ID: 1083822991

View in Genome Browser
Species Human (GRCh38)
Location 11:65183004-65183026
Sequence CCAGATCCTGGATGAGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083822987_1083822991 -2 Left 1083822987 11:65182983-65183005 CCTGGGTGGGACTCGGCTAAGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1083822991 11:65183004-65183026 CCAGATCCTGGATGAGGAGTAGG 0: 1
1: 0
2: 1
3: 20
4: 268
1083822979_1083822991 18 Left 1083822979 11:65182963-65182985 CCCACGGTGAGAGGGGCCATCCT 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1083822991 11:65183004-65183026 CCAGATCCTGGATGAGGAGTAGG 0: 1
1: 0
2: 1
3: 20
4: 268
1083822986_1083822991 2 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822991 11:65183004-65183026 CCAGATCCTGGATGAGGAGTAGG 0: 1
1: 0
2: 1
3: 20
4: 268
1083822980_1083822991 17 Left 1083822980 11:65182964-65182986 CCACGGTGAGAGGGGCCATCCTG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1083822991 11:65183004-65183026 CCAGATCCTGGATGAGGAGTAGG 0: 1
1: 0
2: 1
3: 20
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083822991 Original CRISPR CCAGATCCTGGATGAGGAGT AGG Intronic
900313757 1:2047262-2047284 CCAGATCCCGGCTGAGGGCTGGG - Intergenic
901060386 1:6469166-6469188 GCAGAGCCTGGAAGAGGAGGAGG - Exonic
901323568 1:8353735-8353757 CCACTTCCAGGATGAAGAGTGGG + Exonic
902193898 1:14783717-14783739 CGGGGTCCTGGCTGAGGAGTAGG + Intronic
902469966 1:16642478-16642500 GCAGATGCTGGGTGTGGAGTAGG + Intergenic
902516544 1:16992563-16992585 CCAGGTCCTGGAGGAAGAGCCGG - Exonic
902618648 1:17637907-17637929 GCAGCTCCTGGAAGAGGCGTGGG - Exonic
902778348 1:18689152-18689174 CCAGCCCGTGGATGGGGAGTGGG - Intronic
903754071 1:25648440-25648462 CAAGAACCTGGAGGAGGAGGAGG + Intronic
904049705 1:27631872-27631894 CCAGAGCCTGGAGGAGAAGCCGG - Intronic
904585884 1:31580396-31580418 CCAGAGCCTTCATGAGGAGAGGG - Intronic
905629596 1:39511238-39511260 CCAGATCCCGGCTGGGGAGGCGG + Exonic
905668163 1:39774952-39774974 CCAGATCCCGGCTGGGGAGGCGG - Exonic
907415858 1:54313382-54313404 CTAGTTCCTGGCTGAGGAGCAGG - Intronic
907458772 1:54592950-54592972 CCTGATCTTGGAGGAGGAGCTGG + Intronic
907592567 1:55689835-55689857 GCAGAGCATGGATGAGGAGGTGG + Intergenic
908658803 1:66416548-66416570 CCAGAGGCTGGGTGAGGAGGTGG - Intergenic
909935021 1:81541353-81541375 CAAGCTCTTGGATGTGGAGTAGG + Intronic
911580950 1:99632656-99632678 CCAGTTACTGTATAAGGAGTCGG - Intergenic
912486793 1:110035126-110035148 CCAGCTCGGGGGTGAGGAGTCGG + Intronic
915466410 1:156100945-156100967 GCTGAGCCTGGATGATGAGTAGG + Intronic
915603312 1:156935949-156935971 CCAGTCCCTGAAGGAGGAGTGGG + Exonic
915950727 1:160188385-160188407 CCAGACCCTGGAAGATCAGTGGG + Intergenic
917141380 1:171839321-171839343 CCAGATTCTGGATTGGGATTGGG + Intergenic
917213627 1:172656144-172656166 CCATATCCTGGATGGGGAGGTGG - Intergenic
917257830 1:173134823-173134845 CCAGGTCCTGGATGTGGCTTCGG + Intergenic
919806966 1:201386066-201386088 CCAGGCCCTGGATGAGGATATGG + Intronic
920184455 1:204151630-204151652 GCAGCTCCTGGATGAGGCGCAGG + Exonic
920402310 1:205683614-205683636 CCAAATCCTGGCTGTGGACTTGG + Intergenic
920658056 1:207891041-207891063 CGAGAGTCTGGATGAGGAGGAGG + Intronic
921071300 1:211660386-211660408 CCAGATCCTGAAGGAGAATTAGG - Intronic
922927118 1:229358670-229358692 CCTGATCCTGAATGAGCACTGGG - Intergenic
923744380 1:236686730-236686752 CATGATCCAGGAGGAGGAGTGGG + Exonic
