ID: 1083815095

View in Genome Browser
Species Human (GRCh38)
Location 11:65128222-65128244
Sequence TAGGCCAAGTGGAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083815095_1083815106 8 Left 1083815095 11:65128222-65128244 CCAGCCTCTTTCCACTTGGCCTA 0: 1
1: 0
2: 1
3: 14
4: 249
Right 1083815106 11:65128253-65128275 CGCCTCTTTCTCAGAGCTGGGGG 0: 1
1: 0
2: 0
3: 21
4: 164
1083815095_1083815108 21 Left 1083815095 11:65128222-65128244 CCAGCCTCTTTCCACTTGGCCTA 0: 1
1: 0
2: 1
3: 14
4: 249
Right 1083815108 11:65128266-65128288 GAGCTGGGGGTACTACTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 99
1083815095_1083815102 5 Left 1083815095 11:65128222-65128244 CCAGCCTCTTTCCACTTGGCCTA 0: 1
1: 0
2: 1
3: 14
4: 249
Right 1083815102 11:65128250-65128272 TGCCGCCTCTTTCTCAGAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 159
1083815095_1083815103 6 Left 1083815095 11:65128222-65128244 CCAGCCTCTTTCCACTTGGCCTA 0: 1
1: 0
2: 1
3: 14
4: 249
Right 1083815103 11:65128251-65128273 GCCGCCTCTTTCTCAGAGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 129
1083815095_1083815105 7 Left 1083815095 11:65128222-65128244 CCAGCCTCTTTCCACTTGGCCTA 0: 1
1: 0
2: 1
3: 14
4: 249
Right 1083815105 11:65128252-65128274 CCGCCTCTTTCTCAGAGCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083815095 Original CRISPR TAGGCCAAGTGGAAAGAGGC TGG (reversed) Exonic
900899313 1:5506251-5506273 TTGGCCAAGAGGACAGAGCCTGG - Intergenic
901889607 1:12251450-12251472 TAGGACAAATGGAAAGATCCTGG - Intronic
902186559 1:14729791-14729813 TAGGCCACACGGAAACAGGCTGG - Intronic
902531640 1:17094393-17094415 TGGGCCAGGTGGAAAGGGGCAGG - Intronic
902779213 1:18693634-18693656 GACCCCAAGGGGAAAGAGGCGGG + Intronic
903886198 1:26542506-26542528 GAGGCCACGTAGAAAGGGGCTGG + Intronic
903959445 1:27047468-27047490 CAGGCCAAGGGGAAGGAGGTGGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904327335 1:29735639-29735661 TTGCCCAAGAGGAGAGAGGCCGG + Intergenic
906156358 1:43616447-43616469 TGGGACAAGAGGAAAGAGGCAGG + Intronic
911183973 1:94885482-94885504 ATGGCTTAGTGGAAAGAGGCTGG - Intronic
914249104 1:145907204-145907226 TAGGCCAAAGGGAAAGAGCATGG + Intronic
914746698 1:150506440-150506462 TAGAGCAAGTGGAAGGTGGCAGG - Intronic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
917595309 1:176523238-176523260 TAGGGAAAGTGGGAAAAGGCTGG - Intronic
918102049 1:181384926-181384948 TTGGTAAAGAGGAAAGAGGCAGG - Intergenic
921623887 1:217356907-217356929 CAAACCAAGTGGGAAGAGGCTGG + Intergenic
922030563 1:221793647-221793669 TAGACCAAGCAGAAAGAGCCTGG + Intergenic
922471429 1:225879652-225879674 TTGGCAAAGAGGAGAGAGGCTGG - Intronic
922702958 1:227772435-227772457 TATGCCAAGTGAAATAAGGCAGG - Intronic
923260015 1:232259461-232259483 TATGCCAAGTGGACTGAGCCAGG - Intergenic
1063913676 10:10858418-10858440 TAGGCCAAATTCAAAGAGACAGG + Intergenic
