ID: 1083812103

View in Genome Browser
Species Human (GRCh38)
Location 11:65111935-65111957
Sequence CCATCTCCTGGGAAATGGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 287}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083812091_1083812103 8 Left 1083812091 11:65111904-65111926 CCGCGGGGCCGGATCCTCCGCGC 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1083812103 11:65111935-65111957 CCATCTCCTGGGAAATGGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 287
1083812086_1083812103 25 Left 1083812086 11:65111887-65111909 CCAGGCAGGTGCAGGCGCCGCGG 0: 1
1: 1
2: 1
3: 33
4: 310
Right 1083812103 11:65111935-65111957 CCATCTCCTGGGAAATGGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 287
1083812094_1083812103 -6 Left 1083812094 11:65111918-65111940 CCTCCGCGCGGCCGAGTCCATCT 0: 1
1: 0
2: 0
3: 5
4: 33
Right 1083812103 11:65111935-65111957 CCATCTCCTGGGAAATGGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 287
1083812093_1083812103 0 Left 1083812093 11:65111912-65111934 CCGGATCCTCCGCGCGGCCGAGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1083812103 11:65111935-65111957 CCATCTCCTGGGAAATGGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 287
1083812095_1083812103 -9 Left 1083812095 11:65111921-65111943 CCGCGCGGCCGAGTCCATCTCCT 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1083812103 11:65111935-65111957 CCATCTCCTGGGAAATGGGGCGG 0: 1
1: 0
2: 1
3: 19
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083812103 Original CRISPR CCATCTCCTGGGAAATGGGG CGG Exonic
901735433 1:11309398-11309420 CCATCTCTTGGGGAAGGGGTGGG - Intergenic
901763777 1:11487376-11487398 CCAGCTCTGGGGTAATGGGGCGG + Intronic
902465956 1:16619008-16619030 CCATCTCCCTGGAGATGGAGCGG - Intergenic
902501184 1:16912814-16912836 CCATTCCCTGGGATTTGGGGTGG - Intronic
902508735 1:16954296-16954318 CCATCTCCCTGGAGATGGAGCGG + Exonic
903067725 1:20710098-20710120 CTATCTCATAGGATATGGGGAGG + Intronic
903320224 1:22538720-22538742 GCATCTTCTGTGAAATGGGGAGG + Intergenic
903987753 1:27241242-27241264 CCATTTTCTTGGAGATGGGGTGG + Intronic
904003097 1:27349666-27349688 CCAGATCCTGGAGAATGGGGAGG + Exonic
905395180 1:37662198-37662220 CCACCTCCTTCGAAATGGGAAGG + Intergenic
905683685 1:39893336-39893358 CCATCTCCTGGGGGAAGGGAGGG - Intergenic
905826312 1:41028313-41028335 CGATCTCCTGGGGGGTGGGGAGG + Exonic
905887117 1:41497285-41497307 CCTTCTCCTGGGGAATGGCGGGG + Intergenic
906571474 1:46845429-46845451 CCATCCCCTGGGAAGTAGAGGGG - Intergenic
908727666 1:67194249-67194271 CCATCTCCTGGGAAGAGAGAAGG - Intronic
908770640 1:67592628-67592650 CCATCTCCAGATACATGGGGAGG + Intergenic
910984768 1:92994746-92994768 CCAGCTCCTGGGAAATGGGATGG + Intergenic
913021183 1:114790845-114790867 CCATCGTCTGGGATGTGGGGAGG - Intergenic
913556288 1:119970501-119970523 CCATCTCCTAGTACATTGGGTGG - Intronic
