ID: 1083822988

View in Genome Browser
Species Human (GRCh38)
Location 11:65182992-65183014
Sequence GACTCGGCTAAGCCAGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083822980_1083822988 5 Left 1083822980 11:65182964-65182986 CCACGGTGAGAGGGGCCATCCTG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1083822988 11:65182992-65183014 GACTCGGCTAAGCCAGATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 48
1083822986_1083822988 -10 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822988 11:65182992-65183014 GACTCGGCTAAGCCAGATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 48
1083822974_1083822988 29 Left 1083822974 11:65182940-65182962 CCTATGGCATCAAGTGGAAGCGT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1083822988 11:65182992-65183014 GACTCGGCTAAGCCAGATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 48
1083822979_1083822988 6 Left 1083822979 11:65182963-65182985 CCCACGGTGAGAGGGGCCATCCT 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1083822988 11:65182992-65183014 GACTCGGCTAAGCCAGATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083822988 Original CRISPR GACTCGGCTAAGCCAGATCC TGG Intronic
900246918 1:1640624-1640646 GGCTCGGCTGAGACAGAGCCCGG + Intronic
900258140 1:1707756-1707778 GGCTCGGCTGAGACAGAGCCCGG + Intronic
901808224 1:11750937-11750959 GCCTCTGCTAGGCCAGAGCCAGG - Intronic
901954539 1:12774894-12774916 GACTCTGCTCAGCCAGCTCCAGG - Exonic
903293147 1:22327159-22327181 GAGCCGGCCAAGCCAGCTCCAGG - Intergenic
904955395 1:34279449-34279471 GACTCGTCTGAGACAGATCTGGG - Intergenic
907510349 1:54953301-54953323 GACTCTGCTAAGCCAGAGAATGG + Intergenic
911051572 1:93675975-93675997 GACTAGTATAAGACAGATCCTGG - Intronic
922777168 1:228220346-228220368 GCCTCGGCTCAGCCCGATCCTGG + Intronic
1076778231 10:132709830-132709852 GACTCGGCAAGGCCTGATCAAGG - Intronic
1077224441 11:1433936-1433958 GCCTGGGCTCACCCAGATCCAGG + Intronic
1077909627 11:6562963-6562985 GACTCTGCAGAGACAGATCCAGG - Exonic
1083822988 11:65182992-65183014 GACTCGGCTAAGCCAGATCCTGG + Intronic
1088078821 11:105884558-105884580 ATCTCTGCTGAGCCAGATCCTGG - Intronic
1100106854 12:91185786-91185808 GACTCTGCAAAGTCAGATCTGGG + Intergenic
1104938564 12:132380982-132381004 TACTCAGCTAAGACAGAACCTGG + Intergenic
1107263278 13:38520395-38520417 GACTCGGCTGGGGCAGAGCCTGG - Intergenic
1119765895 14:77187480-77187502 GACTCGGCAAGGCCAGGCCCAGG + Intronic
1123707396 15:22959993-22960015 TACTGGGCTATGCCAGACCCTGG - Intronic
1130444905 15:83991626-83991648 CACTTGGCAAAGCCAGATCGGGG + Intronic
1146260058 17:31415175-31415197 GACTGGACCAAGCCAGTTCCGGG - Intronic
1156530451 18:37810060-37810082 GACTTGGATCAGACAGATCCTGG + Intergenic
1159489614 18:69114590-69114612 GAACAGGCTAAGCCAAATCCTGG + Intergenic
1166560196 19:43727704-43727726 GAGTGGGCTCAGCCAGATCCTGG + Intergenic
1168076147 19:53981910-53981932 GACTTGGGTCAGCCAGATCCAGG + Intronic
928917478 2:36488452-36488474 GACTCAGCAAAGCCAGATCTTGG + Intronic
930279719 2:49355638-49355660 AACTAGCCTAAGCCAGAACCTGG - Intergenic
932800833 2:74741154-74741176 GGCTCGGCTATGCCAGCTCAAGG - Intergenic
933374271 2:81459413-81459435 GACCCAGCTAAGCCAGGCCCAGG + Intergenic
933691072 2:85180040-85180062 GACCCGGCTAAGCCACGTCCTGG - Intronic
945739996 2:213647738-213647760 GATTAGGCTGAGACAGATCCTGG - Intronic
945967822 2:216207728-216207750 CACTGGGCTAACCCAGATACTGG + Intergenic
947025917 2:225737865-225737887 GGCTGAGCTGAGCCAGATCCTGG - Intergenic
948260258 2:236599135-236599157 GTCTGGGCTTAGCAAGATCCTGG - Intergenic
1169712712 20:8582454-8582476 GACTGGTCTCAGCCTGATCCTGG - Intronic
1173894408 20:46539473-46539495 GACTCAGCTAAACCATATCTGGG - Intergenic
1178993205 21:37372575-37372597 GACTCAGATCAGCCAGATTCTGG - Intronic
951814351 3:26736882-26736904 GCCTCGGCTGACCCAGATCCTGG + Intergenic
964323946 3:155526739-155526761 GACCCAGCTAAGCCACACCCAGG + Intronic
967644752 3:191908969-191908991 GACTCGTATGTGCCAGATCCCGG + Intergenic
972766027 4:42152570-42152592 GTCTCGCCGTAGCCAGATCCCGG - Exonic
991949542 5:71934000-71934022 GACTCAGCTCAGTCACATCCAGG - Intergenic
992754263 5:79889356-79889378 GACTTGTCTGATCCAGATCCTGG + Intergenic
993092939 5:83449708-83449730 GATCAGCCTAAGCCAGATCCCGG + Intergenic
995434062 5:112115697-112115719 AACCCAGCTAAGCCACATCCAGG + Intergenic
1025032709 7:55571198-55571220 GTCTCGGCTATGGCAGAGCCTGG + Intronic
1027265874 7:76495058-76495080 GACTGGGCTATGCCACAGCCAGG - Intronic
1027317248 7:76993175-76993197 GACTGGGCTATGCCACAGCCAGG - Intergenic
1028900021 7:96087419-96087441 GTCTCAGCTTAGCAAGATCCAGG + Intronic
1045430890 8:102114256-102114278 GACTCTGCTGGGCCAGCTCCTGG - Intronic
1047167148 8:122451949-122451971 GACACAGCTAAGCCATATCAAGG + Intergenic
1048872866 8:138813215-138813237 GACACAGCCAAGCCAGATCAGGG - Intronic
1060243415 9:121924538-121924560 GACTTGGCCAAGCAAGATCGGGG + Intronic
1061986452 9:134132891-134132913 GACTCAACTCAGCCAGACCCAGG + Intergenic
1193184183 X:78492729-78492751 TACTCGCCTAAGCCTGATTCAGG - Intergenic
1200913653 Y:8552632-8552654 GACATTGTTAAGCCAGATCCAGG - Intergenic