1065732772 10:28724305-28724327 TGGGCCAATGGGAAAGAGGTTGG + Intergenic
1066455323 10:35567351-35567373 AAGGTCAAGTGGGAAGAGCCTGG - Intronic
1069563796 10:69450179-69450201 AAGGCCAGGTGGGAGGAGGCTGG + Intergenic
1069855626 10:71439484-71439506 TAGGCCCAGTAGATGGAGGCAGG - Intronic
1069861880 10:71476562-71476584 TTGGCCAAGAGGACAGAGGATGG + Intronic
1070585951 10:77766271-77766293 AAGTCCAGGTGGAAAGAGGAAGG + Intergenic
1071994520 10:91134770-91134792 TAGACCAAGTGATAAGAGCCAGG - Intergenic
1073471148 10:103723155-103723177 TGGGCCAGGTGGGGAGAGGCAGG - Intronic
1074113865 10:110441349-110441371 GAGGCCACGTGGAGAGAGGGTGG - Intergenic
1075060773 10:119255296-119255318 TGTTCCAAGTGGAAAGAGCCTGG - Intronic
1075458440 10:122599994-122600016 TCGGCAAAGTGGAACGAGGAGGG - Intronic
1075499761 10:122962267-122962289 TTGGCTGAGTGGTAAGAGGCAGG - Intronic
1075647560 10:124106530-124106552 TAATCCCAGTGGAAAGTGGCAGG - Intergenic
1076372582 10:129964762-129964784 AAGGAGAAGTGGGAAGAGGCAGG + Intergenic
1077117798 11:893189-893211 GGGGCCAAGTGGACAGAAGCAGG - Intronic
1078636296 11:13053558-13053580 TTGTCCTAGTGGAAAGGGGCAGG + Intergenic
1079041422 11:17063654-17063676 GATGCCAGGTGGAGAGAGGCAGG - Intergenic
1082779335 11:57274297-57274319 TAGGCCAAGTGGAATGAGTGTGG - Intergenic
1083815095 11:65128222-65128244 TAGGCCAAGTGGAAAGAGGCTGG - Exonic
1083849290 11:65355630-65355652 TAGGCCGAGTGGAAGCCGGCTGG - Intronic
1083929884 11:65835694-65835716 TAAGGCAGGAGGAAAGAGGCTGG + Intronic
1084565984 11:69929350-69929372 GTGCCCAAGAGGAAAGAGGCCGG - Intergenic
1089328392 11:117673204-117673226 TAAGCCAAGTGGAATTAGGTAGG + Intronic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089654313 11:119935761-119935783 TACCCCAAGTGGAAAGAGCTTGG + Intergenic
1090537149 11:127655568-127655590 TAGGACAATAGGAAAGAGGTTGG + Intergenic
1090726942 11:129536514-129536536 TAGGCACAGTGGAATGAGGAAGG - Intergenic
1091407870 12:220391-220413 GAGGACATGTGGAGAGAGGCTGG + Intergenic
1093024480 12:14233608-14233630 GAGGCCATGTGGTAACAGGCGGG - Intergenic
1094778242 12:33757831-33757853 GAGCCCAAGGGGAAAGAGGAGGG - Intergenic
1095614072 12:44167946-44167968 TAGGCCAAGTAGAAAAATCCTGG + Intronic
1098866881 12:75773212-75773234 TACGGCAAGTACAAAGAGGCTGG + Intergenic
1101311039 12:103579642-103579664 GAGGCAAAGTGGAAGCAGGCAGG + Intergenic
1101477261 12:105062693-105062715 TGTGTAAAGTGGAAAGAGGCTGG - Intronic
1102509442 12:113404092-113404114 AAGGGGAAGTGGAAAGAGGGAGG - Intronic
1103015501 12:117491498-117491520 TATGCTAAGTGAAAAAAGGCAGG - Intronic
1103376796 12:120462815-120462837 GATGCCAAGGGGAAAGAAGCCGG + Exonic
1104038678 12:125115571-125115593 TATGCCAAGTGGAATGCAGCAGG + Intronic
1104345000 12:127987979-127988001 TATACCAAGTGGAATGAGGCCGG - Intergenic
1104993631 12:132640880-132640902 GAGGACTGGTGGAAAGAGGCAGG - Intronic
