ID: 1083820741

View in Genome Browser
Species Human (GRCh38)
Location 11:65170075-65170097
Sequence CACCCAGCTGTGGCTCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 341}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083820741_1083820747 2 Left 1083820741 11:65170075-65170097 CCCTGGGGAGCCACAGCTGGGTG 0: 1
1: 0
2: 3
3: 39
4: 341
Right 1083820747 11:65170100-65170122 GACTGGACTCACTGGCAGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 206
1083820741_1083820750 15 Left 1083820741 11:65170075-65170097 CCCTGGGGAGCCACAGCTGGGTG 0: 1
1: 0
2: 3
3: 39
4: 341
Right 1083820750 11:65170113-65170135 GGCAGAGAGGCAGGCGGTGAAGG 0: 1
1: 0
2: 3
3: 99
4: 868
1083820741_1083820748 6 Left 1083820741 11:65170075-65170097 CCCTGGGGAGCCACAGCTGGGTG 0: 1
1: 0
2: 3
3: 39
4: 341
Right 1083820748 11:65170104-65170126 GGACTCACTGGCAGAGAGGCAGG 0: 1
1: 0
2: 6
3: 36
4: 318
1083820741_1083820745 -6 Left 1083820741 11:65170075-65170097 CCCTGGGGAGCCACAGCTGGGTG 0: 1
1: 0
2: 3
3: 39
4: 341
Right 1083820745 11:65170092-65170114 TGGGTGCCGACTGGACTCACTGG 0: 1
1: 0
2: 0
3: 6
4: 82
1083820741_1083820749 9 Left 1083820741 11:65170075-65170097 CCCTGGGGAGCCACAGCTGGGTG 0: 1
1: 0
2: 3
3: 39
4: 341
Right 1083820749 11:65170107-65170129 CTCACTGGCAGAGAGGCAGGCGG 0: 1
1: 0
2: 2
3: 47
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083820741 Original CRISPR CACCCAGCTGTGGCTCCCCA GGG (reversed) Intergenic
900114776 1:1023849-1023871 CACCTGGCAGGGGCTCCCCACGG - Intronic
900189521 1:1347434-1347456 CACCCACCGGGGGCTGCCCAGGG - Intronic
900216471 1:1484723-1484745 CATCCAGCTGGGTCTGCCCAGGG + Intronic
900361748 1:2292539-2292561 CACACTGCTACGGCTCCCCAGGG - Intronic
900399030 1:2465410-2465432 CTCCCAGCTGTGCCGGCCCATGG + Intronic
900409814 1:2507452-2507474 CTCCCTCCTGTGGGTCCCCAGGG - Intergenic
900483133 1:2909011-2909033 CACCCAGCTCTGGCTTCCAAGGG + Intergenic
900777552 1:4596048-4596070 CACCCAGCCGTGGCAGCCCTGGG - Intergenic
900833341 1:4980604-4980626 CACCCAGCTGCCCCTCCTCAGGG - Intergenic
901664244 1:10817379-10817401 GCCCCTGCTGTGGCTTCCCAGGG + Intergenic
902756291 1:18551245-18551267 CAACCAGATGTGGCAGCCCATGG - Intergenic
902837197 1:19054696-19054718 CACCCAGCAGTCCCTCCTCATGG - Intergenic
903550579 1:24155177-24155199 CACACACCTGTGTCTCCCCAGGG - Exonic
903765113 1:25729077-25729099 CACCCCTCTGTGGCTCCTCATGG + Intronic
904268259 1:29330552-29330574 CACCTAGCTCTGCCTCCTCATGG - Intergenic
904368067 1:30029763-30029785 CATCCAACTGGGTCTCCCCAGGG - Intergenic
904829661 1:33298688-33298710 TGCCCACCTGTGGCTCTCCAGGG - Intronic
906673983 1:47679936-47679958 GAGCCAGCAGTGGCTCCCCTTGG - Intergenic
907046390 1:51302639-51302661 AACCCAGCAGGGGCTTCCCAGGG + Intronic
907247656 1:53118173-53118195 CTCCCTGCTGAGGCTCCTCAAGG + Intronic
908116240 1:60943162-60943184 CACCTTTCAGTGGCTCCCCATGG - Intronic
909145082 1:71919957-71919979 GCTCCAGCTGTGGCTCTCCAGGG + Intronic
911093019 1:94032828-94032850 TACCCAACTCTGCCTCCCCAGGG - Intronic
912390545 1:109299811-109299833 GACCCTGCTGTGGCTGCCCTCGG + Intronic
912490618 1:110060826-110060848 CTCAAAGCTGTGGCCCCCCAGGG + Exonic
912758546 1:112345835-112345857 CACCCACATGTGGCTCTCCATGG + Intergenic
913000473 1:114575437-114575459 CACCCACCTCTGCCTCCCAAAGG + Intronic
914705211 1:150164441-150164463 CACCCAGCTCTGGCTGCAGAGGG + Intronic
915172652 1:153988854-153988876 CACCCACCTCTGCCTCCCAAAGG + Intergenic
915240346 1:154516700-154516722 CACCCACCTGGGCCTCCCAAAGG - Intronic
915545768 1:156596600-156596622 CACCTCCCTGTGGCTCCTCAAGG - Intronic