914089681 1:144485301-144485323 CCATTTGCTGGGGAAGGGGGCGG - Intergenic
915183233 1:154081581-154081603 CCACCTCCAGGGAAAAGAGGAGG + Intronic
915640788 1:157224352-157224374 CCAGGTCCTGGGACATGGGTTGG + Intergenic
915669039 1:157471937-157471959 CCAGGTCCTAGGAAATGGGTTGG + Intergenic
915806216 1:158854854-158854876 CCAGCTCCTTGGAAATCAGGTGG + Intergenic
916426927 1:164689566-164689588 CCATTTCCTGGGACATGGGTTGG + Intronic
917418760 1:174839726-174839748 CCCTCTCCTGGGAATTGGTGAGG - Intronic
917725300 1:177822041-177822063 CCATGGCTTGGGAAGTGGGGTGG + Intergenic
917737752 1:177936129-177936151 CCAACTCCTGGGAGCTGGGCGGG - Intronic
920432345 1:205927038-205927060 CCTTCACCTGTAAAATGGGGAGG + Intronic
924209037 1:241745856-241745878 CCATCACCTGGGAAAAGCTGAGG + Intronic
924768000 1:247052299-247052321 CCATCCCTAGGGAAACGGGGAGG - Intronic
1064942127 10:20746761-20746783 CCATCGACTGGGGCATGGGGAGG - Intergenic
1068791744 10:61037282-61037304 CCATCTCCTGGACATTGGCGTGG - Intergenic
1069644152 10:69979925-69979947 CCTGTTCCTGGGAATTGGGGTGG - Intergenic
1069953102 10:72033159-72033181 CCCTCTCTTGGGACATGGGGTGG + Intergenic
1070767294 10:79064088-79064110 CCATCTGATTGGAAATGAGGGGG + Intergenic
1072114253 10:92354552-92354574 CCATCTCCTGGGTTATTGTGAGG + Intergenic
1072427916 10:95345586-95345608 CCATCTGCAGGACAATGGGGTGG + Intronic
1072804716 10:98417263-98417285 CTTTATCCTGGGAGATGGGGAGG - Exonic
1073442023 10:103557752-103557774 CCTTCTTCTGGGAAATGAGCTGG + Intronic
1074935050 10:118169913-118169935 CCATCTCCTGAGTAAAGGGCAGG + Intergenic
1075664115 10:124218742-124218764 CCAAATCCTCGGAAATGGGCTGG - Intergenic
1077773675 11:5248469-5248491 ACAGCTCCTGGGAAATGTGCTGG - Exonic
1077774185 11:5253387-5253409 ACAGCTCCTGGGAAATGTGCTGG - Exonic
1080844615 11:36015769-36015791 CCACCTCCTGGAAGATGAGGTGG - Intronic
1083812103 11:65111935-65111957 CCATCTCCTGGGAAATGGGGCGG + Exonic
1084013248 11:66364206-66364228 CCAGGTCCGGGGCAATGGGGTGG - Exonic
1084942461 11:72620311-72620333 CCTTCTCCTGGGCCTTGGGGAGG - Intronic
1086425442 11:86678178-86678200 ACAACTTCTGGGAAATGTGGAGG - Intergenic
1087017011 11:93563889-93563911 CAATGGCCTTGGAAATGGGGAGG - Intergenic
1087152717 11:94872892-94872914 TCATCTCCTATGAAATGTGGTGG - Exonic
1087480890 11:98699201-98699223 ACATGTCCAGGGAAGTGGGGTGG + Intergenic
1088559213 11:111096060-111096082 CCCTCTAATGGGAAGTGGGGTGG + Intergenic
1089494422 11:118901153-118901175 CCATGTCCTGGGACATGGCTTGG + Exonic
1089672443 11:120065819-120065841 GCATCTGCTGGGAAATGGAAGGG + Intergenic
1089865282 11:121626289-121626311 CCTTCCCCTTGGAAGTGGGGTGG + Intronic
1090313654 11:125765711-125765733 ACATATGCAGGGAAATGGGGTGG - Intergenic
1090659767 11:128873484-128873506 TCATGTCCTAGGAAATGGTGTGG - Intergenic
1093482253 12:19616698-19616720 CAATGTCCTGGGCAATCGGGAGG + Intronic
1094715195 12:33006849-33006871 CCATGTTTTGGGAGATGGGGGGG + Intergenic
