCTTGAGG - Intergenic
1195655178 X:107325801-107325823 CCTTTGCCTGAATTTTGCTTGGG - Intergenic
1195794553 X:108630477-108630499 CCTTTGCCCACATTTTGATGGGG + Intronic
1196216865 X:113063076-113063098 CCTTTGCCTACTTTTTATTGGGG + Intergenic
1196571743 X:117273661-117273683 CCTTTGCCTACTTTTTGATGAGG - Intergenic
1196620928 X:117822716-117822738 CCTTTGCCTACTTTTTGTTGGGG - Intergenic
1197113561 X:122804643-122804665 CCTTTGCCCACATTTTGGTGGGG - Intergenic
1197243673 X:124146489-124146511 AGTTTGCCTGTATTTTGTTGAGG + Intronic
1197259084 X:124297376-124297398 AGTTTGCCTGTATTTTGTTGAGG - Intronic
1197336408 X:125214302-125214324 CCTTTGCCCACTTTTTGTTGTGG + Intergenic
1197394406 X:125908620-125908642 AGTTTGCCAGCATTTTGTTGAGG - Intergenic
1197484721 X:127034365-127034387 TCTTTGCTAGCATTTTGTTGAGG - Intergenic
1197659760 X:129157430-129157452 CCTTTGCCCGCTTTTTGATGGGG + Intergenic
1197660622 X:129167589-129167611 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1197668197 X:129246159-129246181 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1198020111 X:132649306-132649328 TCTTTCCCTGCATTTTGATGGGG + Intronic
1198524582 X:137488137-137488159 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1198606353 X:138342547-138342569 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1198858998 X:141049405-141049427 CCATTGCCCCCTTTTTGATGGGG - Intergenic
1198903701 X:141537984-141538006 CCATTGCCCCCTTTTTGATGGGG + Intergenic
1198916597 X:141679355-141679377 CCATTGCCCCCTTTTTGATGGGG + Intronic
1199354354 X:146843749-146843771 CAATTTGCTGTATTTTGTTGAGG + Intergenic
1199570884 X:149266089-149266111 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1199614933 X:149648731-149648753 CCTTTGCCTGAATTTTGCTTGGG - Intergenic
1200045480 X:153398593-153398615 CCATTGCCTGGTATTTGATGGGG + Intergenic
1200066565 X:153506864-153506886 CGATGGCCTGGATTTTGTTGTGG - Exonic
1200336600 X:155357453-155357475 AGTTTGCCAGCATTTTGTTGAGG - Intergenic
1200349870 X:155483774-155483796 AGTTTGCCAGCATTTTGTTGAGG + Intergenic
1200356297 X:155555696-155555718 CCTTTGCCCGCTTTTTGATGGGG + Intronic
1200416632 Y:2918628-2918650 CCTTTGCCTACTTTTTGATGGGG + Intronic
1200741503 Y:6858833-6858855 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1201078589 Y:10209307-10209329 CCTTTGCCTACTTTTTGATGGGG - Intergenic
1201171324 Y:11268821-11268843 CCTTTGCCCACATTTTGATGGGG + Intergenic
1201498345 Y:14614257-14614279 CCTTTGCCCACTTTTTGTTGGGG + Intronic
1201541212 Y:15106945-15106967 CCTTTGCCTACTTTTTGATGGGG + Intergenic
1201758011 Y:17509962-17509984 CAATTGCTGGTATTTTGTTGAGG - Intergenic
1201843544 Y:18396020-18396042 CAATTGCTGGTATTTTGTTGAGG + Intergenic
1201939142 Y:19440232-19440254 CCTTTGCCCACATTTTGATGGGG - Intergenic
1201971881 Y:19806753-19806775 CCTTTGCCCGCTTTTTGATGGGG - Intergenic
1202013883 Y:20379577-20379599 CCTTTGCCCACTTTTTGTTGGGG + Intergenic
1202056790 Y:20842904-20842926 CCTTTGCCTACTTTTTGATGGGG + Intergenic