ID: 1083814839

View in Genome Browser
Species Human (GRCh38)
Location 11:65126858-65126880
Sequence AGCCTTCTGACCTGCAATCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083814834_1083814839 0 Left 1083814834 11:65126835-65126857 CCAGCATAGGGACATCCCCCTGC 0: 1
1: 0
2: 0
3: 12
4: 91
Right 1083814839 11:65126858-65126880 AGCCTTCTGACCTGCAATCAAGG 0: 1
1: 0
2: 2
3: 13
4: 132
1083814831_1083814839 28 Left 1083814831 11:65126807-65126829 CCACAAGGGAGTGGCTGGGAACT 0: 1
1: 0
2: 0
3: 23
4: 173
Right 1083814839 11:65126858-65126880 AGCCTTCTGACCTGCAATCAAGG 0: 1
1: 0
2: 2
3: 13
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083814839 Original CRISPR AGCCTTCTGACCTGCAATCA AGG Exonic
903651229 1:24923505-24923527 AGACTTCTCCCCTGCAACCAGGG - Intronic
905745070 1:40408862-40408884 TGTCCTCTGTCCTGCAATCAAGG + Intronic
906566221 1:46803092-46803114 AGCCTTTTGACCTGGCCTCAAGG - Intronic
906946668 1:50300542-50300564 AGCCTTCTGAGCTACAAGCCTGG + Intergenic
911903352 1:103532474-103532496 AGACTTCTGTCCTGAAGTCAAGG - Intronic
912340242 1:108907423-108907445 ACGCTTATGACCTGGAATCAAGG - Intronic
913511747 1:119568754-119568776 AGCCCTCTGACCTTCCAACAAGG - Intergenic
917318922 1:173758866-173758888 AGCCTCCTGACCAGAACTCAAGG + Intronic
918572960 1:186020690-186020712 AGTCTTCTGAACTCTAATCAGGG - Intronic
923280650 1:232439892-232439914 AGTCTTCTGCCCTGAACTCAAGG - Intronic
923591361 1:235322698-235322720 AGGCATCTGACCTGCTTTCAGGG - Intronic
1066008649 10:31171746-31171768 AGGCTTCTGTCCTGCATTCGAGG - Intergenic
1068096685 10:52499780-52499802 AGCCTTCTGGCCAGCACTCGGGG - Intergenic
1068257372 10:54530589-54530611 AGACTTCTGAGCTGCTCTCATGG - Intronic
1068859925 10:61837757-61837779 AGCCTGCTGACCTGAAAGTAAGG + Intergenic
1072281455 10:93869455-93869477 AGCCTTCTGTCCTTGAATCTGGG + Intergenic
1083290241 11:61685944-61685966 AACCTTCAGCCCTGCCATCATGG - Intronic
1083814839 11:65126858-65126880 AGCCTTCTGACCTGCAATCAAGG + Exonic
1083958797 11:66002595-66002617 ACCCCTCTGGCCTCCAATCAGGG - Intronic
1085474219 11:76779643-76779665 TGTCTTCTGACCTCCACTCAAGG + Intergenic
1089355813 11:117852475-117852497 AGACTTCTCAACAGCAATCATGG - Intronic
1096956788 12:55534492-55534514 AGCCTTCTGGCCAGAACTCAGGG + Intergenic
1098601285 12:72334555-72334577 AGCTGTCTGATCTGCAACCAGGG + Intronic
1101903104 12:108806263-108806285 TGACCTCTGACCTGCAATGAAGG + Intronic
1105428926 13:20319461-20319483 AGCCTGCTGACCTGCTGTGAAGG + Intergenic
1109109412 13:58296951-58296973 AGACTTCTGACTTGCAAAAAGGG + Intergenic
1109585770 13:64401220-64401242 AGCCTTCTGACCCACAAATATGG + Intergenic
1111786571 13:92794596-92794618 AGCCTTGTCATCTGCAAACAGGG - Intronic
1113461435 13:110485031-110485053 AGGCTTCTGACCTGCAGCCAGGG + Intronic