1105773752 13:23637822-23637844 AAGGCCACGTGGAGACAGGCAGG - Intronic
1106174785 13:27320956-27320978 TGAGCCAAGTGGAAGGATGCTGG + Intergenic
1107404222 13:40097931-40097953 TCAGCCAAATGGAATGAGGCAGG + Intergenic
1107404378 13:40098892-40098914 TCAGCCAAATGGAATGAGGCAGG + Intergenic
1109997764 13:70152185-70152207 TTGGCCAGGTGGAAAGAAACAGG - Intergenic
1112061905 13:95749413-95749435 TGGGCCAAAGGGAAAGAGGAAGG + Intronic
1112484912 13:99811304-99811326 CATGCCAAGTGGAGAGGGGCTGG + Intronic
1116866876 14:50038461-50038483 AAGGCCAAGTTGAAAACGGCAGG - Intergenic
1117763408 14:59056609-59056631 GAGGCTTAGTGGAAAGGGGCAGG + Intergenic
1119812808 14:77537502-77537524 TAAGCCAAGTTGAAATACGCTGG + Intronic
1119921663 14:78452180-78452202 TTGGCCAAGAGCAAAGATGCTGG + Intronic
1121460871 14:94076925-94076947 TAGGCTGAGTAGAAAGAGGAGGG - Intronic
1123076218 14:105668621-105668643 AAGGCCACGTGGACAGAGGCCGG - Intergenic
1123954654 15:25322833-25322855 TACACCAAGTGGAAGGAGACAGG - Intergenic
1124359113 15:29021787-29021809 TAGGGGAAGTGGAAAGATGCTGG - Intronic
1124917756 15:33993473-33993495 TGGCACAAGTGGAAGGAGGCAGG + Intronic
1125090401 15:35784264-35784286 AATGCCTAGTGGAAAGAGGATGG - Intergenic
1125756626 15:42069644-42069666 TAGGGCAAGTGGAAGGCTGCAGG + Intronic
1126498419 15:49318093-49318115 CAGGCCTAGGGGAAAGAGACAGG - Intronic
1127381400 15:58433753-58433775 TAGGCCCCGGGGAAAGAAGCAGG - Intronic
1127582137 15:60348094-60348116 AAGGTCAAGTGGAAATAAGCTGG + Intronic
1128092239 15:64926826-64926848 GAGGCCAGGTGGGCAGAGGCAGG + Intronic
1128300830 15:66565456-66565478 AAGGCCAAGTGGGGAGAGGAAGG + Exonic
1128556681 15:68636483-68636505 TAAGCCAAGTGGGAACAGGCAGG - Intronic
1128980141 15:72179894-72179916 TAGTCCCAGTGGAAAGATTCAGG - Intronic
1129139686 15:73586149-73586171 AAGTCCAAGTGCAGAGAGGCAGG - Intronic
1129168551 15:73793780-73793802 TAGGCCCATAGGAGAGAGGCTGG + Intergenic
1130296401 15:82649268-82649290 TAGACCAAGTGGATGGAGACTGG - Intergenic
1131106673 15:89739449-89739471 TAGGGAGAGTGGAAAGAGGAAGG - Intronic
1132175473 15:99710781-99710803 TAGGCCAGGAGTAAAGATGCAGG - Intronic
1133442351 16:5831355-5831377 AAAGCCAAGTGGGAACAGGCAGG - Intergenic
1134850928 16:17478295-17478317 TAGGACAAGGGGAAACAGGCTGG + Intergenic
1135083097 16:19452877-19452899 TAGAGCAAATGAAAAGAGGCAGG + Intronic
1136564804 16:31063554-31063576 TAGGCCAGCTGGAAAGGGGGCGG - Intronic
1138647168 16:58434104-58434126 TAGGCCAAATGGAGAAAGGCGGG - Intergenic
1140484904 16:75285896-75285918 TTGGAAAAGTGGAAAGATGCGGG - Intergenic
1141361641 16:83400759-83400781 TGGGCCAAATGGAAAGAGTGTGG - Intronic
1141784667 16:86191071-86191093 GAGGCCAGGAGGAAAGAGCCAGG + Intergenic
1141872059 16:86793845-86793867 TAGCGCAAGGGGAAATAGGCTGG + Intergenic
1141992505 16:87618570-87618592 GTGGCCAGGTGGAAAAAGGCTGG - Intronic
