ID: 1083822986

View in Genome Browser
Species Human (GRCh38)
Location 11:65182979-65183001
Sequence TAGCCGAGTCCCACCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 101}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083822986_1083822997 26 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822997 11:65183028-65183050 ATGGGACTCCATGTCCCTGGTGG 0: 1
1: 0
2: 1
3: 11
4: 138
1083822986_1083822988 -10 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822988 11:65182992-65183014 GACTCGGCTAAGCCAGATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 48
1083822986_1083822991 2 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822991 11:65183004-65183026 CCAGATCCTGGATGAGGAGTAGG 0: 1
1: 0
2: 1
3: 20
4: 268
1083822986_1083822992 3 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822992 11:65183005-65183027 CAGATCCTGGATGAGGAGTAGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1083822986_1083822995 8 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822995 11:65183010-65183032 CCTGGATGAGGAGTAGGGATGGG 0: 1
1: 0
2: 3
3: 35
4: 333
1083822986_1083822989 -4 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822989 11:65182998-65183020 GCTAAGCCAGATCCTGGATGAGG 0: 1
1: 1
2: 1
3: 42
4: 368
1083822986_1083822996 23 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822996 11:65183025-65183047 GGGATGGGACTCCATGTCCCTGG 0: 1
1: 0
2: 1
3: 17
4: 178
1083822986_1083822998 27 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822998 11:65183029-65183051 TGGGACTCCATGTCCCTGGTGGG 0: 1
1: 0
2: 1
3: 12
4: 163
1083822986_1083822999 28 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822999 11:65183030-65183052 GGGACTCCATGTCCCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1083822986_1083822993 7 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822993 11:65183009-65183031 TCCTGGATGAGGAGTAGGGATGG 0: 1
1: 0
2: 6
3: 36
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083822986 Original CRISPR TAGCCGAGTCCCACCCAGGA TGG (reversed) Intronic
900090036 1:916235-916257 GTGCCGAGTCCCACCCAGAGGGG + Intergenic
900295394 1:1946686-1946708 TGGCCGTGTCCCAGCCAGGGAGG + Intronic
901237871 1:7677213-7677235 TACCCGAGCCCCACCCAGGAAGG + Intronic
901462200 1:9398472-9398494 CAGCCAGGTCCCACCCACGAGGG + Intergenic
902087025 1:13871107-13871129 CAGCCAACTCCCCCCCAGGAAGG - Intergenic
904585713 1:31579525-31579547 TAGCCCAGCCCAAGCCAGGAGGG - Intronic
905014817 1:34770499-34770521 TAGCAGAGTCCAACACAGGGTGG - Intronic
905733790 1:40312862-40312884 GAGCCTCGGCCCACCCAGGAGGG - Intronic
912535718 1:110368513-110368535 CAACTGAGTGCCACCCAGGATGG - Intronic
915354954 1:155250479-155250501 AAGCAGGGTCCCACCCAGGGCGG + Exonic
917440867 1:175067733-175067755 TAGCAGAGTCCCTGCTAGGAAGG + Intergenic
918237922 1:182598298-182598320 ATGCCGAGTCCCAGCCAGGTGGG + Intergenic
922671305 1:227510299-227510321 AAGCCGACTCTCACCCAGGGTGG - Intergenic
923114001 1:230917323-230917345 TGGCTGAGTCCCAGCCAGCAGGG + Intronic
923151858 1:231240935-231240957 AAGCAGAGGCCAACCCAGGACGG + Intronic
923247774 1:232149770-232149792 AACCCTAGTCCCACCCACGAGGG + Intergenic
923861089 1:237892771-237892793 AACCCCAGACCCACCCAGGATGG - Intergenic