920651135 1:207838313-207838335 AGCACAGCTGTGGCTCCCAAGGG + Intergenic
920879837 1:209869604-209869626 AACCCAGCTGAGGCTCTCCCAGG - Intergenic
920931522 1:210393425-210393447 CACTCAACTGTGACTCCCCAAGG - Intronic
923659920 1:235949204-235949226 CACCCACCTGTTGATACCCAGGG + Intergenic
924181781 1:241446174-241446196 CAAGTGGCTGTGGCTCCCCAAGG - Intergenic
924795300 1:247288460-247288482 CACGGGGCTGTGGCTCCACACGG + Intergenic
924800895 1:247329273-247329295 CACCCAGCTCTGGATCTCCCGGG + Exonic
1065502130 10:26392562-26392584 AGCCCAGCTGAGGCTCTCCAGGG + Intergenic
1067462363 10:46467083-46467105 GAACCTCCTGTGGCTCCCCATGG + Intergenic
1067624834 10:47917554-47917576 GAACCTCCTGTGGCTCCCCATGG - Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069923468 10:71831973-71831995 CACACAGCTGGAACTCCCCATGG + Intronic
1070401381 10:76056293-76056315 GACCCTGCTGTGGCCACCCATGG - Intronic
1070509523 10:77147707-77147729 GTCCCAGCTGGGGCTCACCATGG - Intronic
1070696525 10:78568056-78568078 CACACAACTGTGCCTCTCCAGGG - Intergenic
1073666401 10:105539089-105539111 CTCCCAGCGGTGGCTCCCTCAGG - Intergenic
1075007803 10:118842901-118842923 GACCCACCTATGGCTGCCCATGG + Intergenic
1075279819 10:121129843-121129865 CACCGAGGTCTTGCTCCCCAGGG - Intergenic
1075536620 10:123276895-123276917 CATCCAGGTGTGGGTGCCCAGGG + Intergenic
1075861763 10:125683251-125683273 CTTGCAGCTGTGACTCCCCAGGG + Intergenic
1076079302 10:127564142-127564164 CTCCCTGCTGAGTCTCCCCAGGG + Intergenic
1076259521 10:129054608-129054630 AAACCATCTATGGCTCCCCAGGG - Intergenic
1076715052 10:132359482-132359504 CACCCAGCAGTGGCCACCCAAGG - Intronic
1076744895 10:132507918-132507940 GACCCTGCTGTGGCTCCAGACGG - Intergenic
1077179400 11:1205519-1205541 CACACAGGCGTGGCTCCCCCAGG + Intergenic
1077227969 11:1446647-1446669 CACCCAGCAGAGGCTCCAGAGGG - Intronic
1077242428 11:1517601-1517623 CCCCCACCTCTGGCTCCCCCAGG + Intergenic
1077466928 11:2737913-2737935 CCCCCAGGTGTGCCTCCCCTGGG - Intronic
1078020901 11:7655270-7655292 CACCCACCTGTCACTCCTCAGGG + Intronic
1079087569 11:17457667-17457689 CACCCCGCTGCCACTCCCCAGGG - Intronic
1079233472 11:18670022-18670044 CCCCCAGCTGTGGCTGCTCTGGG + Intergenic
1080529828 11:33163783-33163805 CACCCAACTCGGCCTCCCCAAGG + Intergenic
1081666023 11:44917558-44917580 AATCCAGCTGGGGATCCCCAAGG + Intronic
1083755160 11:64788316-64788338 CCCCCAGCTGTGGGCCCTCAAGG + Intergenic
1083812869 11:65115455-65115477 CACCCTGCTGTCTTTCCCCAGGG + Exonic
1083820741 11:65170075-65170097 CACCCAGCTGTGGCTCCCCAGGG - Intergenic
1084030144 11:66476309-66476331 CCCCCAACTGTGGCCCCCCAAGG + Exonic
1084118248 11:67054362-67054384 CACCCAGCTGTGGCTCAGGACGG - Intergenic
1084857402 11:71997905-71997927 TCCCCAGCTGTGGCTTCCCATGG + Intergenic
1085303582 11:75472860-75472882 CAACCTGCTGTGGAACCCCAGGG + Intronic
1087651250 11:100871299-100871321 CACCCGCCTGTGCCTCCCAAAGG - Intronic
1089552744 11:119293350-119293372 CACCCACCTTTGCCTCCCAAAGG + Intronic
1089858342 11:121566968-121566990 CAGCCTGCTGTGCCTGCCCAAGG + Exonic
1091234165 11:134008628-134008650 CACCCAGCTGGGGCCATCCAGGG + Intergenic
1095825891 12:46530700-46530722 CACCCAGGTCTGTATCCCCAGGG + Intergenic
1096500713 12:52062554-52062576 CACCCAGCACTGCCTCACCAGGG - Intergenic
1101700772 12:107171719-107171741 CACCCACCTCTGCCTCCCAAAGG - Intergenic
1101762753 12:107672451-107672473 CACCCTGCTGTCTCTCACCAGGG + Intergenic
1102295983 12:111737020-111737042 CACCCCGCAGTGGCTCTTCAGGG - Intronic
1102423068 12:112819350-112819372 CACCCACCTCAGCCTCCCCAAGG + Intronic
