ID: 1083815085

View in Genome Browser
Species Human (GRCh38)
Location 11:65128184-65128206
Sequence TCCCCATGGCTGCCTGGGAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 3, 3: 33, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083815085 Original CRISPR TCCCCATGGCTGCCTGGGAC TGG Exonic
900114605 1:1023133-1023155 CCCTCATGGCTGCCTGGGAAGGG + Intronic
900414490 1:2528696-2528718 GCTCCATGGCTGCCAAGGACAGG + Intergenic
900507778 1:3038347-3038369 TGTCCTTGGCTGCCTGGCACAGG - Intergenic
900527371 1:3135819-3135841 TCCCCGTGGCTCCCTGGGCCGGG + Intronic
900603397 1:3512912-3512934 TCCCCAAGGCTGCTTGGCCCAGG + Intronic
900807396 1:4776442-4776464 ACCCGATGGCTGCCTGGCTCCGG + Intronic
900967175 1:5966837-5966859 TCCCTCTGGCTGCCTGGGAACGG + Intronic
901129742 1:6954840-6954862 TCCCTCTGCTTGCCTGGGACGGG + Intronic
902449319 1:16486544-16486566 TCTCCAGGGCTGCCTTGGCCCGG + Intergenic
902505429 1:16936733-16936755 TCTCCAGGGCTGCCTCGGCCCGG - Exonic
902705627 1:18202263-18202285 TTCTCAGGGCTGGCTGGGACTGG + Intronic
903483425 1:23671165-23671187 TCCCCATGCCAGCCTGAGATGGG - Intergenic
903500487 1:23797691-23797713 TCACCTTGTCTGCCTGGCACAGG + Exonic
903550205 1:24152813-24152835 TCTCCCTGGCTGGCTGGGCCTGG - Intergenic
903574325 1:24329027-24329049 TCCTCATTGCTTCCTGGGCCTGG - Intronic
905271671 1:36791537-36791559 TCCTCAGGGCTCCCTGGGGCTGG + Intergenic
905338029 1:37258627-37258649 GCCCCATGGGTGCCTGGAATTGG - Intergenic
905801921 1:40849748-40849770 TCCCCATGGCTGTGCGGGTCTGG + Intergenic
905897500 1:41558197-41558219 TTCCCAATGCTGCCTGGGCCGGG - Intronic
912492760 1:110070874-110070896 TCTCCTGAGCTGCCTGGGACTGG - Intronic
915316232 1:155030529-155030551 GGTCCATGGCTACCTGGGACAGG + Exonic
915530775 1:156500944-156500966 TCCCCAGGGCTGGCCGGGCCAGG + Intergenic
918962801 1:191302621-191302643 TAATCATGGCTGCCTGGGACTGG + Intergenic
919997511 1:202766857-202766879 TACCAATGGCTGTCTGGCACTGG - Intronic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
920345232 1:205301958-205301980 TCCCCTAGGCTGCCAGGGATGGG - Intergenic
921676634 1:217983227-217983249 TCCTCCTGGCTGCCTGAGCCCGG - Intergenic
922078173 1:222268407-222268429 ACCCCATGGCATCTTGGGACAGG + Intergenic
922141820 1:222894739-222894761 TCCCGCTGGCTCCCTGGAACAGG + Intronic
924610885 1:245572881-245572903 TCTCCATTTCTGCTTGGGACAGG - Intronic
1065494361 10:26313669-26313691 TCTCCACGGCTGGCTGGGCCGGG + Intergenic
1066488841 10:35874746-35874768 ACCCCATGGCTGACTGGGGAGGG - Intergenic
1067222487 10:44353934-44353956 TCCCCATGGCTGCCCATGGCAGG + Intergenic
1067526950 10:47044846-47044868 TCACCTTTGCTGCCTGGGTCTGG + Intergenic
1069610994 10:69772448-69772470 TCCCCATGGCTGTCTGTGCTAGG + Intergenic
1069639264 10:69944293-69944315 TCCTCACAGCAGCCTGGGACAGG + Intronic
1070279377 10:75037684-75037706 TCCCCATGTGTGCTGGGGACAGG - Intergenic
1073831605 10:107390223-107390245 TCCCCATAGCTGCCTGACATAGG + Intergenic
1075900891 10:126042055-126042077 TCCCCAAGGCCTCCTGTGACTGG - Intronic
1076700852 10:132271871-132271893 GCCCCAGTGCTGCCTGGGAAGGG - Intronic