1066049173 10:31619173-31619195 CAGCCCAGCCCCACCCATGAGGG - Intergenic
1066629675 10:37446802-37446824 CAGCTGGGTCCCACCCAGGTTGG - Intergenic
1067097671 10:43313161-43313183 CAGCTGAGTGCCATCCAGGATGG + Intergenic
1070727688 10:78803331-78803353 TAGCTGAGTCTACCCCAGGAGGG - Intergenic
1071672895 10:87626617-87626639 TAGCCAAGTGGCACCCAGGAAGG - Intergenic
1074190158 10:111128599-111128621 TAGCAGAGGCTCACCCAGGATGG + Intergenic
1074815065 10:117136944-117136966 CAGCCGAGGCCCCCCCAGGCCGG - Intronic
1077303776 11:1858825-1858847 TAGCCGTGTCCCACCCAGCACGG + Intronic
1079112206 11:17611198-17611220 GAGCCGTGTCTCAGCCAGGACGG + Exonic
1082110918 11:48272814-48272836 AAGCCCAGACCCACCCAGCAAGG + Intergenic
1082822845 11:57556251-57556273 GAGCCGAATCACACCCAGGCAGG - Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG + Intronic
1097680876 12:62647797-62647819 TGTCCAAGTCCCACCCAGGCTGG - Exonic
1097721839 12:63030059-63030081 AAGCCGAGGACCAGCCAGGAGGG - Intergenic
1105978538 13:25495169-25495191 AAGCCCAGCCCCACCCTGGAAGG - Intronic
1110501181 13:76230754-76230776 TAGCTGATGCCCACCCATGAAGG + Intergenic
1115640567 14:35333162-35333184 TCACAGAGTCCCTCCCAGGAAGG - Intergenic
1121987906 14:98526426-98526448 TAGCACAGTCCCTCCCATGAAGG + Intergenic
1122433760 14:101677655-101677677 CAGCCGAGTAGCAGCCAGGAAGG + Intergenic
1123701203 15:22916071-22916093 TGGCCGGGTGTCACCCAGGATGG + Intronic
1123816674 15:23986734-23986756 TAGCTGAGTGTCACCCAGCATGG - Intergenic
1126101039 15:45118351-45118373 TAGCTGAGTGGCATCCAGGACGG - Exonic
1129517707 15:76166627-76166649 TGGCTGAGTCCCACCCTGGCCGG + Intronic
1131150160 15:90042787-90042809 TAACAGAGGCCCAACCAGGAAGG + Intronic
1137359315 16:47798283-47798305 TAGCAGATGCACACCCAGGAAGG - Intergenic
1138502629 16:57457253-57457275 TAGGAGAACCCCACCCAGGATGG - Intronic
1140456844 16:75110758-75110780 AAGAAGAGTCCTACCCAGGAGGG + Exonic
1144494966 17:15740399-15740421 TGGCAGGGTCCCACACAGGATGG + Intronic
1144905290 17:18636276-18636298 TGGCAGGGTCCCACACAGGATGG - Exonic
1144947700 17:18978209-18978231 GAGCCCAGTGCCCCCCAGGACGG - Exonic
1148536375 17:48442475-48442497 TAGCAGAGTCCCAGGCAGGATGG - Intergenic
1151520895 17:74628815-74628837 TGGCCAAGAACCACCCAGGACGG + Intergenic
1152738638 17:82009384-82009406 CAGCCCACTCCCACCCTGGAGGG + Intronic
1153359703 18:4180284-4180306 CAGCAGAGTCCCACAAAGGAGGG + Intronic
1158218161 18:55122019-55122041 TACCTGTGCCCCACCCAGGAAGG - Intergenic
1160678249 19:401698-401720 GTGTCCAGTCCCACCCAGGAAGG + Intergenic
1161055873 19:2190418-2190440 CAGCCCAGTCCCACTCAGGAGGG - Intronic
1161249936 19:3275242-3275264 CAGCCCAGCCCCACCCAGCAGGG + Intronic
1162706013 19:12555457-12555479 TTGCCGAGTCCCAAGCAGGCAGG + Intronic
1162721102 19:12663524-12663546 CGGCCATGTCCCACCCAGGATGG + Intronic
1165119866 19:33552103-33552125 TAGAAGAGCCCCACTCAGGATGG - Intergenic
1166504924 19:43365138-43365160 AAGCCCAGTCCCCTCCAGGATGG + Intergenic
1166505616 19:43369776-43369798 AAGCCCAGTCCCCTCCAGGATGG - Intergenic
1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG + Exonic
924969245 2:109138-109160 CTGCTGGGTCCCACCCAGGACGG + Intergenic
926948171 2:18211811-18211833 TAACCCAGTGCCACCCAGGGTGG - Intronic
936428358 2:112437367-112437389 TGGGCGAGTCCCAGCCAGCATGG + Intergenic