1143621272 17:8081374-8081396 TAGAGCAAGAGGAAAGAGGGTGG - Exonic
1143986583 17:10919798-10919820 AAGGTCAAGAGGTAAGAGGCAGG + Intergenic
1146179697 17:30689717-30689739 AAGGCCAAGTGAAGACAGGCAGG - Intergenic
1146195932 17:30812836-30812858 GAGGACAAGGGGAAAGAGACAGG + Intronic
1146688610 17:34857698-34857720 TTGGCCTGGTGGGAAGAGGCAGG + Intergenic
1150096575 17:62381486-62381508 TATGCCAAGTGGAAAGGCGACGG + Intronic
1150739041 17:67764861-67764883 AAGCCCAAGAGGAATGAGGCAGG + Intergenic
1203165393 17_GL000205v2_random:88663-88685 TAGTCTAAGGAGAAAGAGGCCGG - Intergenic
1153655799 18:7281046-7281068 TAGACAAAGAGGAAGGAGGCAGG + Intergenic
1153693472 18:7616647-7616669 GAGACAAAGAGGAAAGAGGCGGG - Intronic
1155024399 18:21928154-21928176 TACGCTAAGTGGAAAAAGCCAGG + Intergenic
1155789358 18:29946165-29946187 TAGGCTGAGGGGAAAGAGGAAGG + Intergenic
1155983268 18:32203206-32203228 TAGACAAAGTGGAAAGTGGATGG + Intronic
1156332697 18:36139431-36139453 CTGGCCAGGTGGAACGAGGCAGG + Exonic
1158686518 18:59620033-59620055 TAAGCCAAGTCAAAAGAGGGAGG + Intronic
1159015450 18:63098706-63098728 TATGGAAAGTGGAAACAGGCAGG - Intergenic
1162978912 19:14225845-14225867 AAGGCCAAGTGAAGACAGGCAGG + Intergenic
1163415595 19:17184685-17184707 TGGGCCCAGTGGAATGAGGTGGG - Intronic
1165138025 19:33682981-33683003 AAGGCAAAGTGGGAGGAGGCCGG + Intronic
1165347423 19:35257641-35257663 CAGGCTAGGAGGAAAGAGGCCGG + Intronic
1167469788 19:49669207-49669229 ATGGTCAGGTGGAAAGAGGCTGG + Intronic
1168286842 19:55339500-55339522 AGGTCCAAGTGGAAAGAGGGCGG - Intergenic
925524642 2:4786543-4786565 TAGGACAAGTGGCAGAAGGCAGG - Intergenic
926702000 2:15810065-15810087 GAGGGCAAGAGGAAAGAGGAGGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
928251800 2:29687277-29687299 TAAGCCAAGCAGAAAGAGGTAGG + Intronic
928255637 2:29719878-29719900 TAGGGCAAGTGGGAAGGGTCTGG + Intronic
930693261 2:54386098-54386120 TGTGCCTAGTGGATAGAGGCTGG + Intergenic
931543873 2:63359078-63359100 GAGGGAAAGTGGAAAGAGGAAGG - Intronic
931867295 2:66426383-66426405 TAGGCCAAGAGGCAGGTGGCGGG + Intergenic
931906011 2:66844742-66844764 AAACCCATGTGGAAAGAGGCAGG - Intergenic
932000490 2:67880195-67880217 TAGGCTAAGAGAAGAGAGGCTGG + Intergenic
932788850 2:74634350-74634372 TAAGTCAAGTGGTAAGAGCCTGG - Intronic
935082113 2:99808164-99808186 TAGGAAAGGTGGAAAGAGGGAGG - Intronic
938058609 2:128234848-128234870 CAGGCCATGTGGAAAGCAGCAGG + Intergenic
939710521 2:145512364-145512386 TAGGACAAGTGTGAAGTGGCAGG + Intergenic
942437978 2:176002026-176002048 TAGGCCACTTGGCAGGAGGCGGG + Intronic
947590685 2:231383386-231383408 TAGGCCAGGGGGACGGAGGCAGG - Intergenic
1171208213 20:23297467-23297489 AAGGCGAACTGGAGAGAGGCTGG + Intergenic
1171275300 20:23851756-23851778 TAGGCCAAGGGGAAATGGGAAGG - Intergenic
1171496356 20:25558756-25558778 TAGGCCAAGAGCAAGTAGGCAGG + Intronic