1113611248 13:111646181-111646203 AGCCAGCTCACCTGCAGTCAAGG - Intronic
1115328295 14:32166618-32166640 AGCCTCCAGCCCTGCCATCATGG - Intergenic
1115456152 14:33605745-33605767 AGTCTTCTGACCTACAAAAATGG - Intronic
1120218700 14:81708175-81708197 GGACTTCTGACAAGCAATCAAGG + Intergenic
1120221139 14:81735117-81735139 AGCTTACTGACCTACAATGAGGG - Intergenic
1122396480 14:101436254-101436276 TTCCTTCTGTCCTGCAAGCAGGG + Intergenic
1124344710 15:28914522-28914544 AGCCACCTGAGCTGCAATCTGGG - Intronic
1124393991 15:29284601-29284623 ACATTTCTCACCTGCAATCATGG + Intronic
1130536643 15:84790193-84790215 AGCCTTCTGAGTACCAATCAGGG + Intronic
1130639449 15:85657482-85657504 AGTCTTCTCATCTGCAAACATGG - Intronic
1131391988 15:92057191-92057213 AGCCTTCTTACCGGCAGTCCAGG - Intronic
1131770268 15:95729374-95729396 AGCCTCATGACCAGCAGTCATGG + Intergenic
1133096174 16:3447591-3447613 AGCCTTCTCACCTACACTAAGGG + Intronic
1134095139 16:11414071-11414093 GTCCTTCTGCCCTGCAATCTTGG - Intronic
1137570273 16:49560920-49560942 AGCCTCCTGCCCTGGAAACACGG - Intronic
1141419936 16:83907760-83907782 AGCCGTCAGTGCTGCAATCAGGG - Intronic
1141646989 16:85372854-85372876 AGCCTTCTCATCTGCAACAAGGG - Intergenic
1141648440 16:85379642-85379664 AGCTGTCTGACCTGCAATGGAGG - Intergenic
1144447034 17:15341101-15341123 AGCCTTCAGATCTGCAGCCACGG - Intronic
1145105360 17:20110834-20110856 ATCCTTCTGACATCCAAGCAGGG + Intronic
1147398523 17:40164134-40164156 AGCCTTCTTTCCTGCAACCACGG + Exonic
1148649032 17:49236427-49236449 AACAGTCTGACTTGCAATCAGGG + Intergenic
1150678579 17:67265839-67265861 ACCCTTCTGACCGGCTTTCACGG + Intergenic
1152830127 17:82491966-82491988 AGCCTTGTGTTCTGAAATCAAGG + Intergenic
1153169033 18:2293824-2293846 AGCCTTCTGGCCAGAACTCAGGG - Intergenic
1153515614 18:5897957-5897979 AGCCTTCTGACCTTGTAGCAGGG + Intergenic
1154506000 18:15041461-15041483 AGACTTCTGACCTGTTACCAGGG + Intergenic
1160055190 18:75472245-75472267 AGCCTTCTCACATGCAGTCAGGG + Intergenic
925146573 2:1586828-1586850 TGCCTCCTGGTCTGCAATCAAGG + Intergenic
926356043 2:12041501-12041523 AGCCTTCAGGCCTGGAATCCGGG + Intergenic
930434540 2:51323933-51323955 AGCCTTCTGGCCTAAAATAAAGG - Intergenic
930601129 2:53444364-53444386 AGTCTTATGACCTACAGTCAAGG - Intergenic
930609216 2:53522761-53522783 TTCCTTCTGATCTGCAATGAGGG - Intergenic
935382645 2:102468050-102468072 AGCTTTCTGTCCTGAAAGCAGGG + Intergenic
936562930 2:113557480-113557502 AGCCTTCATCCCTGCCATCACGG + Intergenic
937057789 2:118954058-118954080 AGCCTCCTGACCAGAACTCAGGG + Intronic
940889264 2:159019152-159019174 AGACTGCTGACCTGCAATCCCGG - Intronic
943424839 2:187718420-187718442 AAACTTCTGAGCTGCAATCTTGG - Intergenic
944478087 2:200127271-200127293 AGTTGTCTGACCTGCAACCAGGG + Intergenic
947978360 2:234386948-234386970 AGCCTTCTGGCCTCTAAGCAGGG + Intergenic