1076875153 10:133212344-133212366 GCAGCAGGGCTGCCTGGGACCGG - Intronic
1077278854 11:1732891-1732913 TGCTGGTGGCTGCCTGGGACAGG - Exonic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1077662541 11:4082612-4082634 TCCCCATGGCAGCCTGGGGCTGG - Intronic
1078108344 11:8372672-8372694 TTCCCAAGGCTGACTGGGACAGG + Intergenic
1078215920 11:9311657-9311679 TGGCCCTGGCTGCCTGGCACTGG + Intronic
1078433079 11:11302483-11302505 CCAGCCTGGCTGCCTGGGACAGG + Intronic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1080560736 11:33460129-33460151 TGTCCATGGCTGTCTTGGACAGG + Intergenic
1080845498 11:36023344-36023366 TCCCCATGGCCCCCTGCAACAGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082795931 11:57377757-57377779 TCCCCAGGGCAACCTGGGAATGG - Exonic
1083035911 11:59637285-59637307 GGCCCCTGGCTGCCTGGGAACGG + Exonic
1083685665 11:64373513-64373535 TCCCCAGGCCTCCCGGGGACAGG - Intergenic
1083764972 11:64837313-64837335 TCCCCAGGGCTGTCGAGGACAGG + Intronic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1084290624 11:68163752-68163774 TGCCAATGGCTACCTGGAACGGG + Intronic
1084904409 11:72334781-72334803 TCCCACTGGCTGTCTGGGGCTGG + Intronic
1085212159 11:74791203-74791225 TCCCCATGTCTGCCGGAGTCTGG + Intronic
1085224493 11:74907325-74907347 CCTCCATGGCTTCCTGGGAATGG - Intronic
1086899612 11:92352200-92352222 TCCCAGGGGCTGCCAGGGACTGG + Intronic
1088327798 11:108618690-108618712 TTCTCATGGCTGCCTGAGGCTGG + Intergenic
1088595033 11:111435055-111435077 TCCCCAGGGCTGCCCGGTTCTGG + Intronic
1089128306 11:116192907-116192929 TCCAGATGGATGCCTGGGTCAGG + Intergenic
1089649341 11:119902184-119902206 TACCCATCCCTGCCTGGGCCAGG + Intergenic
1089897677 11:121948030-121948052 TCCCCAGGGCTGCTTATGACAGG - Intergenic
1090546048 11:127769423-127769445 TTCTCATGGCTGCTTAGGACAGG + Intergenic
1091090572 11:132767517-132767539 TCCCCATGACTGCCAGAGAGTGG - Intronic
1091903695 12:4165480-4165502 GCCCCCGGTCTGCCTGGGACTGG + Intergenic
1091921451 12:4308126-4308148 TCCCCAGGGCAGCCTGGGGAAGG + Intergenic
1094124956 12:27014162-27014184 ACCCCATTGCTGCCTGGGCCGGG + Exonic
1095970820 12:47901058-47901080 ACCCCAAGGCTGGCTGGGAGAGG - Intronic
1096521230 12:52185893-52185915 TCTCCATGCCTGCCTGGGGCTGG + Intronic
1097013700 12:55970801-55970823 TCCCCAAGGCTGGGTGGGTCTGG - Intronic
1097225522 12:57475064-57475086 TCCTCCTGGCTGCCTGTGCCAGG + Intronic
1097487609 12:60225410-60225432 CCCCCAAGGCTGCCTGCCACAGG - Intergenic
1098143319 12:67472791-67472813 TCCCCGTGGCTGCCTGAGTGAGG - Intergenic
1098465383 12:70780985-70781007 TTACCATTGCTGCCTGTGACTGG + Intronic
1102028404 12:109726515-109726537 GCCCCATGGCTGCCCGGGGTGGG - Intronic
1102549836 12:113683729-113683751 TGCCCATGGCTGCCTTGGGTAGG + Intergenic
1102563402 12:113778883-113778905 TCCCCATCTCCTCCTGGGACGGG + Intergenic
1102827678 12:115963232-115963254 CCCTCATAGCTGCATGGGACAGG - Intronic
1103629809 12:122251048-122251070 GCCCCTTGGCTGCGTGGTACAGG + Exonic
1103700442 12:122846400-122846422 TGCCCATGCCTGGCTGGGGCTGG + Intronic