1172690394 20:36785792-36785814 GAGGCGAAGTGGAAACATGCAGG - Exonic
1172989188 20:39020002-39020024 TATGCCAAGTGAAATAAGGCAGG - Intronic
1173134812 20:40430128-40430150 TAAAACAAGAGGAAAGAGGCCGG + Intergenic
1174387011 20:50193291-50193313 CAGGCCAGGTGGAGAGAGGTGGG + Intergenic
1175018037 20:55812927-55812949 TAGGCAATGAGGAAAGAGGTAGG + Intergenic
1176113032 20:63419096-63419118 TAGGGCAGGTGGAAATAGGACGG - Intronic
1176336296 21:5602788-5602810 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176391461 21:6218160-6218182 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176406359 21:6370416-6370438 TAGTCTAAGGAGAAAGAGGCCGG + Intergenic
1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176493519 21:7479792-7479814 TAGTCTAAGGAGAAAGAGGCAGG + Intergenic
1176507123 21:7658591-7658613 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1176897867 21:14404304-14404326 TAGACAAAGTGGGTAGAGGCTGG - Intergenic
1180944826 22:19686885-19686907 TATGCTAAGTGGAAAAAGCCAGG + Intergenic
1181748974 22:24975998-24976020 TATGCCTTGTGGGAAGAGGCGGG + Intronic
1181883275 22:25998565-25998587 TAGGACAAGTGGAAAGATCTGGG + Intronic
1183208645 22:36436275-36436297 TGGGTCAAGTGGAAAAAGTCTGG - Intergenic
1183320031 22:37159637-37159659 GAGGCCGAGGGGACAGAGGCAGG + Intronic
1183692133 22:39396412-39396434 TAGGTCAAGTAGAAAGACTCTGG - Intergenic
1183929518 22:41228010-41228032 AAGGGCAAGGGGAAAGAGACAGG - Intronic
1184979936 22:48089091-48089113 TATGCCAAGTGAAATGAGCCAGG + Intergenic
949829516 3:8198969-8198991 GAGGGTAAGTGGAGAGAGGCTGG - Intergenic
950031772 3:9858514-9858536 TTGGCTAAGTGGAAAGATGAAGG - Intergenic
950142695 3:10626280-10626302 ATGGCAAAGTGGAAAAAGGCCGG - Intronic
950415520 3:12867039-12867061 TTGGCCAAGTGGACAGATGAAGG - Intronic
950417092 3:12875014-12875036 TTGGCCAAGTGGACAGATGAAGG - Intergenic
950520500 3:13495137-13495159 GAGGCCAGGTGGAGAGAGGGTGG - Intronic
950646708 3:14381708-14381730 TTGGCCAAGAGGAAAGGGGGCGG + Intergenic
950665968 3:14495117-14495139 AAGGCCCAGGGGCAAGAGGCTGG - Intronic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
953013582 3:39051947-39051969 TTGGCCAAAGGGAAAGGGGCAGG + Intergenic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953841038 3:46390445-46390467 GAGGCCATGTTGAAACAGGCAGG + Intergenic
954869749 3:53758805-53758827 TAGGCCAAGAGGAGAGAGCAGGG + Intronic
955101155 3:55851320-55851342 TAGTTTAAGTGGAGAGAGGCTGG - Intronic
955734110 3:62018488-62018510 TTGGCCAACTGGAAAGAGAGTGG - Intronic
957154378 3:76528942-76528964 TAGGCCAAGTAGAAAGAGGTGGG + Intronic
959272237 3:104227411-104227433 TCAGCCAAGTGGAAAGATACAGG + Intergenic
960306573 3:116069233-116069255 TAGGACATGTGGAAAGGGCCTGG - Intronic
961167430 3:124773201-124773223 AAGGTAAATTGGAAAGAGGCCGG - Intronic
961783818 3:129337513-129337535 TTGGCCAAGTGGACAGATGAAGG - Intergenic