948262249 2:236613034-236613056 AGCTTTCTGTCCTGCACACATGG - Intergenic
1169323129 20:4651734-4651756 AGCCCTCTGACCTCCCACCATGG - Intergenic
1175483870 20:59330769-59330791 AACCTTGGGACCTGGAATCAGGG + Intergenic
1176791854 21:13327565-13327587 AGACTTCTGACCTGTTACCAGGG - Intergenic
1177310566 21:19386983-19387005 GGACTTCTGACCTGCAAAAACGG - Intergenic
1177991247 21:28038567-28038589 AGGCTTCTGACCTGTTACCAGGG - Intergenic
1184770950 22:46596114-46596136 AGCCCTCTGACCTCCCGTCATGG - Intronic
950687826 3:14631457-14631479 AGCCATCTGACCCCCAAACAAGG - Intergenic
952363977 3:32658773-32658795 CTCCTTCTGACCTGGAGTCAGGG + Intergenic
953657517 3:44865277-44865299 AGCCTTCTGACCATCAGCCAAGG + Exonic
953724017 3:45381891-45381913 AGCCTTCTGGCCAGAACTCAGGG - Intergenic
954755617 3:52837890-52837912 AGCCCTCTGATCTGCTCTCATGG + Exonic
955022023 3:55130892-55130914 AGCCATCTGACCCCCATTCATGG + Intergenic
959279721 3:104323122-104323144 AGCCTCCTGACCAGAACTCAGGG + Intergenic
960116370 3:113897497-113897519 TGCATTCTGACCTGCAACCTTGG + Intronic
961562043 3:127737356-127737378 AGCCTCGTCACCTGCAATAAGGG + Intronic
967365841 3:188685608-188685630 AGCTTTCTGACCTCACATCAAGG - Intronic
973621116 4:52726980-52727002 TGCCTTCAGACTTGCAATCAGGG + Intronic
975496059 4:75037301-75037323 TAGCTTCTGACCTGCAACCATGG + Intronic
977342501 4:95776407-95776429 ATACTTCTGATCTACAATCATGG - Intergenic
977761717 4:100745964-100745986 AGCCTTCTCCCCTGAGATCATGG + Intronic
977848007 4:101789330-101789352 AACCTTCTGACTTCCAATCCAGG + Intronic
984280572 4:177665689-177665711 AAGCTTCTAACCTGCAATCAGGG + Intergenic
989973363 5:50551940-50551962 AGCCTTCTGTCTTACAATGAAGG + Intergenic
993101651 5:83547594-83547616 AGCCTTCCCACCTCCAATCATGG - Intronic
995529950 5:113082667-113082689 AGCAGTCTGAGCTGCCATCATGG - Intronic
997588865 5:135060940-135060962 AGCCTTCTGCCCTGGAATCTTGG + Intronic
998116723 5:139543460-139543482 CGCCTACTGACGTGCAATCCAGG - Intronic
998651708 5:144127858-144127880 AGGCTTCTTCCCTGCAATGACGG - Intergenic
999076562 5:148801615-148801637 AGGCTTCTAACCTGTAAACATGG - Intergenic
1001512554 5:172334091-172334113 AGCCTTCTTAGCTCCAATCAGGG - Exonic
1002963661 6:1941467-1941489 GTCCTTCTGACCTGCAGTCATGG - Intronic
1003340396 6:5214588-5214610 AGCCTTCTGACCTGTCCTCCGGG - Intronic
1006090633 6:31626719-31626741 AGCATTCTGCCCTCCAATCTTGG - Intronic
1011240973 6:85271005-85271027 GTTCTTCTCACCTGCAATCAGGG + Intergenic
1012422723 6:99082175-99082197 ATCATTCTTACCTGCAATCCAGG + Intergenic
1015415174 6:132940093-132940115 AGCCTTCTGAGATGCCTTCAAGG - Intergenic
1017061173 6:150486435-150486457 AGCCTTCTCACCTGCGTTCAAGG + Intergenic
1018261884 6:161978651-161978673 AGCCTTCTGACCAGCCTTCTTGG - Intronic
1019023763 6:168941236-168941258 AGCCTTCTGCTCTGGAATCTGGG - Intergenic