1095176918 12:39103198-39103220 CCAACACCTGGGAAAGGAGGTGG - Intergenic
1096148149 12:49293352-49293374 CTAACTCCTGGGAATTGGGAGGG - Intronic
1096742164 12:53701928-53701950 CCACCGCCTGGGAGATGGGAAGG - Intergenic
1098453626 12:70648248-70648270 ACATCTCCTAGGAAAAGGGTGGG - Intronic
1100270575 12:93020727-93020749 CCATCGCCAGTGAAATGGGAAGG + Intergenic
1102000002 12:109551435-109551457 TCCTCACCTGTGAAATGGGGAGG + Intergenic
1103674285 12:122643533-122643555 CCATCTGCTGGGAAAGGAAGAGG - Intergenic
1105272477 13:18891374-18891396 CCTTCTCCTGGGAAAAGCTGAGG + Intergenic
1105587580 13:21759152-21759174 ACATCACCTGGGAGATGGTGAGG + Intergenic
1105770981 13:23611453-23611475 GCATCACCTGGGAGATGGTGAGG + Intronic
1107114220 13:36729241-36729263 CCATCCCCAGGGAAAGTGGGAGG - Intergenic
1107334193 13:39335969-39335991 CACTCCTCTGGGAAATGGGGAGG - Intergenic
1111034102 13:82647798-82647820 CCATCTCCTGGGCTATGGATGGG - Intergenic
1112594763 13:100797533-100797555 ACATCCCCTGGGCAATGGTGTGG - Intergenic
1118729142 14:68654558-68654580 CCACATCCTGGGAGATGGGGCGG - Intronic
1119201216 14:72754209-72754231 CTATTCCCAGGGAAATGGGGCGG + Intronic
1119428849 14:74552629-74552651 CAATAACCTGGGAGATGGGGAGG + Intronic
1121157839 14:91703562-91703584 GCATCTCCCAGGAAGTGGGGAGG + Intronic
1121284334 14:92723470-92723492 CCATCAACTGGTAAATGGGCAGG + Intronic
1121406079 14:93720173-93720195 GCATCTCCTGGAAAATGAGTGGG - Exonic
1121448027 14:93990526-93990548 CCAGCTCCTGGAAAATAGGCTGG - Intergenic
1122006193 14:98705867-98705889 CCCTCACCTGTGAAATGGGGAGG + Intergenic
1122066209 14:99175830-99175852 CCATCTCCTCGGCACTGAGGCGG + Exonic
1122159136 14:99770077-99770099 CTATCTTAGGGGAAATGGGGGGG - Intronic
1122417520 14:101557520-101557542 CCATCTCCCGGGAGCTGGGAGGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1123751910 15:23363662-23363684 CCATCTCCTGGGGGTGGGGGTGG - Exonic
1123995794 15:25716918-25716940 CCTTCTCCTGGGAGAAAGGGAGG + Exonic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124284276 15:28387586-28387608 CCATCTCCTGGGGGTGGGGGTGG - Exonic
1124298421 15:28524028-28524050 CCATCTCCTGGGGGTGGGGGTGG + Exonic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124646024 15:31438000-31438022 CCATCTCCTCTGACGTGGGGTGG - Intergenic
1125488095 15:40126427-40126449 CCATACCCTGCGAAATTGGGAGG - Intergenic
1126108861 15:45164024-45164046 CCATCCCCTGGGAGATTGGTGGG + Intronic
1126397896 15:48238612-48238634 CAATATGTTGGGAAATGGGGAGG + Intronic
1126649596 15:50908101-50908123 TCTTCTCCTGGGATTTGGGGAGG - Intergenic
1127351859 15:58161069-58161091 ACATTTCCTGAGCAATGGGGAGG + Intronic
1128661579 15:69505098-69505120 TCATGTCCTGGGTACTGGGGAGG - Intergenic
1128735860 15:70053589-70053611 AAGTCCCCTGGGAAATGGGGGGG + Intronic
1128879924 15:71233904-71233926 ACACCTCCTGGGAAGAGGGGAGG - Intronic