939716780 2:145594042-145594064 CACACAAGTCCCACCCAGGAGGG + Intergenic
947977048 2:234375821-234375843 AGGCCGAGTCCCCCCCAGCACGG - Intergenic
947995778 2:234525959-234525981 TAGCCCAGTTGCACCCAAGATGG + Intergenic
1171531437 20:25856058-25856080 GAGCCGACTCCCACCAAGGGAGG + Intronic
1171573575 20:26276846-26276868 GAGCCGACTCCCACCAAGGGAGG - Intergenic
1171986583 20:31665292-31665314 GAGGCCAGCCCCACCCAGGAGGG - Exonic
1172359298 20:34301224-34301246 CAGCCGGGCCCCTCCCAGGAGGG - Intronic
1173491239 20:43484190-43484212 TAGCCATGTGGCACCCAGGATGG + Intergenic
1176086486 20:63297621-63297643 GAGTCCAGTCCCACCCAGGGAGG - Intronic
1176373891 21:6077844-6077866 TGGGCGAGTCCCAGCCAGCATGG - Intergenic
1179749586 21:43460399-43460421 TGGGCGAGTCCCAGCCAGCATGG + Intergenic
1180618087 22:17141525-17141547 TGGCAGAGTCCCAGCCAGCAAGG - Intronic
1181040861 22:20192030-20192052 TCCCTGACTCCCACCCAGGATGG - Intergenic
1181808604 22:25390350-25390372 AAGCCAAGTCCTCCCCAGGACGG - Intronic
1182350308 22:29695612-29695634 TACCCCAGCCCCACACAGGAAGG - Exonic
1185045684 22:48527667-48527689 AAGCCGCATCCCACCCAGGCTGG + Intronic
951757194 3:26103864-26103886 TAGCAGAATCCCAGACAGGATGG - Intergenic
954272398 3:49520063-49520085 TAGCAGAGTCACACCCACAAGGG - Intronic
956965608 3:74455850-74455872 TGGCCCTGCCCCACCCAGGAGGG + Intronic
961380276 3:126492329-126492351 CAGCCGAGGCACACGCAGGAAGG + Intronic
961603543 3:128077592-128077614 TAGCTGAGCCTCACCCAGGATGG + Intronic
961750513 3:129091391-129091413 AAGCCCAGTCCCACCTGGGAGGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
965746840 3:171935176-171935198 TAGCAGAGACCCACCCTGAAGGG + Intronic
979620348 4:122791475-122791497 TAGCCATGTGTCACCCAGGATGG - Intergenic
990248739 5:53891378-53891400 GAGCAGAGTCCCACGCAGTAAGG - Intronic
991183666 5:63783890-63783912 TATCCAAGTCACACCCAGAAAGG + Intergenic
995146996 5:108797459-108797481 CAGCCAATGCCCACCCAGGAAGG - Intronic
999187414 5:149722428-149722450 TACTCAAGTCCCTCCCAGGATGG + Intergenic
1001708078 5:173756548-173756570 AAGCCCAGTCCCTCCCAGCAGGG + Intergenic
1006589182 6:35141572-35141594 AAGCCGAGCCACACCCAGGAGGG + Exonic
1007115251 6:39338884-39338906 GAGCCATCTCCCACCCAGGATGG + Intronic
1016255993 6:142106097-142106119 TAGCCATGTGGCACCCAGGAAGG + Intergenic
1019114845 6:169751716-169751738 TAGCCGAGCACCACCCAGCCTGG - Intronic
1025284136 7:57649001-57649023 GAGCCGACTCCCACCAAGGGAGG + Intergenic
1035494522 7:159311515-159311537 TAGCCATGTGGCACCCAGGAGGG - Intergenic
1036993442 8:13627088-13627110 CCCCTGAGTCCCACCCAGGAAGG + Intergenic
1049599430 8:143500143-143500165 GTGCTGAGGCCCACCCAGGATGG - Intronic
1053049252 9:34945187-34945209 TATCCAAGTACCACCCAAGAGGG + Intergenic
1053067533 9:35079127-35079149 TAGGCGGGTCCTCCCCAGGATGG - Intronic
1054417422 9:64890154-64890176 CAGCTCAGTCCCATCCAGGATGG - Intergenic
1057885740 9:98828219-98828241 CAGCTGGGTCACACCCAGGAAGG - Intronic
1058877722 9:109258949-109258971 TTGCCAAGTCCCCCACAGGATGG + Intronic
1189896439 X:45661351-45661373 TTGCCGAAGCTCACCCAGGAAGG - Intergenic
1190037492 X:47039340-47039362 TAGCCGATTTCCACCCAGGATGG - Intronic
1192549865 X:72045296-72045318 TAGCAGAGTCCCAGCAATGAGGG + Intergenic
1197701745 X:129605011-129605033 TTGCTGAGTCCCACCAAGAATGG + Intergenic