1104084421 12:125461152-125461174 CTCCCAGCTCTGGCTCTCCTGGG - Intronic
1104505095 12:129324584-129324606 CACCCACCTCTGCCTCCCAAAGG - Intronic
1104658707 12:130593166-130593188 GGCCCCGGTGTGGCTCCCCAAGG + Intronic
1104814398 12:131637568-131637590 CACCCAGCAAGTGCTCCCCATGG + Intergenic
1104914523 12:132257885-132257907 CTCACAGCTGTGCCTCCGCAGGG - Intronic
1106773471 13:32985401-32985423 CACACAGCTGTCCCTCCACAGGG - Intergenic
1108290184 13:48951790-48951812 AACACAACTGTGGCTACCCAGGG - Intergenic
1109152005 13:58858554-58858576 CAGCCAGCAGTGGCAACCCACGG - Intergenic
1113851137 13:113418923-113418945 CAGCAAGGTGTAGCTCCCCAGGG - Intergenic
1115865560 14:37742660-37742682 CACCCACCTTGGGCTCCCAAAGG + Intronic
1119139673 14:72255029-72255051 CAGCCTGCTGTGTCTCCCCAGGG - Intronic
1119348455 14:73944870-73944892 TTCCCAGGTGTGGCTCCACAAGG - Exonic
1119477441 14:74939297-74939319 CACCCAGCAGTCGTTGCCCATGG - Intergenic
1120745505 14:88147510-88147532 GACCCACCCGTGGCTGCCCATGG + Intergenic
1122116043 14:99527745-99527767 CACCCAGCTGTGGCTCCCGGTGG - Intronic
1122251336 14:100442000-100442022 CACCAGGCTGTTGCTCCCAAGGG + Intronic
1122349450 14:101078930-101078952 CACCAAACTCTGGGTCCCCAGGG + Intergenic
1122397149 14:101441727-101441749 CGCCCATCTGCGGTTCCCCACGG + Intergenic
1122827310 14:104376533-104376555 CACCCAGCTCTGGCACCCCGTGG + Intergenic
1122865334 14:104601436-104601458 CACCCAGCTGTGGGTCCCCTAGG + Intronic
1124914676 15:33958333-33958355 CACCCACCTCTGCCTCCCAAAGG - Intronic
1125332767 15:38598296-38598318 CACCAAGCTGTGTTACCCCAGGG + Intergenic
1126128431 15:45316953-45316975 CAGCCAGCTTTAGCTTCCCAAGG + Intergenic
1126526994 15:49667166-49667188 AATCCAGCAGTGGCTTCCCAAGG + Intergenic
1126782507 15:52150681-52150703 AACCCAGCTGTGGCCTCCCATGG + Intronic
1126885847 15:53148916-53148938 AACCCAGCTGTAGCTCTCCCAGG + Intergenic
1128904445 15:71454474-71454496 CTCCCAGCTGTGGGGCTCCAGGG + Intronic
1129393552 15:75232588-75232610 CACCCAGCCCCAGCTCCCCAAGG - Intergenic
1129536622 15:76318370-76318392 CACACAGGTGTGGCTCCTAAGGG - Intergenic
1129750613 15:78060391-78060413 CACCCACCTGGGCCTCCCAAAGG - Intronic
1129787186 15:78317250-78317272 CAACCTTTTGTGGCTCCCCATGG + Intergenic
1130092723 15:80834550-80834572 ATGACAGCTGTGGCTCCCCAGGG - Intronic
1130166179 15:81461342-81461364 CACCCAGCTGAGGCTTCTCTAGG + Intergenic
1130639284 15:85655721-85655743 CCCCCAGCTGTGCCTCCGGAAGG - Exonic
1131153905 15:90063242-90063264 GACCCAGCTGTGGGGCCACACGG + Intronic
1131157814 15:90085551-90085573 CACCCTCCTGTGGGTCTCCAGGG + Intronic
1132167204 15:99605724-99605746 CACCCACCTTTGGCCTCCCAAGG - Intronic
1132251135 15:100336238-100336260 CATCCAGCTGCAGCTCTCCAGGG - Intronic
1132663437 16:1071470-1071492 CCCACAGCAGTGGCTTCCCAAGG - Intergenic
1132672048 16:1106034-1106056 CACCCACCCGAGGCCCCCCACGG - Intergenic
1132863201 16:2081527-2081549 TACCCATCTCTGGCCCCCCAGGG - Intronic
1132998760 16:2838704-2838726 CACCCAGCTGAGGGTGCCCCCGG + Intronic
1133504366 16:6396533-6396555 CGTCCAGCTATGGCTTCCCACGG - Intronic
1133532171 16:6665367-6665389 CACCCACCTGGGCCTCCCAAAGG - Intronic
1134516119 16:14888621-14888643 CACAGAGCTGTGGCTGCCCCTGG + Intronic
1134516383 16:14890694-14890716 CACCTAGCTGTGTCCCCACAAGG + Intronic
1134601637 16:15538206-15538228 CACCCACCTTGGGCTCCCAAAGG - Intronic
1134703792 16:16287268-16287290 CACAGAGCTGTGGCTGCCCCTGG + Intronic
1134704056 16:16289346-16289368 CACCTAGCTGTGTCCCCACAAGG + Intronic
1134963487 16:18422768-18422790 CACCTAGCTGTGTCCCCACAAGG - Intronic