1129066863 15:72912449-72912471 CCAACTCCAGGGAAAAGGGTGGG + Intergenic
1129073259 15:72969939-72969961 CCATCTCATGGGAAATACAGGGG - Intergenic
1131820272 15:96265374-96265396 CAATTTGCTGGGAAAGGGGGAGG + Intergenic
1132465485 16:75583-75605 CCAAACCCTGGGATATGGGGAGG - Intronic
1133279263 16:4655867-4655889 CCTTCTCCTGTGAGATGCGGAGG - Intronic
1133912981 16:10082698-10082720 TTATCTCATGGGAAATGAGGAGG - Intronic
1134256667 16:12617995-12618017 CATTTTCTTGGGAAATGGGGAGG - Intergenic
1136299675 16:29325447-29325469 CCATCTCGGGGGGACTGGGGAGG - Intergenic
1137584079 16:49653594-49653616 CCACCTCCAGGGAAAGGGGTGGG + Intronic
1138477387 16:57279894-57279916 CCACCTCCTGGGATTGGGGGTGG - Intronic
1139637955 16:68270264-68270286 CTTTCTCCTGGGAAAAGGGCAGG - Intronic
1140307620 16:73818383-73818405 CCATCTCCATGGTATTGGGGTGG - Intergenic
1141746925 16:85932061-85932083 TCCTCACCTGGCAAATGGGGTGG + Intergenic
1143726264 17:8848920-8848942 CCATCTCCTGGGGAAGGGAAGGG - Intronic
1145265504 17:21377868-21377890 ACGCCCCCTGGGAAATGGGGAGG - Intronic
1145981211 17:29012837-29012859 TCATCTCCTAGGAAAGGGGGAGG + Intronic
1146134516 17:30307128-30307150 TCATCTTCTGAAAAATGGGGTGG + Intergenic
1146720736 17:35121711-35121733 CCATCAAGTGGGAGATGGGGAGG + Exonic
1147449724 17:40496410-40496432 ACATCACCTGGGACATGGTGGGG + Exonic
1147947224 17:44086896-44086918 ACATCTCCTCTGAGATGGGGAGG + Intronic
1148715239 17:49711178-49711200 CCATCTCAGGGGACCTGGGGAGG + Exonic
1149521797 17:57323419-57323441 GAATCTCCAGGGAAATGCGGGGG + Intronic
1151371872 17:73652364-73652386 CCATCTCCTCAGAAATGAAGAGG - Intergenic
1151603964 17:75124687-75124709 CCCTCCCATGGGAAATGGCGGGG - Intronic
1151842014 17:76625699-76625721 ACATCTGCTGGGAAAGAGGGTGG - Intronic
1152608297 17:81303750-81303772 CCACCTCCCAGGAAAGGGGGAGG - Intergenic
1153755045 18:8273963-8273985 CCAGCTCCTCTGCAATGGGGAGG + Intronic
1155120784 18:22816682-22816704 CCATCAACTCGGAAATGGGCTGG + Intronic
1156360716 18:36382173-36382195 ACATCTTTTGGGGAATGGGGTGG + Intronic
1157791060 18:50531567-50531589 CCATATCCTGGGAAAATGAGTGG - Intergenic
1158318660 18:56239296-56239318 TCATCTCCTGGCCAATGGGTGGG + Intergenic
1159429071 18:68327519-68327541 CCATTTCATGGGAAATAGAGAGG + Intergenic
1160518462 18:79490975-79490997 CCAGCTCCATGGAAATGCGGGGG + Intronic
1161497120 19:4592755-4592777 CCATCTCCTGGGGAACGTGTAGG - Intergenic
1161565115 19:4997588-4997610 TCCTCTCCTGGGAAATGGGCTGG + Intronic
1161817818 19:6510652-6510674 GGATTTCCTGGGAGATGGGGAGG + Intergenic
1162259374 19:9519906-9519928 CATTCTCCTTAGAAATGGGGTGG - Intergenic
1164715179 19:30385640-30385662 CCATCTCCCAGGGAATGGGCAGG + Intronic
1165052609 19:33151573-33151595 GCATCTCCTGTAAAATGGGAAGG + Intronic
1165220807 19:34315242-34315264 CCATGTTTTGGGAAATGGGGTGG + Intronic
1165445535 19:35855179-35855201 ACACCCCCTGGGAAATGGGCTGG + Intronic