1104568506 12:129904697-129904719 TCCCCAGGGCTCACTGGGAAAGG + Intergenic
1104786794 12:131455456-131455478 GCCCCATGGCTGCTCTGGACAGG + Intergenic
1104831911 12:131758152-131758174 ACCCCATAGCTGGCTGGGTCAGG - Intronic
1104966024 12:132509187-132509209 TCCCAGTGGCTGGCTGGGAGCGG - Intronic
1105914738 13:24902860-24902882 TTCCCATGGCTGCCTGCTGCGGG - Intronic
1106181203 13:27371370-27371392 TCCCCATGGATGGCTTGGTCTGG - Intergenic
1108704647 13:52974278-52974300 TCCCAATGGATTCCTGGGTCTGG + Intergenic
1109944882 13:69420524-69420546 TCCCCATGTCTGTCTGAGTCTGG + Intergenic
1114107275 14:19438746-19438768 CCCCCATGGGTGACTGGCACTGG + Intergenic
1114576764 14:23722017-23722039 TGCCAATGGCTGCCTGGCAGAGG + Intergenic
1116683723 14:48011239-48011261 TCCCCATGGGTGCCTCACACAGG - Intergenic
1117736976 14:58777551-58777573 TTCCCATGGCTGCCGTGAACTGG + Intergenic
1118752238 14:68815954-68815976 TCCCCATGGTGGTCAGGGACTGG + Intergenic
1119230037 14:72972418-72972440 TCCCCAGGGGTACCTGGGAGAGG - Intronic
1120974278 14:90235226-90235248 TCCACCTGGCTACCCGGGACTGG - Intergenic
1121016615 14:90552933-90552955 CCCCTATGTCTGACTGGGACTGG - Intronic
1121337868 14:93088197-93088219 TCCCTGTTTCTGCCTGGGACAGG - Intronic
1121409987 14:93743204-93743226 CCCCCATGGCTCCCTGGTTCCGG + Intronic
1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG + Intergenic
1121909470 14:97776084-97776106 TCCTCATGGCTTCCTAGGACTGG + Intergenic
1122856552 14:104562995-104563017 TCCCTCTGGCTGCCAGGGAGTGG - Intronic
1122979343 14:105184652-105184674 TCACCGTGGCTGCCTGGGGCCGG + Intergenic
1123202398 14:106679060-106679082 ACCTCATGACTCCCTGGGACAGG + Intergenic
1202865572 14_GL000225v1_random:114946-114968 TCCCCGTGGAAGCCTGGGGCAGG - Intergenic
1124081653 15:26504350-26504372 TCCACATGGCAGCCAGGTACAGG + Intergenic
1124385866 15:29207806-29207828 TCCCCAGGCCTGGCAGGGACTGG - Intronic
1125341262 15:38677809-38677831 TCTCCATGGCTGTCTTGGCCTGG + Intergenic
1125766553 15:42140502-42140524 TCACCATGGCTGCCTGTCACAGG - Exonic
1127454955 15:59148585-59148607 GCACCATGTCTGCCTGGGCCAGG + Intronic
1127690795 15:61394988-61395010 TCCCCCTGGGAGCCTGGGTCTGG - Intergenic
1127795290 15:62432925-62432947 TCCCCATGCCTGCCTGGCAAGGG - Intronic
1128818231 15:70629739-70629761 TCCACATGGCTTCCTGGTCCTGG + Intergenic
1129056004 15:72820915-72820937 GCCCCAGGGCTGCTTTGGACTGG - Intergenic
1129191675 15:73941308-73941330 TCACCCTGGCTGCCTGGACCAGG + Intronic
1129394704 15:75237532-75237554 TCCACTTGGCTCCCTGGGGCAGG + Intergenic
1131273569 15:90961466-90961488 TCCCCAAGGTTGCCTGGCTCTGG + Intronic
1131437931 15:92437995-92438017 TCCCCAGGACTGCCTGGCTCGGG - Intronic
1132209383 15:100008662-100008684 TGCCCAAGTCTCCCTGGGACAGG - Intronic
1132344962 15:101102545-101102567 ACCCCATGGCTGCCAGGGGTGGG - Intergenic
1132404354 15:101533366-101533388 TACCCATGCACGCCTGGGACTGG + Intergenic
1132756368 16:1487381-1487403 ACCCGATGGCTGCCTGAGGCTGG + Exonic
1132799730 16:1746083-1746105 ACCCAGCGGCTGCCTGGGACAGG + Intronic