1134963751 16:18424846-18424868 CACAGAGCTGTGGCTGCCCCTGG - Intronic
1134967782 16:18505367-18505389 CACCTAGCTGTGTCCCCACAAGG - Intronic
1134968046 16:18507445-18507467 CACAGAGCTGTGGCTGCCCCTGG - Intronic
1135691687 16:24542705-24542727 CACCCACCTGGGTCTCCCAAAGG + Intronic
1136381235 16:29896910-29896932 CACCCAGCCCTGCCTCCCCAGGG - Exonic
1136570667 16:31094697-31094719 CACCCAGCCAGGGCTCCCCCAGG + Exonic
1136995893 16:35187907-35187929 CACCCAGCTGGGCTTCCCCCTGG + Intergenic
1137565800 16:49531816-49531838 CCCCCAGCTCTGGCAGCCCACGG + Intronic
1137675965 16:50304040-50304062 TACCCTGCTCTGCCTCCCCAGGG - Intronic
1138393939 16:56690160-56690182 CACACACCTGTGTGTCCCCATGG + Intronic
1139373130 16:66480613-66480635 CACTCAGCTGTATGTCCCCACGG + Exonic
1140943837 16:79749053-79749075 CACCCATCTTAGGCTCCCTAAGG - Intergenic
1141361281 16:83397172-83397194 CACCAAGTTGTGTTTCCCCAAGG + Intronic
1141854197 16:86670017-86670039 GGCCCAGCTTTGGCTCTCCAGGG - Intergenic
1141906267 16:87028929-87028951 CCACCACCTGTGGCTCCCCATGG + Intergenic
1142214659 16:88824672-88824694 CACCCTCCTGTGCCTCCCCCAGG + Intronic
1142256158 16:89014807-89014829 CCACCTGCTGGGGCTCCCCAGGG + Intergenic
1143693526 17:8591293-8591315 AAGCTAGCTGTGGCTCACCAAGG - Intronic
1144658019 17:17050519-17050541 CCACCACCTGTGGCACCCCAGGG - Intronic
1144668690 17:17119107-17119129 AACTCAGCTGGTGCTCCCCAAGG + Intronic
1144954086 17:19010438-19010460 CCCCCAGCTCTGCCTCCCCGGGG + Intronic
1145063847 17:19748798-19748820 CCCCAGCCTGTGGCTCCCCAGGG - Intronic
1145754874 17:27382950-27382972 CACCCTGCTGTGGGTACCCAAGG + Intergenic
1146279987 17:31538564-31538586 TCCGCCGCTGTGGCTCCCCAGGG + Intergenic
1148124484 17:45229824-45229846 CGCCCAGCTGGGACTCCCCCAGG - Intronic
1149645973 17:58241954-58241976 CCCCCAGCCATGTCTCCCCAGGG - Intronic
1150448382 17:65245234-65245256 AATCCTCCTGTGGCTCCCCAAGG - Intergenic
1151152637 17:72100986-72101008 CTCCCAGCCTTGGCTCCCCAGGG + Intergenic
1151538247 17:74750509-74750531 CACCCAGCTCTGGCTGGACAGGG - Intronic
1151955641 17:77378852-77378874 CACCCATCTGTGACACTCCAGGG - Intronic
1152875120 17:82781974-82781996 CACGCAGCCGGGGCTCCCCAGGG + Intronic
1152876016 17:82786582-82786604 GAGCCAGCTGTGGCTGCCCAGGG + Intronic
1153466219 18:5390599-5390621 AACCCAGGTGTGTCTACCCATGG + Intergenic
1153799365 18:8656023-8656045 AAGCCAGCTGTGGCTCCCAGGGG + Intergenic
1157751252 18:50180253-50180275 CACTGGGCTGTGGCTTCCCAAGG + Intronic
1160159719 18:76461876-76461898 CATCCAGGTGAGGCTGCCCAGGG - Intronic
1160478020 18:79210348-79210370 CACCCAGGCGTGGGTCCACATGG - Intronic
1160512268 18:79459238-79459260 CACGCAGACGTGGCTCCCCTTGG + Intronic
1160554531 18:79717117-79717139 CACCCAGCTGTACCCCACCAGGG - Intronic
1160554578 18:79717245-79717267 CACCCAGCTGTACCCCACCAGGG - Intronic
1160554605 18:79717333-79717355 CACCCAGCTGTACCCCACCAGGG - Intronic
1161016229 19:1985143-1985165 CAGCCAGCAGGGCCTCCCCACGG + Intergenic
1161345934 19:3768730-3768752 CACCCTCCTGTTGTTCCCCAAGG + Intergenic
1161999418 19:7733745-7733767 CCCCCTGCCTTGGCTCCCCAAGG - Intronic
1162015544 19:7844812-7844834 CAGGCCTCTGTGGCTCCCCAAGG - Intronic
1162127716 19:8508258-8508280 CACCCTTCAGTGGCTTCCCATGG - Intergenic
1162789916 19:13057516-13057538 CCCCCAGCCTCGGCTCCCCAGGG + Intronic
1164064456 19:21703622-21703644 CACCCACCTCGGGCTCCCAAAGG + Intergenic
1164461699 19:28454581-28454603 CACCCAGCCGGACCTCCCCAGGG + Intergenic
1165384360 19:35501820-35501842 CACCCAGCCGTGGCTCCCCTGGG + Intronic
1166349166 19:42186555-42186577 AACCCATCAGCGGCTCCCCATGG - Intronic