1165744274 19:38221569-38221591 CCTTCCCCTGGGAACTGGGATGG - Intronic
1166201083 19:41238397-41238419 CCACTTCCTGGGAACAGGGGAGG + Intronic
1166765192 19:45248739-45248761 CCCACATCTGGGAAATGGGGTGG + Intronic
1166817356 19:45554238-45554260 CTTTCTCCTGGGAAGTGGGTGGG - Intronic
1167368217 19:49065532-49065554 GGAGCTCCTGGGAAGTGGGGAGG - Intergenic
925194606 2:1912998-1913020 CAAACTCCAGGGGAATGGGGTGG + Intronic
926298978 2:11588873-11588895 GCATCTCCTCGGAGATGGGCTGG - Exonic
929047228 2:37801744-37801766 TCATTTACTGGAAAATGGGGAGG + Intergenic
929488096 2:42372506-42372528 CCATTTGCTGTGAAATGGGCTGG + Intronic
929538859 2:42804221-42804243 CCCTCTGCTGAGGAATGGGGAGG - Intergenic
929777600 2:44938629-44938651 CCAGCGCCTGGGAATTTGGGAGG + Intergenic
930034024 2:47074537-47074559 ACATCGCCAGGGAGATGGGGTGG - Exonic
932498215 2:72158173-72158195 CCAACTCATGGAGAATGGGGAGG - Intergenic
934923713 2:98366779-98366801 CGAGCTCCTGGGGAAAGGGGTGG - Intronic
935127568 2:100238013-100238035 CTATCTGCTGGGGAAGGGGGTGG + Intergenic
936683103 2:114797765-114797787 GCATCTCCTGGGTACTGGAGGGG - Intronic
938099073 2:128485960-128485982 CCACCTCCTGGGAAAGTGAGAGG + Intergenic
938307820 2:130266782-130266804 CCATCCCCTGAGAAAGGTGGAGG - Intergenic
938447517 2:131390059-131390081 CCATCCCCTGAGAAAGGTGGAGG + Intergenic
938753963 2:134362812-134362834 CCCTTTCCTGGGAAATGCAGTGG + Intronic
940449224 2:153817437-153817459 ACATCACCTGGGAGATGGTGGGG - Intergenic
942369600 2:175268783-175268805 CCAGCTCTTGGGAAAGGGAGAGG - Intergenic
942507052 2:176654127-176654149 CCATCTCCTGAGAGAGGGGGAGG - Intergenic
942650423 2:178161254-178161276 ACATCTCTTGGGAAAAGAGGAGG - Intergenic
943125710 2:183792124-183792146 CCATCGTCTGGGAAGTGAGGAGG - Intergenic
943748380 2:191486058-191486080 ACCTCTCCTGGGAAATTGGAAGG + Intergenic
946510277 2:220348518-220348540 CCATGTGCTGGGAGTTGGGGGGG + Intergenic
947063056 2:226188552-226188574 CCAGTTGCTGGGAAGTGGGGAGG + Intergenic
947545809 2:231009404-231009426 CCATCCCCGGGGAAATGTGTGGG + Intronic
948614798 2:239191548-239191570 CCTTCTCCTGAGAAAAGGGTGGG + Intronic
948631631 2:239306649-239306671 CCATCACCTGGGCAGTGTGGGGG - Intronic
948685841 2:239669395-239669417 CCATTTCCAGGGAAAGAGGGAGG - Intergenic
1169061924 20:2666682-2666704 CTATCTCCTGGGGGATGGGAGGG + Intergenic
1169351025 20:4867990-4868012 ACATCTCCTGGGAGCTGGGAGGG + Intronic
1169713937 20:8594501-8594523 ACATCTCCTGGGAACTAGGTAGG - Intronic
1173973362 20:47169255-47169277 CCTTCTACTAGGAAGTGGGGTGG + Intronic
1174255493 20:49251565-49251587 CCAGATCCTGGTAAATGTGGGGG + Exonic
1174898106 20:54471985-54472007 CCACTTCCTGGGAAATGAGAGGG + Intergenic
1176232795 20:64040600-64040622 CCAACCCCTGGGCCATGGGGAGG + Intronic
1176810281 21:13529434-13529456 CCTTCTCCTGGGAAAAGCTGAGG - Intergenic
1179525758 21:41974871-41974893 GCACCTGCTGGGAACTGGGGAGG + Intergenic