962379488 3:134886097-134886119 AAGGTGAAGTGTAAAGAGGCAGG + Intronic
964072005 3:152646517-152646539 TAGGCACAGTGGAAAGAAGTGGG + Intergenic
964734362 3:159901137-159901159 TAGGCCAAGGGGCAGGGGGCTGG - Intergenic
967952383 3:194851298-194851320 TTGGACAAGTGGAGAGAGGTTGG + Intergenic
968735298 4:2292016-2292038 TAGGCTAAGTGGAAAGGAGGTGG - Intronic
973061099 4:45725948-45725970 TACGGCAATTGGAAAAAGGCAGG + Intergenic
973080622 4:45987848-45987870 TATGCTAAGTGAAAAGAGCCAGG + Intergenic
977744836 4:100534709-100534731 TGGACCAAGGGCAAAGAGGCTGG - Intronic
977884815 4:102243031-102243053 TAGGCAAAGCGGAAATAGGAAGG - Intergenic
978847048 4:113285800-113285822 TAGGGAAAGTGAAAGGAGGCCGG + Intronic
980229787 4:130034367-130034389 TTGGCCAAATGGAAAGATGGAGG + Intergenic
981315677 4:143337372-143337394 GGGGCCAAGGGGAAAGAGACCGG - Intronic
981413292 4:144458462-144458484 AAGGGCAAGAGGAAAGAAGCAGG - Intergenic
981614217 4:146629700-146629722 AAGGCACACTGGAAAGAGGCTGG + Intergenic
983940025 4:173528656-173528678 CAGCCCAATTGGAAAGAGGCCGG + Intronic
984121412 4:175749932-175749954 TAGGCCAAGTGTGAAATGGCAGG - Intronic
987640962 5:20611853-20611875 TAGGCCACGTGGCAAGGGCCTGG + Intergenic
988353268 5:30140497-30140519 TATGCCAAGTGAAATAAGGCAGG - Intergenic
993150136 5:84151413-84151435 CAGTCCAAATGAAAAGAGGCAGG + Intronic
993240814 5:85381975-85381997 TGGGCCAAGTAGAATGAGACTGG + Intergenic
993694751 5:91048064-91048086 TAGCAGAAGTGTAAAGAGGCAGG - Intronic
994722368 5:103394969-103394991 TTGTCCAAGTGGAGAGAAGCAGG - Intergenic
994804234 5:104422531-104422553 TAGGCTAAGGAGAAAGAGGAGGG + Intergenic
995752946 5:115472722-115472744 GAGGCCAAGAGGAGAGAGGGAGG + Intergenic
996414232 5:123192648-123192670 TAGGACAAATGGCAACAGGCAGG + Exonic
997081396 5:130743645-130743667 TAGGCAAAGTGGAAAGCTTCTGG + Intergenic
999063094 5:148655916-148655938 TAGGCCCAGTGGAAATAAGAAGG - Intronic
999178680 5:149652902-149652924 TAGGTCTTGTGGAAAGAGGGAGG - Intergenic
999777707 5:154824071-154824093 TAGGCCCAGAGCAAAGAAGCAGG + Intronic
1000191346 5:158914062-158914084 CAGGCCAAGTGGAGAAAGACAGG - Intronic
1001591123 5:172866215-172866237 AAGGCCAACTGGGGAGAGGCAGG + Intronic
1002065678 5:176650556-176650578 CAGGCCAAGTGGGAGGAGGCAGG + Intronic
1003100828 6:3175286-3175308 TAGGACAACTGGAAGGAGGGGGG + Intergenic
1003739306 6:8917079-8917101 TATGCCAAGTGGAATAAGCCAGG + Intergenic
1004046079 6:12024921-12024943 AAGGCCCAGTGGCAAGAGGGAGG + Intronic
1004421016 6:15469880-15469902 TAAGAAAAGAGGAAAGAGGCTGG + Intronic
1005695769 6:28351340-28351362 GAGCCCAAGTGGAATGAGGAGGG - Intronic
1005962496 6:30704040-30704062 TAGGCTCAGGGGAAATAGGCTGG + Exonic
1009627082 6:66147629-66147651 TAGGGGAAGAGGAAAGAGGGAGG - Intergenic
1015242106 6:131036183-131036205 TAGGCAAAGTGAAAGGAGGAAGG + Intronic
1018392248 6:163349580-163349602 TAGGACCAGAGGAAGGAGGCAGG - Intergenic
