ID: 1083811392

View in Genome Browser
Species Human (GRCh38)
Location 11:65108698-65108720
Sequence CCGCCCGGAGACCCTGCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083811392_1083811402 16 Left 1083811392 11:65108698-65108720 CCACCTGCAGGGTCTCCGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 168
Right 1083811402 11:65108737-65108759 GACAGACGTCCGCCAGGCGCTGG 0: 1
1: 0
2: 0
3: 5
4: 63
1083811392_1083811400 10 Left 1083811392 11:65108698-65108720 CCACCTGCAGGGTCTCCGGGCGG 0: 1
1: 0
2: 1
3: 23
4: 168
Right 1083811400 11:65108731-65108753 CTGCCTGACAGACGTCCGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083811392 Original CRISPR CCGCCCGGAGACCCTGCAGG TGG (reversed) Exonic
900310440 1:2030821-2030843 CCGCCCAGGGAGCCTGCAGCTGG - Intergenic
900394663 1:2448315-2448337 CCTCCCGGGGAGCCTGCAGAGGG - Intronic
900413379 1:2523853-2523875 CAGCCCGGAGAGCCGCCAGGAGG - Intronic
901221724 1:7587236-7587258 CCACCCGCCGCCCCTGCAGGCGG + Intronic
902078179 1:13803707-13803729 CGGCCCGGAGAACCTGCCCGCGG - Intronic
902469625 1:16639343-16639365 CCGCCAGGAGAGACAGCAGGTGG - Intergenic
903127666 1:21258776-21258798 CTTCCAGGACACCCTGCAGGTGG - Exonic
905366688 1:37455410-37455432 CCACCTGCAGACCCTGCAGGCGG - Intergenic
906103825 1:43279799-43279821 CCAGCCTGAGACCCTGGAGGAGG - Intergenic
910292924 1:85616364-85616386 CCTCCCGGCGACCCTCCAGGCGG + Intergenic
913680965 1:121186671-121186693 CCGCCCGGAGCCCGCGCAGGCGG + Intronic
914032796 1:143974310-143974332 CCGCCCGGAGCCCGCGCAGGCGG + Intergenic
914156651 1:145093655-145093677 CCGCCCGGAGCCCGCGCAGGCGG - Intronic
915362699 1:155295436-155295458 CCGCACTGGGATCCTGCAGGGGG - Exonic
915367106 1:155322830-155322852 CCGCCCGGCGACCCCGAGGGGGG - Exonic
916063459 1:161118032-161118054 CCGGCCGGAAACCCAGCAGGCGG - Exonic
917668468 1:177248700-177248722 CAGGCACGAGACCCTGCAGGGGG + Intronic
917926853 1:179796556-179796578 CATCCTGGAGAACCTGCAGGAGG - Intronic
920468277 1:206205195-206205217 CCGCCCGGAGCCCGCGCAGGCGG + Intronic
924853982 1:247857627-247857649 CCGCACGGCGCCGCTGCAGGAGG + Exonic
1063381547 10:5589112-5589134 CCAGCCAGAGGCCCTGCAGGTGG - Intergenic
1066406932 10:35127213-35127235 CGGCCCCGAGACCCAGCAGCGGG + Intronic
1067684823 10:48459814-48459836 CCGCCTGGCGCCCCTGCTGGTGG - Exonic
1070129679 10:73647773-73647795 CCGCACGGGTATCCTGCAGGAGG - Exonic
1071573816 10:86711775-86711797 CGGCGCGGAGACCCTGCGCGCGG + Intronic
1073363508 10:102918588-102918610 CGGCCGGGGGATCCTGCAGGCGG + Exonic
1077194387 11:1272113-1272135 ACGGGCAGAGACCCTGCAGGGGG - Intergenic
1077335657 11:2002738-2002760 CCTGCCAGAGACCCTGTAGGAGG + Intergenic
1077495257 11:2884173-2884195 CGGCCCGGAGACCCGAGAGGGGG + Intronic
1078565468 11:12410367-12410389 TGGCCCGGAGTCCCTGCCGGGGG - Intronic
1079071732 11:17353022-17353044 GCGCCCCGAGTCACTGCAGGTGG + Intronic