1180718592 22:17889773-17889795 CTCTATCCTGGGAAATAGGGCGG + Intronic
1180727117 22:17954458-17954480 ACATCACCTGGGGCATGGGGAGG + Intronic
1182347032 22:29673591-29673613 CCATCTTCTGGGCCGTGGGGAGG + Intronic
1183581019 22:38726795-38726817 CTATCTCCTGGGGTTTGGGGTGG + Intronic
1183659133 22:39208134-39208156 CCATGTCCTGGGAGAAGGGCGGG - Intergenic
1184516329 22:44965032-44965054 CCCTCCCCTGTGATATGGGGGGG + Intronic
1184856071 22:47147508-47147530 CCACCTCCTGGGACATCGTGAGG + Intronic
1185320896 22:50199910-50199932 CCAGGGCCTGGGGAATGGGGAGG + Intergenic
1185324590 22:50219506-50219528 CCATCTCCTGTGGATGGGGGCGG - Intronic
949879894 3:8652927-8652949 CCATCTCCCTGGGAGTGGGGAGG + Intronic
949935493 3:9112616-9112638 CCCTCTCCTGGGGAAGGCGGAGG + Intronic
950221644 3:11200815-11200837 CCTTCATCTGGGAAATGGGAAGG + Intronic
950429739 3:12943954-12943976 CCAGCTCCTGGGGAGTGGGGTGG - Intronic
950498043 3:13346112-13346134 CCATCCCCTGGGAAATCGAGTGG - Intronic
950542084 3:13618769-13618791 TCCTCTCCTGTGAAATGGGGTGG + Intronic
950555960 3:13696154-13696176 CAATCTCCTGGGGGATGGTGGGG + Intergenic
950694121 3:14684297-14684319 CCATCTCCTTGGCATTGAGGTGG - Exonic
951067053 3:18278626-18278648 ACCTCTCCTGGCAAATGGGTGGG - Intronic
952901178 3:38112586-38112608 GCATCTCCTGGGAAAAGGTGTGG - Intronic
952924296 3:38309910-38309932 CCATGTCATGGGAGGTGGGGAGG + Intronic
953449640 3:42995590-42995612 CCACCTCCTGGAGACTGGGGTGG + Intronic
953710467 3:45265502-45265524 CCACCTCCTGGGACAAGGGTTGG + Intergenic
954121693 3:48503738-48503760 CCATCCCCTGGAACATGGGCGGG + Intronic
954584567 3:51722147-51722169 TCATCTCCTGGGAAAAGCAGGGG + Intergenic
959620649 3:108395417-108395439 CCATGGCCTGAGAGATGGGGTGG + Intronic
961158055 3:124697612-124697634 TTCTCTCCTGGGCAATGGGGCGG - Intronic
962230840 3:133664060-133664082 GCATCTCCTGGGAATTTTGGGGG + Intergenic
966849702 3:184156732-184156754 CAGTCTCCTGGGAGTTGGGGGGG - Intronic
967095397 3:186173566-186173588 CCATCTCCATGGAAATTTGGAGG - Intronic
967879924 3:194294600-194294622 CCAGCTACTGGGGAATGGGTAGG - Intergenic
967949307 3:194828674-194828696 CCAGCTGCTGGGAAAGGAGGTGG + Intergenic
969477380 4:7429266-7429288 ACATCTCCGGGGAGCTGGGGTGG - Intronic
969961775 4:10952010-10952032 CCATGGCCTGGGAGGTGGGGCGG - Intergenic
970853172 4:20626098-20626120 GTGTCTCCTGAGAAATGGGGTGG - Intergenic
971138040 4:23891240-23891262 ACATCTCCTGGGAACTTGGAAGG - Intronic
971282129 4:25249756-25249778 CCATCGTCTGGGATGTGGGGAGG - Intronic
972278386 4:37580974-37580996 CCTTTGCCTGGGAAAAGGGGAGG - Intronic
974877179 4:67714812-67714834 CCAGCAGCTGGGAAATAGGGAGG - Intergenic
975342605 4:73258665-73258687 CCATCCCCAGGGAAAGAGGGAGG + Exonic
975951113 4:79772268-79772290 CCATCCCTAGGGAAAGGGGGAGG + Intergenic
976221190 4:82758139-82758161 TCACCTCCTGGGAGAGGGGGAGG + Intronic
981093617 4:140756923-140756945 ACTTTTCCTGGGAAAAGGGGTGG - Intergenic