1166518557 19:43464425-43464447 CACGCAGCTGTAGCACTCCAGGG + Exonic
1166764058 19:45242115-45242137 CACCTATCTGTGGCTCTGCAGGG - Intronic
1166765813 19:45251657-45251679 GACCCAGCCAGGGCTCCCCAAGG - Intronic
1168186882 19:54705702-54705724 TTTCCACCTGTGGCTCCCCATGG - Intergenic
1202649236 1_KI270706v1_random:165814-165836 CCCCCAGCTGGGACTCCCCAAGG + Intergenic
926910264 2:17846367-17846389 CACCCAAATGTGGCTTCACAAGG - Intergenic
927911399 2:26902352-26902374 CACCCACCAATGGCTCTCCAGGG + Intronic
928606328 2:32947536-32947558 CCCCCAGCCGTGCCTCCCCCGGG + Exonic
930444690 2:51455486-51455508 AACCCAGCAGTGGCTTTCCATGG - Intergenic
931294403 2:60907400-60907422 CACCCATCTTGGCCTCCCCAAGG - Intronic
931439197 2:62275846-62275868 TTCCCATCTGTGGCTCCCAAAGG - Intergenic
931773795 2:65522638-65522660 CACCCACCTCGGGCTCCCAAAGG - Intergenic
932576328 2:72964279-72964301 CACCCAACAGGGGCTCCCCAAGG + Intronic
932586760 2:73035185-73035207 CAGCGAGCGGTGGCTCACCATGG + Intronic
932732152 2:74228955-74228977 CCTGCAGCTGTGGCTCCCCATGG + Intronic
932856373 2:75237697-75237719 CACCCAGCTGAGGCTGCTCCAGG + Intergenic
933639274 2:84741753-84741775 CACCCAGCTGAGGCTGCACCAGG + Intronic
934650226 2:96086280-96086302 CACCAGACTGTGGCTCCTCAAGG - Intergenic
935333855 2:101997256-101997278 CACCCCGCTGTGCCTCTCCCTGG + Intronic
935841486 2:107116600-107116622 CACTCAGATGTGGATCTCCATGG - Intergenic
936061161 2:109296594-109296616 CATCCACCTGTGGCTTCTCAGGG + Intronic
936654772 2:114472325-114472347 CATCCAGAAGTGGCTCCTCAAGG - Intronic
937441644 2:121920496-121920518 CACTCTGCTGTGTGTCCCCAGGG + Intergenic
940616932 2:156060333-156060355 GAATCAGGTGTGGCTCCCCATGG + Intergenic
946050193 2:216855871-216855893 CACCCACATGTGGGTCCCCTGGG + Intergenic
946148528 2:217748830-217748852 GTTCCAGCTGTTGCTCCCCATGG + Intronic
946399449 2:219460887-219460909 CACCCCAGCGTGGCTCCCCAGGG - Intronic
946520746 2:220461777-220461799 CAGCCAGCTTTGCTTCCCCAAGG - Intergenic
946762002 2:223003888-223003910 CACCCACCTTGGGCTCCCAAAGG + Intergenic
946977052 2:225164653-225164675 CACTCAGGAGTGGCTCTCCAGGG + Intergenic
948205692 2:236161742-236161764 TGCCCAGCCGTGGCTTCCCAGGG - Intergenic
948287492 2:236797637-236797659 CACACAGCTGGGCCTCTCCAGGG - Intergenic
948656889 2:239481850-239481872 GAGCCAGCTGTGGATCCTCAGGG - Intergenic
948690115 2:239696746-239696768 AACCCCGCTCTGCCTCCCCAGGG + Intergenic
948691157 2:239706030-239706052 CACCCAGATGTGAATCCCCCAGG - Intergenic
1168772013 20:421425-421447 CACCCAGGGGCGGCTCCACAAGG - Intronic
1169489074 20:6056152-6056174 CACCCCGACATGGCTCCCCAAGG - Intergenic
1170216402 20:13896225-13896247 CACCCACCTCGGCCTCCCCAAGG - Intronic
1170567332 20:17614591-17614613 CGCCCAGCTCTGCCTCCCCTGGG + Intronic
1172001678 20:31783017-31783039 CACCCTTTTGTGACTCCCCAAGG + Intronic
1174043373 20:47715548-47715570 CACTCAGCTGTGTCTCCCACAGG - Intronic
1174130858 20:48342440-48342462 CACCCAGCAGTGACACCACAGGG - Intergenic
1175624768 20:60481256-60481278 CACCCAGTGGTATCTCCCCATGG - Intergenic
1176121840 20:63457607-63457629 CAGCCAGCTGTGGCTCCCTCGGG + Intronic
1177550822 21:22620009-22620031 CACACCGCTGTGGCTTTCCAAGG - Intergenic
1178153204 21:29820142-29820164 CACACATATGTGGGTCCCCATGG + Intronic
1178257929 21:31072356-31072378 CAGACAGCTGTGTCTCCTCAGGG + Intergenic
1178466377 21:32852251-32852273 CACTATGCTGGGGCTCCCCAGGG + Intergenic
1178812087 21:35893644-35893666 TACACAGCTGTGGCTCCTAAGGG + Intronic
1179178695 21:39027116-39027138 GGCCCTGCTGTGGCTCCCCTGGG - Intergenic