1133324748 16:4936155-4936177 TTCCCAGGGCGGCCTGGGAGGGG - Intronic
1135136787 16:19890852-19890874 TCCCCATGGCAGCCTTGCAGGGG - Intergenic
1135155109 16:20046085-20046107 TCCCAATGGCTGCCAGGGGTAGG + Intronic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1138336001 16:56253184-56253206 TCCCCAGGGCAGCCTGGCTCTGG + Intronic
1139606633 16:68023383-68023405 TCCCCAAGGCTGGCCGGGTCTGG - Exonic
1140914957 16:79484615-79484637 TCCAGATGGCAGCCTGGGTCAGG + Intergenic
1142866745 17:2796059-2796081 TCCCGAGGGCTGCCTGAGACAGG - Intronic
1142966625 17:3585783-3585805 TCACCATGGCTGCCTACTACAGG - Exonic
1143046861 17:4088388-4088410 TCCCCATGGCAGCCACGGCCAGG + Intronic
1143491251 17:7286416-7286438 GCCCCATAGCCTCCTGGGACAGG - Exonic
1143515867 17:7418924-7418946 TCCCCTGCCCTGCCTGGGACTGG - Exonic
1143855261 17:9843544-9843566 TCCCCATGGCTTCCCAGGAAAGG + Intronic
1144588556 17:16504296-16504318 TCCTCATTGCTGCCTGTCACTGG + Intergenic
1144807944 17:17979883-17979905 TTCCCAGGGCTGGGTGGGACTGG - Intronic
1144826705 17:18109245-18109267 TCCCCAAGGCTGGCTGGCAAAGG + Intronic
1146620045 17:34390161-34390183 TCCCAGTGGCTGCCTGTGGCTGG + Intergenic
1148329785 17:46806876-46806898 TCACGATGGCTGCTGGGGACGGG + Intronic
1149772402 17:59331976-59331998 TCCCCGTGGGCGCCGGGGACGGG + Intronic
1150103925 17:62447928-62447950 TACCCATGGCAGCCAGGCACTGG + Intronic
1150432459 17:65129269-65129291 TCCCCTTGCCTGACTGTGACGGG - Intergenic
1151963499 17:77419541-77419563 TCCCCAGGGCTGGCTGGGAATGG + Intronic
1152233362 17:79125827-79125849 TCCCCATTTCTGCCTGGAATGGG - Intronic
1153940358 18:9971282-9971304 TTCCCATGGCTTCCTAGGAAAGG - Intergenic
1154502352 18:15003147-15003169 AACCCATGGCAGCCTGGGCCGGG + Intergenic
1160515736 18:79478349-79478371 TCCCCTTGGCTGCCTTGGTGTGG - Intronic
1161128510 19:2574054-2574076 TCACCTTGGGTGCCTGGGTCTGG + Intronic
1161322133 19:3646189-3646211 GCGCCATGGCTTCCTGGGAGGGG + Intronic
1161607293 19:5222262-5222284 GCCCCATGAGTGCCTGGCACTGG + Intronic
1161719507 19:5895206-5895228 TGCCCATGGATGCCAGGGCCAGG + Intronic
1161898224 19:7098845-7098867 TCCCCATGGCACCCTGGGCTCGG - Intergenic
1162042474 19:7979115-7979137 TCCCCGAGGCTCCCTGGGCCTGG - Intronic
1162362327 19:10227551-10227573 GGCCCAAGCCTGCCTGGGACTGG - Intronic
1162815401 19:13191200-13191222 TCTCCCTGGCTGGCTGGGGCGGG + Intergenic
1162904926 19:13817763-13817785 TCCCCAGGGCTCCCGGGCACAGG - Exonic
1163127580 19:15252587-15252609 ACCCCATGGCTGCCCAGGAAGGG - Intronic
1163329697 19:16628394-16628416 TCCCAACGGCTGCCTAGGCCGGG - Intronic
1163590770 19:18193101-18193123 TCCCCGAGGCTGCCTGCGATTGG + Intergenic
1164534324 19:29073827-29073849 TCCCCATTGCTGCCTTGGTGGGG - Intergenic
1165269225 19:34690409-34690431 TCCAAATGACAGCCTGGGACAGG - Intergenic
1166033115 19:40147901-40147923 CCTGCAGGGCTGCCTGGGACTGG + Intergenic
1166040268 19:40198173-40198195 CCCTCATGGGAGCCTGGGACAGG + Intronic
1166329648 19:42070438-42070460 TGCCCAGGGCTGCCTGGGCAGGG - Exonic
1166457003 19:42949991-42950013 TACCCAGGTTTGCCTGGGACAGG + Intronic