985838969 5:2291422-2291444 CCAGCTTCTGGGAATTGGTGTGG - Intergenic
985868564 5:2536116-2536138 CCTTCCCCTGTGACATGGGGAGG - Intergenic
986750930 5:10787227-10787249 CTATCTCCTGAGCAGTGGGGTGG - Intergenic
988246086 5:28683645-28683667 CAATGTACTTGGAAATGGGGTGG + Intergenic
991246749 5:64516717-64516739 CAATCTCCTGGGAGATGCAGTGG - Intronic
992873012 5:81025106-81025128 CCATCTCCTTGGCACTGGGTGGG + Intronic
993399069 5:87426583-87426605 ACTTCTCCTGGGAAGTGGGTGGG - Intergenic
994087312 5:95773434-95773456 CCAGCTCCTGAGAGTTGGGGAGG + Intronic
999160120 5:149488566-149488588 CCAACTTTTGGGAAATGTGGGGG - Intergenic
999244855 5:150148652-150148674 CAATTTCCTGGGAAATGGCATGG + Intronic
1003160850 6:3633193-3633215 CCATCACCTGGGAACTTGCGAGG - Intergenic
1003777988 6:9390794-9390816 ACAACTCCTGGTAAATGGGTAGG + Intergenic
1003921676 6:10838543-10838565 TCATCTCCTAGGAAACGGCGGGG + Intronic
1006398193 6:33800711-33800733 CCTTCTCCCTGGAGATGGGGAGG + Intronic
1006779513 6:36622883-36622905 CCATCACCTGGGGAATAGGAGGG + Intergenic
1007747924 6:44054653-44054675 CCATCTCCTGGGCACTGCAGAGG + Intergenic
1012173433 6:96048300-96048322 ACATCTTCTGGGGGATGGGGAGG + Intronic
1012899666 6:104991549-104991571 CCATCTTCTGGGATGTGAGGAGG - Intronic
1013743236 6:113314025-113314047 CCAGCTCCTGGGAAATTTTGAGG + Intergenic
1014140670 6:117938624-117938646 CCATCTCTTGGGAAGTGGGAAGG + Intronic
1015810595 6:137158717-137158739 CCACAGCCTGGGAAATAGGGTGG - Intronic
1016532133 6:145070701-145070723 TCACCTCGTGGGAAATGAGGTGG + Intergenic
1016747506 6:147596905-147596927 CCATTTCCTCTGAAATGGGAAGG - Intronic
1017529426 6:155274076-155274098 TCCTCTTCTGGAAAATGGGGAGG - Intronic
1017563999 6:155664628-155664650 CAATCCTCTTGGAAATGGGGAGG + Intergenic
1017750806 6:157488828-157488850 CAAACTCCTGGGAAGGGGGGCGG - Intronic
1019598224 7:1868318-1868340 CCAGCTCCTGGGTACTGTGGAGG + Intronic
1019713073 7:2526179-2526201 CCATCTGCTGGGAGCTGGGGAGG - Intronic
1020713426 7:11637588-11637610 ACTTCACTTGGGAAATGGGGGGG - Intronic
1022471754 7:30685881-30685903 CCATCTCAAGGGCAATGGGTTGG - Intronic
1022680745 7:32543156-32543178 CCATCTCCTGGAATCAGGGGCGG - Exonic
1023633250 7:42184010-42184032 CCCTCTTCTGTAAAATGGGGAGG + Intronic
1024934361 7:54698020-54698042 CAGCCTCCTGGGAGATGGGGAGG + Intergenic
1028684226 7:93574878-93574900 CCCTCTCCTGGGACAGGAGGGGG - Intergenic
1029448551 7:100627968-100627990 TCATCCCCTGGAAAAAGGGGAGG + Exonic
1032016096 7:128381187-128381209 CCCTCTCCTGGGTATTGGGTGGG + Intergenic
1032440673 7:131940812-131940834 GCATCTCCTGGGAACAGGGAAGG - Intergenic
1032538578 7:132684927-132684949 CCTTCTCCTGGGGAAGGGAGAGG + Intronic
1033075234 7:138243631-138243653 CCATCTGCTGGGGACTGGAGAGG + Intergenic
1036569703 8:9969333-9969355 CCTTTTCCTGGGGAATGGTGAGG + Intergenic
1036581768 8:10081744-10081766 CCATCTCCCGGGACTTTGGGAGG - Intronic