1079451770 11:20604496-20604518 CCGCCCGGCGGCCCTGCCTGAGG - Intronic
1083811392 11:65108698-65108720 CCGCCCGGAGACCCTGCAGGTGG - Exonic
1084788787 11:71459995-71460017 CCTTCCGGAGACACTCCAGGAGG + Intronic
1090057879 11:123438942-123438964 TGGCCCGGAGAGCCTGGAGGTGG + Intergenic
1202818641 11_KI270721v1_random:57920-57942 CCTGCCAGAGACCCTGTAGGAGG + Intergenic
1097180353 12:57168287-57168309 GGGCCTGGAGAACCTGCAGGGGG - Intronic
1098299865 12:69043179-69043201 CCTCCCAGGGACCCAGCAGGTGG + Intergenic
1098301259 12:69056279-69056301 CCTCCTGGAGACCCTGAAGGAGG + Intergenic
1102239305 12:111314031-111314053 CCTCCCGGGGACCAGGCAGGAGG - Intronic
1102457148 12:113077873-113077895 GCGCCTGGAGGCCCTCCAGGTGG - Exonic
1104595342 12:130116751-130116773 GCGCCTGCAGCCCCTGCAGGTGG - Intergenic
1104900708 12:132188291-132188313 CCCCCCCGCGAGCCTGCAGGCGG + Intergenic
1105578440 13:21673736-21673758 CGGCCCCGACACCCTGCGGGTGG - Intronic
1107026061 13:35802884-35802906 CCACCCAGAGAGCCTGCAGCTGG + Intronic
1108496098 13:51026801-51026823 CTGCCTGGAGGGCCTGCAGGTGG + Intergenic
1111724429 13:91987239-91987261 ACCCACGGAGACTCTGCAGGAGG + Intronic
1116464383 14:45214530-45214552 CCGCCCGGGGCCTCAGCAGGGGG + Intronic
1117339245 14:54779804-54779826 CAGCCAGGAGACCCTTCAGGTGG + Intronic
1118350936 14:64972156-64972178 CCGCCCGGGGACGCTGCGGGCGG + Exonic
1119711829 14:76828089-76828111 GCTCCCGTAGACCCTGCAGCCGG + Intronic
1122156276 14:99752354-99752376 CCGCCCGGCGACCCTGGCGTTGG - Intronic
1122629749 14:103102182-103102204 GCGCCTGGAGACGCTGCTGGTGG + Exonic
1122630969 14:103107624-103107646 CGCCCAGGAGACTCTGCAGGAGG + Exonic
1122779857 14:104139024-104139046 CCGCCCCCACACCCTGCAGGTGG + Exonic
1123203649 14:106691899-106691921 CGGCCCTCAGAACCTGCAGGGGG - Intergenic
1123774613 15:23566182-23566204 CCGCCTGGGGCCTCTGCAGGTGG + Exonic
1125538870 15:40458518-40458540 CCGCCGAGAGCCCCTGCAGATGG + Exonic
1125541261 15:40471222-40471244 CCGCCCGCTGACCCCGCTGGCGG + Exonic
1128334903 15:66779527-66779549 CCGCCCAGCCACCCAGCAGGAGG - Intronic
1129700911 15:77768260-77768282 CTGCCCGGGGACCCTGCATCTGG - Intronic
1132365738 15:101254923-101254945 ACTCCCGGAGCCCCTCCAGGTGG - Intergenic
1132670510 16:1100543-1100565 CCACCCGGAGAGCATGTAGGTGG - Intergenic
1132759270 16:1500985-1501007 CCGGCCGGACAAACTGCAGGGGG - Intronic
1133257904 16:4529278-4529300 CCGCCAGGAGACCCAGCAGGAGG + Intronic
1141566588 16:84906519-84906541 CCACCCAGAGTCCCTGCAGGAGG + Intronic
1141608467 16:85168886-85168908 CCCCCAGGAGACCCTTCAGACGG + Intergenic
1141629357 16:85278193-85278215 CCGCCCCCTGACGCTGCAGGAGG - Intergenic
1142123028 16:88396577-88396599 CCGCCCGGCCTCCCTTCAGGAGG - Intergenic
1142123047 16:88396631-88396653 CCGCCCGGCCTCCCTTCAGGAGG - Intergenic
1142193154 16:88727073-88727095 CCGCCTGGAGCCGCTGCGGGGGG - Exonic