1179190930 21:39121224-39121246 CACCCTGCTGTAGCTGCCTAGGG - Intergenic
1179553244 21:42156602-42156624 CCCCCAGCTCTGGCTGCCCTCGG + Intergenic
1180183266 21:46127344-46127366 CACCCACCGGGAGCTCCCCATGG - Intronic
1181463669 22:23099429-23099451 CACCCAGCTGGGGCTTCCTCAGG + Intronic
1183307478 22:37090303-37090325 CAACCTTCTGTGGCTCCCTATGG - Intronic
1183405290 22:37627555-37627577 CACCCAGGGCTGGCTCCACAGGG - Intronic
1183425562 22:37737366-37737388 CACCCAGCTGTGCCAAGCCAAGG - Intronic
1183519278 22:38287158-38287180 CCCCCAGCAGCAGCTCCCCAAGG + Intergenic
1184362135 22:44024851-44024873 CACCCAGTAGTGGGTCCCCCAGG - Intronic
1184517282 22:44970486-44970508 GAGCCACCAGTGGCTCCCCAGGG + Intronic
1184743450 22:46442496-46442518 CCCCCAGCTGTGGCTCCTGAAGG + Intronic
1184879452 22:47295695-47295717 TACCCAGCGGGGCCTCCCCATGG - Intergenic
1185318305 22:50188550-50188572 CACGCAGCTCTTGCTCCCCCGGG - Intronic
1185350312 22:50332864-50332886 CACCCGCCTCTGCCTCCCCATGG + Intergenic
950459912 3:13115112-13115134 AACCCATCTGTGGCTCCCTGTGG - Intergenic
950995771 3:17494552-17494574 CTCCCACCAGGGGCTCCCCAGGG + Intronic
951372150 3:21862710-21862732 CAGCTAGCTGTGCCTCCCCAAGG + Intronic
952832713 3:37578518-37578540 CACCCATCTTTTTCTCCCCATGG + Intronic
953450586 3:43001921-43001943 CCCGCAGTTGTGGCTCCTCAAGG + Intronic
953849594 3:46455609-46455631 GACTCAGCTGTGCCTCCCAAGGG + Intronic
953979198 3:47405257-47405279 GCCCCAGCAGAGGCTCCCCACGG - Intronic
954242369 3:49303995-49304017 CACCCACCTTGGCCTCCCCATGG + Intronic
954342420 3:49965879-49965901 CACCCATCTCTGTCTCCCCAAGG - Intronic
954422788 3:50427345-50427367 GAGCCAGCTGGGGGTCCCCAGGG - Intronic
954449142 3:50562366-50562388 CACCTGCCTGTGGCTCCCCAGGG + Intronic
954917541 3:54161869-54161891 CACACAGTGGTGACTCCCCAAGG - Intronic
956414075 3:69008998-69009020 CACCCAGCTGCTGCTGGCCAAGG + Intronic
960884957 3:122384264-122384286 CAGACCGCTGAGGCTCCCCATGG - Exonic
960967620 3:123116153-123116175 CACCCTGCCCTGCCTCCCCATGG - Intronic
961441908 3:126958319-126958341 CACCTAGTTTGGGCTCCCCAAGG + Intronic
961658092 3:128454193-128454215 CTCCCAGCGGTTCCTCCCCAAGG - Intergenic
961756463 3:129130058-129130080 GACCCAGCTGGGGCTCTCCTTGG - Exonic
962289773 3:134124121-134124143 CGCCCAGCTGAGGCTGCTCAGGG + Intronic
963301050 3:143597597-143597619 CACCCGCCTGTGGCCCCCCGAGG + Intronic
963708577 3:148719597-148719619 CACTGAAGTGTGGCTCCCCATGG - Intronic
965791089 3:172388607-172388629 CATACAGCTGTGCCTCCCCCAGG - Intronic
966775127 3:183536979-183537001 TAACCAGCTTTGACTCCCCAAGG + Intronic
968236343 3:197032102-197032124 GACACAGCTCTGGCTCTCCAAGG + Intergenic
968292100 3:197546884-197546906 CACCCACCTGTGGTGCCCCAGGG + Intronic
968941445 4:3640798-3640820 CACCCACACGTGGCTCCCCCAGG + Intergenic
969620641 4:8277137-8277159 GGTCCAGCTGTGGCTCCCCGTGG - Intronic
969728208 4:8938360-8938382 CTCCCAGCTGTGCCTGGCCAGGG + Intergenic
969738109 4:9004544-9004566 CTCCCAGCTATGGCTACCCCAGG + Intergenic
970354075 4:15235160-15235182 AACCCATCAGTGGCTGCCCAGGG - Intergenic
972531637 4:39966751-39966773 CACCCAGCTTGGCCTCCCAAAGG - Intronic
972634412 4:40870547-40870569 CACCCAGCTGTCTCTCCTCTAGG - Intronic
976937092 4:90649860-90649882 CACCCACCTCTGCCTCCCAAAGG - Intronic
986174151 5:5337547-5337569 GACCTGGCTGTGGCTCCCCCTGG - Intergenic
986297362 5:6449937-6449959 CAGGCAGCTGTCCCTCCCCACGG - Intronic
986473387 5:8097878-8097900 CACCCAGATGTGGGTGCCAAAGG + Intergenic
989425518 5:41291170-41291192 CACCCAGCTGAGGCTCTGTATGG - Intergenic
990477330 5:56174069-56174091 CATCTCCCTGTGGCTCCCCAAGG - Intronic