1166885569 19:45959053-45959075 TCCCCATTTCTGTCTGGCACCGG + Intronic
1167381680 19:49142069-49142091 TACCTTTTGCTGCCTGGGACGGG + Exonic
1167427566 19:49437296-49437318 TCCCTAGGGATGCCTGGGACGGG - Intronic
1167450783 19:49567520-49567542 GCCCCAGGGCTTCCTGGGACTGG + Intronic
1167593371 19:50415948-50415970 CCCCCATGGCAGCCTGGGTGTGG + Intronic
1168107629 19:54174136-54174158 GCCCCAGGGCTGCCAGGGCCAGG + Exonic
1168452942 19:56479956-56479978 TTCCCATGGGTTCCTGGGGCAGG - Intergenic
925006508 2:447208-447230 TCCCCATGTCTGAGTGGGGCAGG - Intergenic
925542010 2:4976612-4976634 TCCCCATGGTGGCCTGGGGAGGG + Intergenic
926113611 2:10197453-10197475 TTCCCAGTGCTGCCTGGGGCAGG - Intronic
927720602 2:25379512-25379534 TCTCCATGGCTGCCTCGGGTTGG - Intronic
928027160 2:27749692-27749714 TCCCCATGATTGGATGGGACTGG + Intergenic
929598935 2:43193026-43193048 GACACATCGCTGCCTGGGACAGG - Intergenic
934234342 2:90216958-90216980 GCCACATGGCTGCCTGGCAGGGG - Intergenic
934526427 2:95054713-95054735 TCCCCATGGCTGCCAGCAAGAGG - Intergenic
935552093 2:104468458-104468480 ACCCCATGCTTCCCTGGGACAGG - Intergenic
935785359 2:106544021-106544043 TCCCCATGGATGCCTAGCAAGGG + Intergenic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
936075514 2:109399078-109399100 TGCCCTTTGCTGCCTGGCACTGG + Intronic
936075647 2:109399986-109400008 TCCCTCTGGCTGCCCTGGACAGG + Intronic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
937892049 2:126946467-126946489 GCTCCATGTCTGCCTGGGAATGG - Intergenic
938466860 2:131530370-131530392 TCTCCATGTCTCCCTGGGAAGGG - Intronic
938501526 2:131833319-131833341 AACCCATGGCAGCCTGGGCCGGG + Intergenic
940018916 2:149135906-149135928 TCCCCATGCCAGGCTGGGAGTGG + Intronic
943802969 2:192085523-192085545 TTCATATGGCTGCCTGGGATGGG - Intronic
944641866 2:201735193-201735215 TCCCCCTGCCTGCCTGGCTCTGG - Intronic
947962539 2:234251684-234251706 TCTCCCTGCCTTCCTGGGACTGG + Intergenic
948147588 2:235719680-235719702 TGCCCAAGGCTTCCTGGGTCAGG + Intronic
948888609 2:240896328-240896350 ACCCCAAGCCTGGCTGGGACAGG - Intronic
948991796 2:241559244-241559266 TCCCCGAGGCTGCCAGGGACCGG - Intronic
949058407 2:241942362-241942384 GCACCATGGCTGCCTGGGCAGGG + Intergenic
1169273341 20:4217117-4217139 TCCCCAGGGCTGCTTGGGGCTGG - Intergenic
1171092240 20:22296296-22296318 TCCTCTTGGATGCCTAGGACGGG - Intergenic
1172843081 20:37913735-37913757 TGCGCCTGGCTGCCTGGGTCTGG + Intronic
1173933387 20:46840276-46840298 TCCCCTTCCGTGCCTGGGACAGG - Intergenic
1174549889 20:51354777-51354799 ACCCCAGGGCTACCTGGTACAGG - Intergenic
1174891928 20:54404635-54404657 TCCACATGGGTGGCTGAGACAGG - Intergenic
1174938625 20:54898908-54898930 TCTCTATACCTGCCTGGGACTGG + Intergenic
1175881774 20:62263413-62263435 TTCCCAGGGCTTCCTGGGAATGG - Intronic
1176910488 21:14559338-14559360 TCCCCATTGCTGCCTTGGTAAGG - Intronic
1178426564 21:32483501-32483523 TTCCCCTGACTGCCTGGGAGTGG - Intronic
1178431281 21:32520641-32520663 TTCCCTTGACTGCCTGGCACTGG - Intergenic
1179171328 21:38975244-38975266 GCCACATGGCTGAATGGGACTGG - Intergenic