1036755981 8:11471448-11471470 TCATCACCTGGGACATGCGGGGG - Intronic
1037316757 8:17606581-17606603 CCATCTCTGGGGAAATACGGAGG - Intronic
1037581719 8:20249482-20249504 CCATCTCCTGGGAAAGCCAGAGG + Exonic
1037659170 8:20912405-20912427 CCGTATCCTGGGATATGGGAGGG + Intergenic
1037659820 8:20916935-20916957 CGATCTGCTGGGAATTGAGGGGG - Intergenic
1037999890 8:23382593-23382615 CCACCTCCTGGGAAAAAGTGAGG - Intronic
1040568405 8:48587310-48587332 TCATATCCTGAGAGATGGGGAGG - Intergenic
1041792206 8:61709536-61709558 CCATCTATCGGGAAATGTGGAGG - Intronic
1045927124 8:107586913-107586935 ACATCCCCTGGGATATTGGGAGG + Intergenic
1046033800 8:108816942-108816964 CCATCTCTAGGGAAAGGGGGAGG - Intergenic
1048278332 8:133084703-133084725 ACTTCTGCTGGGAAATGGAGAGG - Intronic
1053081983 9:35184246-35184268 CCATCGTCTGGGATGTGGGGAGG - Intronic
1053105344 9:35403745-35403767 CAGCCTCCTGGGAAATGAGGAGG + Exonic
1053866223 9:42439273-42439295 CCATTTCATGGGCAATGGAGAGG + Intergenic
1056006815 9:82281303-82281325 CCATAGCCTGGGAAATGCTGAGG + Intergenic
1056094903 9:83242951-83242973 TTATCTACTGGGAACTGGGGTGG - Intergenic
1056769147 9:89464458-89464480 CCAGATCCTGGGCATTGGGGAGG - Intronic
1057415952 9:94862437-94862459 CCATGTCCTGAGAAAAGGGAGGG + Intronic
1058935079 9:109762845-109762867 CCACCCCCTGGGGAATGGGAAGG - Intronic
1059669448 9:116478645-116478667 CCAGCCCCTGGCAACTGGGGAGG - Intronic
1060225127 9:121785825-121785847 CCACCTCCTGGGAGACAGGGTGG + Intergenic
1060666098 9:125433069-125433091 CCATCTCCTGGGAGTCTGGGGGG + Intergenic
1060878812 9:127103314-127103336 CCATCTGTTGTGAGATGGGGTGG + Intronic
1061226543 9:129283963-129283985 GCAGCTCCGGGGGAATGGGGAGG - Intergenic
1062392295 9:136338681-136338703 CCAGCTCCTGGGCAATGAGCAGG - Exonic
1062617185 9:137403208-137403230 TCATCTGCTTGGAAATGGGTTGG + Intronic
1187269684 X:17768572-17768594 CCAGCTTCTGGAAAATGGTGTGG + Intergenic
1187361953 X:18636867-18636889 CCATCTGCTGGGAAAGGGGATGG - Intronic
1189117156 X:38354998-38355020 ACATCTCTTGGGAAAGGTGGAGG + Intronic
1189215491 X:39319545-39319567 GTAACTCCTGGAAAATGGGGTGG - Intergenic
1190868154 X:54402041-54402063 CCTTCTCCTTGGAAATGGACTGG - Intergenic
1191742140 X:64447501-64447523 TAAGCACCTGGGAAATGGGGTGG + Intergenic
1191896006 X:65994119-65994141 CCATCTGTAGGGAAATGTGGGGG + Intergenic
1194811887 X:98397641-98397663 CCATCTCCTAACAACTGGGGAGG + Intergenic
1196409568 X:115401393-115401415 CCATATGATGGAAAATGGGGAGG - Intergenic
1197729221 X:129795662-129795684 CCATCTCCTGGGAGGTAGGATGG + Intergenic
1197952771 X:131915906-131915928 CCATGGCCTGGGGAATGGTGAGG + Intergenic
1198560163 X:137841032-137841054 TGATCTCCTGGGAGATGAGGTGG - Intergenic
1199715324 X:150503766-150503788 CCACCTCCAGGGAAATGAGTGGG + Intronic
1199845607 X:151690824-151690846 CCATTTCCAGGAAAATGTGGAGG - Intergenic
1199879843 X:151965144-151965166 CCATCTCAGGGGAGCTGGGGGGG + Intronic