991926156 5:71706943-71706965 TTCACAGCTGTGGCTCCTCAGGG + Intergenic
992723394 5:79582379-79582401 CAATCAGCTGTGGCTCCCTCTGG - Intergenic
994309463 5:98251273-98251295 CACCCACCTGGGCCTCCCAAAGG - Intergenic
996922564 5:128786244-128786266 CACCCACCTCAGGCTCCCAAAGG - Intronic
997713840 5:136028141-136028163 AATCCATCTGTGTCTCCCCAGGG + Intergenic
997771337 5:136556981-136557003 CACACAGCTGTGTTTCTCCAAGG - Intergenic
1001122827 5:168994138-168994160 CACCCAGCTGTCCCACTCCAGGG - Intronic
1001221208 5:169902592-169902614 CACCCCGCTGAGGCTCCCTGGGG + Intronic
1001959993 5:175874094-175874116 CACCCTGCAATGGCTCCCCATGG - Intronic
1002212491 5:177607219-177607241 CACCCACCCGGGGGTCCCCATGG - Intronic
1002777634 6:342358-342380 CACGCTGCTGTGGCCCCCCAAGG - Intronic
1002777815 6:343442-343464 CACGCTGCTGTGGCCCCCCAAGG + Intronic
1003159846 6:3625442-3625464 TTCCCAGCTGTGGCGCCCCCCGG - Intergenic
1003311135 6:4970901-4970923 CACCCAGCTGAGGCTCGGGAAGG + Intergenic
1003903857 6:10680645-10680667 CTCCCAGCTCTGCCTCCCCAAGG - Intronic
1006451017 6:34105707-34105729 CATCCAGCTGCTGCTCCCCTGGG + Intronic
1006787557 6:36678742-36678764 CGCCCAGCTCCGGCTCCACAAGG - Exonic
1007950106 6:45864516-45864538 CACCCACCTTGGGCTCCCAAAGG + Intergenic
1009871592 6:69459351-69459373 CAAGCAGCTGTTGCTCCCCTGGG + Intergenic
1010191237 6:73199201-73199223 TACCCAGCTCTGCCTCACCAGGG + Intergenic
1010714194 6:79209377-79209399 CAACCTACGGTGGCTCCCCAAGG + Intronic
1012267584 6:97164861-97164883 CACCCACCTCTGCCTCCCAAAGG + Intronic
1013075147 6:106764555-106764577 CACCCAGCTGTGTCTCTCTCTGG - Intergenic
1013323903 6:109025014-109025036 CTGGCAGCTGTGGATCCCCAGGG + Intronic
1014300400 6:119674956-119674978 CACCCAGATGAGGCTAGCCATGG - Intergenic
1015796399 6:137016238-137016260 CACCCAGCTGGGGCTCCATGGGG + Intronic
1015984444 6:138871559-138871581 CACCCACCTCTGCCTCCCAAAGG - Intronic
1018815509 6:167327570-167327592 CACACAGCTGTTGTTCCACACGG - Intronic
1019411473 7:908629-908651 CACCCAGCTGTGCCTGGGCAGGG - Intronic
1019519636 7:1454839-1454861 CCTCCAGCAGTGGCTCCCAAGGG - Intronic
1019709312 7:2511116-2511138 GACCCAGCTGGGGCTCAGCAGGG - Intergenic
1019910833 7:4099783-4099805 CCACCAGCTGCGGCTCCCCTTGG - Intronic
1019914402 7:4123498-4123520 CTTCCAGCTGTGGCTCCACCCGG - Intronic
1020092778 7:5350534-5350556 CATCCAGGTGTGGCTACCCAGGG + Intronic
1020244790 7:6421961-6421983 AACCCAGCGGTGGCTCCTGAGGG + Intronic
1020639817 7:10741756-10741778 CACCCTGCTTCGGCTCGCCATGG - Intergenic
1022443275 7:30451014-30451036 CACCCAGCTGTGGCTGATCCAGG + Intronic
1022511639 7:30938577-30938599 CACTTAGCTGTGGCTCTGCAGGG - Intergenic
1022892541 7:34715834-34715856 CACCCAGGTGCTGCTCCTCATGG - Intronic
1023086062 7:36571241-36571263 CACCCAGCTGGGGAGACCCAGGG - Intronic
1023844118 7:44111611-44111633 CACCCAGTTCATGCTCCCCAGGG - Exonic
1024258765 7:47558724-47558746 GTCCCAGCTCTGCCTCCCCAGGG + Intronic
1024939766 7:54750223-54750245 CACCCACCTCTGCCTCCCAAAGG + Intergenic
1025003853 7:55340509-55340531 CACCCACCTCTGCCTCCCGAAGG + Intergenic
1026470678 7:70692486-70692508 TACCCAGCTGTGGTCCTCCAGGG - Intronic
1026582071 7:71626884-71626906 CACCCAGCTTTGGCCACCCATGG - Intronic
1026906576 7:74066207-74066229 CAACCAGGTGTGGCACCTCATGG - Intronic
1026977366 7:74506819-74506841 CCCCCAGTTGTGGGTCCCCATGG - Intronic
1029284381 7:99455909-99455931 TCCCCAGCAGTGGCTCCCCAAGG + Intronic
1029582474 7:101446474-101446496 CACACAGCTGTCACTGCCCAAGG + Intronic
1031468776 7:122144875-122144897 AGCCCAGCTGTGATTCCCCAAGG + Intergenic