1018542889 6:164902128-164902150 ATGGCAAAGTGGAAAGAGGGTGG + Intergenic
1019497242 7:1346332-1346354 TGAGCCAAGTGGGCAGAGGCCGG - Intergenic
1019812224 7:3173159-3173181 TGGGCCAAGGGGAGAGAGGCAGG + Intronic
1021256475 7:18398566-18398588 TTGGACAAGTGGAAAGATACAGG + Intronic
1023411662 7:39894316-39894338 TGGGACAACTGGAAGGAGGCAGG - Intergenic
1023665432 7:42518148-42518170 TGGACCTAGTGGACAGAGGCCGG - Intergenic
1026970567 7:74465126-74465148 GAGGCCAGGTGGGGAGAGGCAGG + Intronic
1027828645 7:83149666-83149688 TATGCCAAATGTCAAGAGGCTGG - Intronic
1027876599 7:83778156-83778178 TATGCCATGAGGAAAGATGCAGG + Intergenic
1028825153 7:95263709-95263731 TAGAAAAACTGGAAAGAGGCCGG - Intronic
1031610181 7:123817193-123817215 TAGGCCAAGAGCAAAGAAGTAGG - Intergenic
1032522733 7:132558737-132558759 CAGGCAAAGGCGAAAGAGGCGGG - Intronic
1032538031 7:132680725-132680747 TAGCCTAAGTGCAAAGAGGTGGG + Intronic
1034191719 7:149218243-149218265 CAGACCAAGTGGAGAGATGCTGG + Intronic
1036417813 8:8566596-8566618 AAGGCCAAGTGAGAAGAGACTGG + Intergenic
1038867681 8:31457295-31457317 CAGGACAAGTGGAAAGATACAGG - Intergenic
1039401683 8:37275220-37275242 TCGGCCAGGTGTAAAGATGCTGG + Intergenic
1041184274 8:55282651-55282673 TAGGACAAGTGGGAGGTGGCTGG - Intronic
1041401778 8:57453427-57453449 TAGGCCAAGTGAAATCAGCCAGG - Intergenic
1044927937 8:97224818-97224840 GGGGCCAAGGGGAAAGGGGCTGG + Intergenic
1048231440 8:132645491-132645513 TAGGCAAAGTGGAGAGAAGAAGG + Intronic
1051042414 9:12827500-12827522 AAGGCCAAGTGACAAGAAGCTGG - Intergenic
1052264083 9:26551569-26551591 AAAGCCAAGTGGTGAGAGGCTGG + Intergenic
1055664813 9:78542815-78542837 AAGGGAAAGTGGACAGAGGCAGG - Intergenic
1057423421 9:94929640-94929662 TTGGCCAAGAGAAAAGATGCTGG - Intronic
1057795821 9:98157388-98157410 GAGGGAAAGTGGAAAGAGCCTGG - Intronic
1058165271 9:101611962-101611984 GAAGCCAAGAGGAAAGTGGCTGG + Intronic
1058616768 9:106837716-106837738 AAGGTACAGTGGAAAGAGGCTGG - Intergenic
1059844115 9:118252463-118252485 TAGAGTAAGTGGAAAGAGGGAGG - Intergenic
1061927786 9:133814553-133814575 CAGGCCAGGTGGAAGGAGGGGGG + Intronic
1203789824 EBV:144891-144913 TAGGCAAATTGAAAATAGGCAGG - Intergenic
1203425349 Un_GL000195v1:32114-32136 TAGTCTAAGGAGAAAGAGGCAGG - Intergenic
1185828653 X:3277137-3277159 AATCCCAAGTGGACAGAGGCAGG + Intronic
1186685470 X:11920787-11920809 TGGGCCCAGAGGAAAGAGGCTGG - Intergenic
1186968767 X:14817166-14817188 TCGGCCATTTGGAAAGAGGCTGG + Intergenic
1187253553 X:17621414-17621436 TAGGCCTAGAGAAAAGAGGTAGG + Intronic
1195018561 X:100802247-100802269 TAGGTGATGTGGAAAGAGACAGG + Intergenic
1196489361 X:116248712-116248734 TAGGCAAAGAGGAAATAGGAAGG - Intergenic
1196883275 X:120219940-120219962 AAGGGCAAGTAGACAGAGGCTGG - Intergenic
1201250440 Y:12052420-12052442 AAGCCCAAGTGGACAAAGGCAGG - Intergenic