1143388710 17:6547547-6547569 CCTCCTGGGGAGCCTGCAGGTGG - Intronic
1143513642 17:7408570-7408592 CTGCCCGCAGAACCTGCACGGGG + Exonic
1143515699 17:7418241-7418263 CCCCCTGGAGACCCTGGAAGTGG + Exonic
1144782847 17:17816580-17816602 CCACCCAGAGACGCTGCAGCAGG + Exonic
1145001557 17:19308633-19308655 CTGCACGGAGACCCGGGAGGAGG + Intronic
1146352989 17:32111499-32111521 CAGCCCCGAGAGCCTGAAGGCGG + Intergenic
1147254837 17:39175377-39175399 GGGCTTGGAGACCCTGCAGGGGG - Exonic
1148474335 17:47917019-47917041 CCACCCGCAGAGCCTGCTGGGGG - Exonic
1148911894 17:50947278-50947300 CCCCCTGCAGACCCTCCAGGAGG - Intergenic
1150764537 17:67993167-67993189 CCGGCTGGTGACCCTGCTGGTGG - Exonic
1151031363 17:70744110-70744132 CAGGCCCGAGAGCCTGCAGGTGG - Intergenic
1152391640 17:80007251-80007273 CCACCCGGAGACCGTGCTGGGGG - Intronic
1152803702 17:82344558-82344580 CCTCCTGGAGACCCTCCTGGTGG + Intergenic
1158947480 18:62459556-62459578 CCCCACGGAGATCCTGGAGGAGG - Intergenic
1160016109 18:75141857-75141879 CAGCCAGGAGAGCCTGCAGCAGG - Intergenic
1160510531 18:79451083-79451105 CCGCACGCTGTCCCTGCAGGTGG + Exonic
1160878281 19:1308055-1308077 CCACCAGGCGACCGTGCAGGAGG - Intergenic
1160933231 19:1580605-1580627 CGGCCCTGAGGCCCCGCAGGAGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161586967 19:5110895-5110917 CGGCCCGGAGCCCCTGCCAGTGG - Intronic
1161947125 19:7444379-7444401 CCGCCAGGAGTCCCTGGAGGAGG + Exonic
1161949924 19:7462282-7462304 CCCATCCGAGACCCTGCAGGGGG + Exonic
1162547360 19:11338917-11338939 CCGCACGGAGAGGCTGCAGAAGG + Intronic
1165072434 19:33263397-33263419 CTCCCCGGAGTCCCTGCACGTGG + Intergenic
1167463884 19:49640127-49640149 CCGCCCGGCTCCCCCGCAGGCGG - Exonic
925609341 2:5691411-5691433 CCGCCCGGCGTCCCTGCGAGGGG - Intergenic
925730761 2:6918052-6918074 CCGCCCGCAGACCCTGGGGCTGG + Intronic
927149251 2:20186295-20186317 CTGCCTGGAGACCCTGCTGAGGG - Intergenic
931282780 2:60808509-60808531 CGGCCCGGAGTTCCTGCAGCAGG - Intergenic
932705846 2:74024463-74024485 CAGCCTGGAGACCATCCAGGCGG + Intronic
933666748 2:84970958-84970980 CCGCCCGGAGGCCCCGCGGCCGG - Intergenic
934568353 2:95352894-95352916 CAGCCTGGTCACCCTGCAGGAGG + Intronic
935588086 2:104820033-104820055 CCGCCAGGAGACCCAGTAGCTGG - Intergenic
936259647 2:110947858-110947880 GGGCCAGGAGACACTGCAGGAGG - Intronic
937331515 2:121033251-121033273 CAGCCCTGAGCCCCTGCAGGAGG + Intergenic
938722059 2:134076025-134076047 CAGACAGGAGACCCTGCAGTAGG + Intergenic
942088576 2:172465622-172465644 CCGCCCGGGGGCCATGCACGCGG + Exonic
947602923 2:231465351-231465373 CCGCCGGGGAACCCTGCCGGTGG - Intronic
948961953 2:241346169-241346191 CCTCCTGGAGATCCTGCATGTGG - Exonic
1173837062 20:46132816-46132838 ACGCCCGAAGACCCTGGCGGCGG + Intergenic
1176083725 20:63286496-63286518 CCTCCTGGAGAGCCTGTAGGAGG - Intronic
1176387815 21:6147867-6147889 CCCCCCAGTGACCCTGGAGGAGG + Intergenic