1032851777 7:135801585-135801607 CACCCAGCTTTGTCTCCCATTGG - Intergenic
1033080012 7:138287334-138287356 CACCCAACTCTGCCTCCCAAAGG + Intergenic
1034899220 7:154897198-154897220 CTCCCTGCTGGGGCTCCCCAGGG + Intergenic
1035685019 8:1517497-1517519 CACCGAGCTGTGCATCCTCAGGG + Intronic
1037682209 8:21106846-21106868 CAGCCCTCTGTGGCTGCCCATGG - Intergenic
1037817052 8:22117867-22117889 CACCCAGCTGGGACTCCCCTAGG - Intronic
1037915984 8:22773754-22773776 CCCCCGGCTGAGGCTCCCAAGGG - Intronic
1038398269 8:27262835-27262857 CACCAAGCAGTGGCTGCCCTGGG - Intergenic
1038483861 8:27919960-27919982 AAGCCCACTGTGGCTCCCCATGG - Intronic
1038552476 8:28481917-28481939 CAGCCTGCTGTTGCTCCCAAAGG - Intronic
1039391886 8:37187825-37187847 GGACCAGCTGTGTCTCCCCAAGG + Intergenic
1040342799 8:46449846-46449868 CACCCACCTGAGGCTCCCAAAGG + Intergenic
1040940652 8:52829538-52829560 CACCCACCTCGGGCTCCCAAAGG + Intergenic
1041403813 8:57473909-57473931 CACCCAGCTGTGGCTCAAACAGG - Intergenic
1042623642 8:70732871-70732893 CACCCAGCTCAGCCTCCCAAAGG - Intronic
1046496366 8:115019397-115019419 CACCCAGCTGAGGCTGCTCTAGG + Intergenic
1048591788 8:135827119-135827141 CACCCAGCTGGTGAGCCCCAGGG - Intergenic
1049178211 8:141206770-141206792 CACCTGGCTTTGGCGCCCCAGGG - Intergenic
1049572868 8:143377814-143377836 CACCCAGCACTGGCTCACGAGGG + Intronic
1050080113 9:1907099-1907121 CTTCCAGATGTGGCTCCTCATGG + Intergenic
1051278035 9:15415914-15415936 CACCCACCTTTGCCTGCCCAAGG + Intergenic
1051374221 9:16387847-16387869 CAGCCAGGTGAGGCTCACCAAGG + Intergenic
1056192037 9:84194412-84194434 CACCCATCCATGGCTACCCATGG - Intergenic
1057903530 9:98967322-98967344 AACAGAGCTGTGGCTCCCCAGGG - Intronic
1057952552 9:99381365-99381387 CACCAAGCTGTGAATTCCCAAGG - Intergenic
1059733124 9:117076029-117076051 CACTCAGCTCTGTATCCCCAGGG - Intronic
1060972348 9:127745342-127745364 CTCCAAGCAGTGGGTCCCCAAGG - Intronic
1061122370 9:128651582-128651604 CCTCCAGTTGTGGCTCTCCAAGG - Intronic
1061407612 9:130401140-130401162 GACCCATCAGTGGTTCCCCAAGG + Intronic
1061993818 9:134174045-134174067 CACCGAGCTCTGGTGCCCCAGGG - Intergenic
1062021051 9:134319596-134319618 CACCCTGCTGGGGCCTCCCATGG - Intronic
1062289625 9:135788723-135788745 CCCCCAGCTGGGGCTCCACGAGG + Intronic
1062496219 9:136833036-136833058 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496282 9:136833208-136833230 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496298 9:136833252-136833274 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496362 9:136833427-136833449 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496410 9:136833559-136833581 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062496425 9:136833602-136833624 GACCCAGCTGGGGCAGCCCAGGG - Intronic
1062634700 9:137484713-137484735 CCACCAGCTTGGGCTCCCCACGG - Exonic
1062651799 9:137581599-137581621 CAGACACCTGGGGCTCCCCAAGG + Intergenic
1185446078 X:258593-258615 CACCCAGCTGGGCCCCCACAGGG + Intergenic
1186842111 X:13494742-13494764 CAACCAGGCGTTGCTCCCCAGGG + Intergenic
1187685315 X:21810262-21810284 CTTCCTGCTGTGTCTCCCCATGG + Intergenic
1189007711 X:37011872-37011894 CACCCATCTGGGCCTCCCAAAGG - Intergenic
1189362571 X:40363976-40363998 CACCCACCTCTGCCTCCCAAAGG - Intergenic
1189510432 X:41656330-41656352 AACCCATCTGTGGCCTCCCAGGG - Intronic
1196815819 X:119664947-119664969 GCCCCAGATGTGCCTCCCCACGG + Intronic
1201863284 Y:18623033-18623055 CAGCCACCCATGGCTCCCCATGG + Intergenic
1201870038 Y:18697345-18697367 CAGCCACCCATGGCTCCCCATGG - Intergenic