1019831799 7:3337694-3337716 AGCCTTCTCATCTGGAATGATGG + Intronic
1023154295 7:37232605-37232627 AGCCTGCTTACTTGTAATCAGGG - Intronic
1023358261 7:39389490-39389512 ATCCTTCACAACTGCAATCAAGG - Intronic
1024669345 7:51577819-51577841 AGCCTTCTGCCCAGAACTCAGGG - Intergenic
1024854956 7:53768021-53768043 AGTCTTCTGACCTGAAATCAAGG + Intergenic
1026953733 7:74364072-74364094 AACCTGCTGACCTGCACTCTAGG - Intronic
1029575136 7:101398562-101398584 TCCCTCCTGACCTGCAATAATGG + Intronic
1030690071 7:112523295-112523317 AGCTTTCTGAAGAGCAATCAAGG - Intergenic
1032450139 7:132023644-132023666 AGCCTTCTGTCCTGCTGTCTTGG - Intergenic
1034367646 7:150565487-150565509 AGCCTTGTGAACTGCAGGCATGG - Intergenic
1034512949 7:151551244-151551266 AGCCACCTGGCCTGCAATGAGGG - Intergenic
1035191985 7:157177817-157177839 AGCCTTCTGCCCTGCCAGGAGGG - Intronic
1037210102 8:16375868-16375890 AGCCTGCTGACCTGGAATCAAGG + Intronic
1037772535 8:21810943-21810965 AGCCACCTGACCTCCCATCAGGG + Intronic
1037933685 8:22899910-22899932 ACCCTTCTCACCCGCAGTCAAGG + Intronic
1038629388 8:29226609-29226631 ATCATTCTGACCAGCAATCTTGG - Intronic
1040967690 8:53100861-53100883 AGCCTTCTAACCAGCAACCAGGG + Intergenic
1041428846 8:57755614-57755636 AGCTTTTTGACCTGCATTTATGG - Intergenic
1043480455 8:80647392-80647414 ATGCCTCTGACCTGCAATAAGGG + Intronic
1045056245 8:98370635-98370657 AGCCTTCTGAGCTGGACTCAGGG + Intergenic
1045727098 8:105186452-105186474 AGCCTGCTTCCCTGAAATCACGG - Intronic
1048270256 8:133022566-133022588 AGCCATCTGATTTGGAATCAGGG + Intronic
1049129256 8:140822276-140822298 AGCATTCTGATCTTCATTCATGG + Intronic
1049889802 9:58219-58241 AGCCTTCATCCCTGCCATCACGG - Intergenic
1051362624 9:16294590-16294612 AGCCTCCTGGCCAGAAATCAGGG + Intergenic
1053731283 9:41059494-41059516 AGCCTTCATCCCTGCCATCACGG - Intergenic
1054697226 9:68372595-68372617 AGCCTTCACCCCTGCCATCACGG + Intronic
1060451748 9:123749134-123749156 AGTCTTCTGACCTCCAACCCAGG - Intronic
1060542844 9:124442553-124442575 AGCCATCTCACATGCATTCAAGG + Intergenic
1061893518 9:133635133-133635155 AGCCTCCAGACCTGCTGTCATGG + Intergenic
1062156891 9:135054772-135054794 AGCCTTCTCATCCGAAATCATGG + Intergenic
1189262966 X:39690928-39690950 AGCCTTTAAAGCTGCAATCAGGG + Intergenic
1192538735 X:71950274-71950296 TGCCTTCTGCCCTGCCCTCATGG - Intergenic
1192630032 X:72770026-72770048 AGGTGCCTGACCTGCAATCATGG - Intergenic
1192651678 X:72950778-72950800 AGGTGCCTGACCTGCAATCATGG + Intergenic
1192970325 X:76221667-76221689 AGCCTCCTGACCAGAACTCAGGG - Intergenic
1195411372 X:104570226-104570248 AGCTTTCTGACCTAGGATCAAGG - Intronic
1196464767 X:115960554-115960576 AGCCTCCTGACCAGAACTCAGGG + Intergenic
1196811675 X:119634001-119634023 AGCCATCATACCTGCCATCAAGG + Intronic