1179716215 21:43290127-43290149 CCCCCATGGCTGCCTTGGGAGGG + Intergenic
1179827288 21:43973306-43973328 TCCAGATGGCAGGCTGGGACAGG + Intronic
1183103371 22:35597836-35597858 TCCCAATGGCTACCAGGGCCTGG - Intergenic
1183391334 22:37547001-37547023 GCCCTGTGGCTGCCTGGGCCAGG + Intergenic
1183590657 22:38777569-38777591 TCCCCTTGGCTGCATGGGTCTGG + Intronic
949547479 3:5084366-5084388 TCAGCATGTCTTCCTGGGACCGG + Intergenic
950177634 3:10886354-10886376 TGCCCAAGGCTGTATGGGACAGG - Intronic
952793356 3:37217724-37217746 TCCCCAAGTCTGCCTGAGTCTGG - Intergenic
952973393 3:38671630-38671652 TCCCCATTGCTGGCTGGGGAAGG - Intergenic
953465700 3:43117476-43117498 TCTCTATGGCTGGCAGGGACAGG - Intergenic
953911139 3:46893587-46893609 TCCCCAGGGGTACATGGGACTGG - Intronic
954682865 3:52355349-52355371 TCCCCAGGGCTGCCTGAGCTTGG + Intronic
956749932 3:72337177-72337199 TCTCCCAGGCTGCCTGGAACAGG + Intergenic
958573086 3:95912256-95912278 ACCCCCTTGCTGCCTGGGACAGG + Intergenic
961313300 3:126017405-126017427 GACCCTTGGTTGCCTGGGACTGG - Intronic
961579838 3:127871591-127871613 AACCCGTGGCTGCCTGGGGCTGG - Intergenic
963293857 3:143523054-143523076 TCCCCATGGGATTCTGGGACTGG - Intronic
963933904 3:151033488-151033510 TCCCCGTGAATGCCTGGCACAGG - Intergenic
965105590 3:164348007-164348029 TCACCATGGCAGCCTGGGTTTGG - Intergenic
966402576 3:179562804-179562826 CCCCCATGGCTGCCTTCGATTGG + Intergenic
966940191 3:184741237-184741259 TCCCCATGGCTGGGTGGAAAGGG - Intergenic
968492740 4:899122-899144 TCCACATGGATGCCTGGTGCTGG - Intronic
968505277 4:968447-968469 CCCCCAGGGCTCCCTGGGGCCGG + Intronic
968706614 4:2081271-2081293 TCCCCATGCATGCCTGGCAGGGG - Intronic
968833777 4:2948038-2948060 TCCCCATGCCTGCCTCTGGCTGG + Intronic
969351088 4:6598323-6598345 CCGCCATGGGTGCCTGGGGCTGG - Exonic
969464962 4:7350875-7350897 TCTTCGTGGCTGCTTGGGACAGG + Intronic
969675072 4:8610108-8610130 TCCCAAGGGCTTCCTGGGGCAGG + Intronic
969845688 4:9918436-9918458 TCCCCATGGCTGCCTAGGGATGG + Intronic
978379547 4:108112428-108112450 TGCCCATGGGTGGGTGGGACTGG - Intronic
978819237 4:112946261-112946283 TCCCCATGCCTGCCTGTGGTGGG + Intronic
982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG + Intergenic
982115863 4:152097900-152097922 TGCCCATGGCTGCCTGTTAATGG - Intergenic
982916846 4:161222230-161222252 TACCCATCTCTGCCTGGGATGGG + Intergenic
984710564 4:182880766-182880788 GTACCATGGCTGCCTGTGACGGG + Intergenic
988609972 5:32714154-32714176 TTCCCAAGGCCGGCTGGGACTGG + Intronic
988696056 5:33623680-33623702 TCCCAATTGCTCCCTGGGAGGGG - Intronic
989560079 5:42840567-42840589 ACCCCATGGCAGCCTGCCACTGG - Intronic
990317043 5:54592461-54592483 TCTCAATGGTTGCCTGGCACTGG + Intergenic
990449056 5:55918519-55918541 TCCCCTGTCCTGCCTGGGACTGG + Intronic
990644003 5:57822845-57822867 TGGCCATGGCTGACTGGAACAGG - Intergenic
995493916 5:112721957-112721979 TCCCCAGGGCTGCATGGCCCAGG - Intronic
995822840 5:116256831-116256853 TCCACGTGGCTGGCTGAGACAGG - Intronic
