ID: 1083821509

View in Genome Browser
Species Human (GRCh38)
Location 11:65173778-65173800
Sequence AGCTACTCGGGACGCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083821502_1083821509 7 Left 1083821502 11:65173748-65173770 CCAGGCATGGTGGCAGGTGCCTA 0: 198
1: 4039
2: 18500
3: 50920
4: 101177
Right 1083821509 11:65173778-65173800 AGCTACTCGGGACGCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083821509 Original CRISPR AGCTACTCGGGACGCCAAGG TGG Intergenic
No off target data available for this crispr