1178772155 21:35515549-35515571 AGGCCCTGAGACCCTGCAGGAGG + Intronic
1179113988 21:38472984-38473006 CCGCCTGCAGACCCGGCATGAGG + Intronic
1179532093 21:42026745-42026767 CAGCCCATACACCCTGCAGGTGG + Intergenic
1179532329 21:42028499-42028521 CAGCCCATACACCCTGCAGGTGG + Intergenic
1179735657 21:43390381-43390403 CCCCCCAGTGACCCTGGAGGAGG - Intergenic
1180798176 22:18617882-18617904 CCATCCTGAGAGCCTGCAGGAGG + Intergenic
1180877709 22:19182536-19182558 CCCCCTGGAGGCTCTGCAGGCGG + Intronic
1180877708 22:19182536-19182558 CCGCCTGCAGAGCCTCCAGGGGG - Intronic
1181033143 22:20157779-20157801 CCTCTTGGAGTCCCTGCAGGGGG - Intergenic
1181223543 22:21377384-21377406 CCATCCTGAGAGCCTGCAGGAGG - Intergenic
1181255200 22:21558238-21558260 CCATCCTGAGAGCCTGCAGGAGG + Intronic
1184472283 22:44702629-44702651 CCACCCGGAGGCCCTGGAGCCGG + Intronic
1185389237 22:50549815-50549837 CCCCCCAGAGACCGTGAAGGTGG - Exonic
954299819 3:49694874-49694896 CCGCCAGGAGAGACAGCAGGTGG + Intronic
954628580 3:52036123-52036145 CCGTCTGGTGACCCTGCGGGTGG - Intergenic
955409891 3:58648755-58648777 CCTCCCTGAGGCCTTGCAGGGGG + Intronic
957789021 3:84916710-84916732 CCACCTGGAGACCCAGAAGGGGG + Intergenic
960056927 3:113282598-113282620 CCACCCGGACCCCCTGCACGGGG - Intronic
961326597 3:126112753-126112775 CCGCCCGCAGACCCTGGGGCAGG + Intronic
961442386 3:126960710-126960732 CGGGCCGGAGACCCAGCAGAGGG + Intergenic
968759953 4:2437503-2437525 CAGCCCTGAGACCCTGCACAGGG + Intronic
969560307 4:7942478-7942500 CCACCTGCAGGCCCTGCAGGAGG + Intergenic
975986099 4:80202641-80202663 CCGCGCGGCCAGCCTGCAGGAGG + Exonic
989217316 5:38918469-38918491 CCACCCTGGGACCCTGCAGGAGG - Intronic
993436496 5:87901959-87901981 CTGCCTGTAGACTCTGCAGGAGG + Intergenic
997441327 5:133910762-133910784 ACGCCTGGCGTCCCTGCAGGAGG - Intergenic
1002290693 5:178198765-178198787 GCGCCCTGAGACCCTGCATCGGG - Intergenic
1002352017 5:178590023-178590045 CCGCCTGGACACCCAGCAGCAGG + Exonic
1002852887 6:1012028-1012050 CCTCCCTGAGATCCTCCAGGGGG - Intergenic
1005890922 6:30137084-30137106 CTGCCAGGAGAGCCTGAAGGAGG + Exonic
1006438322 6:34038535-34038557 ACACCCTGAGACCCTGGAGGAGG + Intronic
1019077360 6:169398455-169398477 CAGCCCAGGGACCCTGCAGGAGG + Intergenic
1019135387 6:169904636-169904658 CTGCCTGGTGCCCCTGCAGGAGG - Intergenic
1019164120 6:170087603-170087625 GGACCCGGAGACCCTGCAGTGGG + Intergenic
1019713119 7:2526361-2526383 CCACCTGGAGAACCTGCAGCAGG + Exonic
1020005827 7:4783438-4783460 CAGCCCGGGCACCCTCCAGGAGG + Exonic
1022534268 7:31086047-31086069 CAGCCAGAGGACCCTGCAGGAGG - Intronic
1024472260 7:49775774-49775796 CCGCGGGGACACCCCGCAGGCGG + Exonic
1025120175 7:56295180-56295202 CCACCCGGAGAGCCTGAAGCAGG - Intergenic
1026952619 7:74357541-74357563 CAGAGCGGAGACCCTGGAGGGGG + Intronic
1029821157 7:103149108-103149130 CCGCCCAGAGACCGTGGAGGAGG + Exonic