997653769 5:135540443-135540465 TCCCTAGGGCTGCCTGGAACAGG - Intergenic
999190304 5:149742230-149742252 CCCCCATGGTTGCCTGGTATAGG - Intronic
999431739 5:151530968-151530990 TCCCCATGGCTCCCCTGGAATGG - Intronic
999450343 5:151673071-151673093 TGCCCTTGGCTGCCTGGGCCTGG - Intronic
1000086208 5:157889547-157889569 TCCCCATGACTGCCTGGGACAGG - Intergenic
1001025354 5:168219662-168219684 TCCCAGTGGCTGGCTGAGACTGG + Intronic
1002173973 5:177391105-177391127 TGCCCATCCCTGCCTGGGCCTGG - Intronic
1002574251 5:180162475-180162497 CCCACATGGCTGCCTGTGAAAGG - Intronic
1002615444 5:180451986-180452008 TCCCCATGGCTGAATGTGAATGG + Intergenic
1003630122 6:7779221-7779243 GCACCATGGTTGCCTGGCACTGG - Intronic
1006630864 6:35428596-35428618 AACCCATGGCTGCCGGGGGCTGG - Intergenic
1007687647 6:43676517-43676539 CCCACCAGGCTGCCTGGGACAGG + Intronic
1011522852 6:88228752-88228774 TCCATACTGCTGCCTGGGACTGG - Intergenic
1015248842 6:131105448-131105470 TCCCCTTGCCTGGTTGGGACAGG - Intergenic
1015830430 6:137363112-137363134 TCTCCAGGGCTGTCTGTGACAGG - Intergenic
1016731399 6:147431999-147432021 TCCCCAGCGCTGCCTGTGCCAGG + Intergenic
1017138468 6:151168655-151168677 TTCCTATGTCTGCCTGGCACAGG - Intergenic
1018824177 6:167397025-167397047 TGCCCTTGACTGCCTGTGACAGG - Intergenic
1018965498 6:168484783-168484805 TCCACATTGCTGCCTGTGTCAGG - Intronic
1019147974 6:169986928-169986950 TGCCCAGTGCTGCCTGGGGCAGG - Intergenic
1019273523 7:163976-163998 TCCTCGTGGCTGCCTGGGACTGG - Intergenic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1019881403 7:3864643-3864665 TCCCCAGGGCTGTCTGAGACTGG - Intronic
1019929621 7:4215003-4215025 ACCTCATGGCTGCCTGGGGAAGG + Intronic
1022442487 7:30445790-30445812 TCCACATGGAAGCATGGGACAGG - Intronic
1023116127 7:36864428-36864450 TCACCAAAGCTGCCTGGGAGGGG + Intronic
1023874997 7:44282116-44282138 TCTCCATGGCACCCTGTGACAGG + Intronic
1024295758 7:47840731-47840753 TCTCCAGGGAAGCCTGGGACTGG - Intronic
1026853183 7:73737416-73737438 TCCCTATGTCTGCCTAAGACTGG - Intronic
1026888968 7:73971121-73971143 GCCCCATGGCTGGCTGCGGCTGG - Intergenic
1030058945 7:105607785-105607807 TCCCCATGGCCTCCTCGGATGGG + Exonic
1030077423 7:105748600-105748622 TCCCCCTGGTTACCTGGGCCTGG + Intronic
1032963217 7:137064974-137064996 ACTCCATGGCATCCTGGGACTGG + Intergenic
1033665307 7:143435643-143435665 TCCTCATGGCTCCCTGAGCCTGG + Intergenic
1034254261 7:149715691-149715713 CATCCATGGCTGCCTCGGACTGG - Intronic
1034878181 7:154743719-154743741 TCCTCAGGGCTGACTGGGACTGG - Intronic
1034878203 7:154743816-154743838 TCCTCAGGGCTGACTGGGACTGG - Intronic
1035393304 7:158519742-158519764 TTCCCTTGGCTGCTTGGGATGGG - Intronic
1036787159 8:11695655-11695677 ACCTGATGGCTGCCTGGGAGAGG - Intronic
1037908147 8:22727548-22727570 TCCCTATTGGTGCCTGAGACTGG + Intronic
1038078460 8:24104359-24104381 TCCTCCTGGCTGCCTGGGAGTGG + Intergenic
1038870691 8:31489968-31489990 TCCCCAGGGCTGGCAGGGCCAGG - Intergenic
1040106572 8:43545407-43545429 TCCCCCTGGGTGACAGGGACAGG - Intergenic
1040107044 8:43547150-43547172 TCCCCCTGGGTGACGGGGACAGG - Intergenic
1040302362 8:46194692-46194714 GCCCCAGGGCTGTCTCGGACTGG + Intergenic
1040303391 8:46199727-46199749 CCCCCAGGGCTGTCTGGGGCAGG + Intergenic
1040307783 8:46221140-46221162 TCCCCAGGGCTGTCTCGGGCTGG + Intergenic
1040310259 8:46233204-46233226 CCCCCATGGCTGTCCGGGGCGGG + Intergenic
1040330858 8:46385105-46385127 TCCCCATGGCTGGCTTTGGCTGG + Intergenic
1040336832 8:46420352-46420374 CCCCCAGGGCTGTCTGGGGCGGG + Intergenic
1041019630 8:53625775-53625797 TAACGATGGCTGCCTGGGAGTGG + Intergenic
1041077488 8:54182328-54182350 TCCCTTTGACTGCCTGGAACAGG - Intergenic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1042485017 8:69338837-69338859 TCCACATGCCTGGCTGGGCCGGG - Intergenic
1042721767 8:71833963-71833985 CCCCCATGACAGCCTGGGGCTGG + Intronic
1048517522 8:135124317-135124339 ACCCCATGGCAGCCCTGGACTGG - Intergenic
1049223191 8:141437080-141437102 TCCCCATGGCGGGCAGGGCCAGG - Intergenic
1049349145 8:142154768-142154790 TCCACATGCCTGCCGGGGCCAGG - Intergenic
1049599475 8:143500384-143500406 TCCCCATGCCAGCCTGTAACAGG + Intronic
1049795862 8:144497007-144497029 CCCCCAGGGCTGCCTGGGCCTGG + Exonic
1050064041 9:1739954-1739976 TCACCATGGCTGCCATGCACAGG - Intergenic
1050222460 9:3408843-3408865 TCACCATCTCTGCCAGGGACGGG - Intronic
1053043064 9:34891102-34891124 TCTCAGTGGCTTCCTGGGACAGG + Intergenic
1053283385 9:36835843-36835865 CACCCATGCCTGCCTGGGCCTGG + Exonic
1055227427 9:74015761-74015783 TCCCCATGGTTGCCTGGGGTGGG - Intergenic
1057203832 9:93158848-93158870 TAACCATGGCTGCCTGGGTGGGG - Intergenic
1057858141 9:98618124-98618146 TCCCCATGGCTGTCAGGCTCAGG + Intronic
1060473951 9:123971184-123971206 TCCCCCTGACTGCCTGGGAGAGG - Intergenic
1060503472 9:124180702-124180724 TCCCCAGGGCTGGCTGGCTCTGG + Intergenic
1060820388 9:126658377-126658399 TCCCCCTGGCTGCCGGGCCCGGG + Intronic
1061012217 9:127962416-127962438 TCCCCAGGACTGCCGGGGATTGG - Intronic
1061014871 9:127975814-127975836 GCCCAAGGGCTGCCTTGGACAGG + Intronic
1061574515 9:131497665-131497687 ACCCCAGAGCTGCCTGGGAAAGG + Exonic
1061681557 9:132245020-132245042 CCCCCATGCCAGCCTGGCACTGG - Intergenic
1061934291 9:133848798-133848820 ATCCCATGGCAGCCTGGCACCGG + Intronic
1061978915 9:134088543-134088565 TCCCCTTCGCTGCCTGGCAAGGG - Intergenic
1062024199 9:134332881-134332903 TCAGCATGGCAGCCTGGGAAGGG + Intronic
1062552900 9:137098245-137098267 CCCCCAGAGCTGCCTGGGACTGG - Intronic
1186428502 X:9484434-9484456 CACCAATGGCTGCCTGGGAAAGG - Intronic
1187073403 X:15910995-15911017 TGACCATGGTTCCCTGGGACCGG + Intergenic
1188078526 X:25807850-25807872 TCCCCATGGCCACCAGGGCCGGG + Intergenic
1190742413 X:53298284-53298306 TCCCCAGGGCTTCCTGAGAAAGG + Intronic
1192222165 X:69204619-69204641 TCCCCATGTCTGCCTGGCCCAGG - Intergenic
1195254973 X:103081778-103081800 CCCCCATGCCAGCCTGGGACAGG + Intronic
1197262323 X:124332630-124332652 GCCGCAAGGCTGGCTGGGACCGG - Intronic
1199263956 X:145808599-145808621 TGCCCAGCACTGCCTGGGACTGG - Intergenic
1202151935 Y:21851433-21851455 TCCCCATGGCTGTCTCACACAGG + Intergenic