1034174814 7:149091455-149091477 CCACCCTGAGTCCCTGCAGGCGG - Intergenic
1034552356 7:151829789-151829811 CCTTCCGGGGACCCTGCAGCGGG + Intronic
1035083071 7:156233528-156233550 CAGCCCCAAGACCTTGCAGGCGG + Intergenic
1036926379 8:12909736-12909758 CCCCCAGGAGGCCCTGGAGGAGG - Intergenic
1039992067 8:42496931-42496953 CTGCCCAGATCCCCTGCAGGTGG + Intronic
1043889870 8:85643505-85643527 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043891408 8:85655413-85655435 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043893076 8:85715085-85715107 ACGGCAGCAGACCCTGCAGGAGG - Intergenic
1043895763 8:85736539-85736561 ACGGCAGCAGACCCTGCAGGAGG - Intergenic
1043896916 8:85745269-85745291 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043899240 8:85763636-85763658 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043900850 8:85775830-85775852 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043902814 8:85791105-85791127 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043904424 8:85803298-85803320 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043906036 8:85815489-85815511 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1043907644 8:85827679-85827701 ACGGCAGCAGACCCTGCAGGAGG + Intergenic
1044973756 8:97644274-97644296 CCGCCAGGAGACCCGGGAGGCGG - Exonic
1045571239 8:103371322-103371344 CCCCGCCCAGACCCTGCAGGCGG + Intergenic
1049199882 8:141334809-141334831 CCCCCCGGGCACCCAGCAGGAGG - Intergenic
1049201642 8:141343404-141343426 CCACCCTGAGAGCCTGCCGGGGG - Intergenic
1049566431 8:143341495-143341517 CCACCCGGAGACCCCAGAGGAGG + Intronic
1049735080 8:144200495-144200517 CCGCGTGGGCACCCTGCAGGTGG + Exonic
1049774567 8:144398431-144398453 TCGCCCGCAGATCCTGCAGACGG - Exonic
1053605883 9:39658336-39658358 CTGCCTGGCCACCCTGCAGGAGG - Intergenic
1053863800 9:42414960-42414982 CTGCCTGGCCACCCTGCAGGAGG - Intergenic
1054561778 9:66718605-66718627 CTGCCTGGCCACCCTGCAGGAGG + Intergenic
1061583946 9:131554678-131554700 CCGCCCGCGGACCCTGGACGAGG + Intergenic
1061837046 9:133336339-133336361 CCGCCCGGAGTCGGTGCAGCAGG + Exonic
1061860963 9:133468623-133468645 GCTCGCGGAGACCCTGGAGGGGG + Exonic
1061882732 9:133576134-133576156 CCGCCCGGAGAGGCCCCAGGAGG + Intergenic
1062562007 9:137145866-137145888 ACGCCTGGAGACGCTGCTGGAGG + Exonic
1062723821 9:138059756-138059778 CCACCTGGGGACCCTGAAGGAGG - Intronic
1203793355 EBV:163193-163215 CGGCCTGGGGACCCTGCAGGAGG - Intergenic
1185450047 X:276958-276980 ACGCCCGGTGACCCGCCAGGCGG - Intronic
1185590707 X:1275046-1275068 CTGCCTGGAGACCCTTCAGGAGG - Intronic
1187234282 X:17452413-17452435 CTCCCCGGTGACCCTGCAGTGGG + Intronic
1190260847 X:48795944-48795966 CAGCCCTCACACCCTGCAGGAGG + Intergenic
1190302019 X:49062529-49062551 CCGGCAGCGGACCCTGCAGGAGG + Exonic
1191717706 X:64204877-64204899 GCGCCCGGAGGCCCAGGAGGAGG + Intronic