1063671081 10:8100702-8100724 CTAGGTCCTGCAAGAGGAGTGGG - Intergenic
1063969394 10:11371042-11371064 CAAGATGGCGGATGAGGAGTGGG - Intergenic
1064321566 10:14310090-14310112 CCACATCCTCGATGAGAGGTAGG - Intronic
1069796152 10:71053197-71053219 CCTCAACCTGGATGAGGACTGGG + Intergenic
1069859339 10:71460769-71460791 CCTGCTCCTGAATGTGGAGTTGG + Intronic
1070150609 10:73802625-73802647 TCAGATCCTGGAAGTGGAGAGGG + Exonic
1070174193 10:73956501-73956523 CCAGCTCCTGGTGGAGGAGATGG - Intergenic
1071783509 10:88873839-88873861 CCAGATACTGAATGAGGTTTGGG - Intergenic
1072319716 10:94237135-94237157 CCAGATCCAGTATGAGGAGAAGG - Intronic
1073237761 10:102033064-102033086 CCAGAGCCTGGATGCAGTGTTGG + Exonic
1076542083 10:131220784-131220806 CCAGAGCCAGGATGAGGAAAGGG + Intronic
1077049068 11:558630-558652 CCACATCCTGGAAGAGGTGGCGG - Exonic
1077916182 11:6612801-6612823 CCAGGTCCTAGCTCAGGAGTTGG - Exonic
1077963147 11:7096860-7096882 CCAGTTCCTGGCCCAGGAGTTGG - Intergenic
1080226388 11:29965901-29965923 GCAGGTCCTGGAGGTGGAGTTGG - Intergenic
1081774066 11:45665742-45665764 CCGGAGCCTGGCTGCGGAGTGGG - Intergenic
1082182428 11:49135796-49135818 CTAGATCTTGCCTGAGGAGTGGG + Intergenic
1083822991 11:65183004-65183026 CCAGATCCTGGATGAGGAGTAGG + Intronic
1084860293 11:72013764-72013786 CCAGGTCCTGGAGAAGGAGGGGG - Exonic
1085032944 11:73283663-73283685 CCAGCTCCGGGAAGAGCAGTGGG - Intronic
1085472549 11:76767561-76767583 CCAGATCCGGGACGAGGAGCAGG + Intergenic
1086893499 11:92285909-92285931 CCACGTCCTGGAGGAGAAGTAGG - Intergenic
1087467384 11:98525889-98525911 CCAGATGCTAGATGAGGACCTGG - Intergenic
1089422289 11:118340886-118340908 CCAGACCACTGATGAGGAGTAGG + Intronic
1089918816 11:122187283-122187305 CCAGACCCTGGATTAGGGGATGG + Intergenic
1091304599 11:134529608-134529630 ACAGATCCTGGAGGTGGACTTGG + Intergenic
1091309831 11:134564505-134564527 CCATATTGTGGAGGAGGAGTTGG + Intergenic
1091825454 12:3509185-3509207 CCTGAGCCCGGGTGAGGAGTGGG - Intronic
1092881430 12:12890710-12890732 CTTGATCCTGGAAGAGGAGTGGG + Intergenic
1093090560 12:14915566-14915588 CCAGACTCTAGATGACGAGTGGG - Exonic
1093172200 12:15873980-15874002 CCAGGTCCTGCAGGAGCAGTTGG - Intronic
1095279730 12:40336050-40336072 CCAGAGGCTGGGTGAGGAATGGG - Intronic
1095616072 12:44190689-44190711 CCAGAAACTGGATGAGGGCTGGG - Intronic
1101942895 12:109113320-109113342 CCACATGCTGGATGTGGAGCTGG + Intergenic
1103760493 12:123246384-123246406 CCTGCTCCTGAATGAGCAGTGGG - Intronic
1105439874 13:20405993-20406015 CGGGATCCTGGAAGAGGAGGAGG + Intronic
1107755741 13:43620502-43620524 CCAGCTCCTGAATGAGCATTGGG - Intronic
1107808441 13:44176385-44176407 CAAAATCCTGGGTGATGAGTAGG - Intergenic
1108189927 13:47927796-47927818 CCAGATCTTGAAGCAGGAGTAGG - Intergenic
1109576846 13:64270658-64270680 CCAGAACATGGGAGAGGAGTGGG + Intergenic
1109736125 13:66486326-66486348 CCAGCTCCTGGGTTGGGAGTGGG + Intronic
1109796531 13:67321012-67321034 CCAGGTGCTGGAGGAGGAGGGGG - Intergenic
1111812775 13:93112446-93112468 TCAGATCCTGGAAAAGTAGTTGG + Intergenic
1112292123 13:98153895-98153917 CCATATCCTGACTGTGGAGTTGG - Intronic
1113561657 13:111286476-111286498 CCAGCTCCTGGATGAGGAAGGGG - Intronic
1114549495 14:23524835-23524857 CCAGACCCTTGAAGAGGAGGAGG - Exonic
1114691936 14:24591536-24591558 CCTGATCCTGAATGAGCACTGGG - Intergenic
1119566000 14:75629960-75629982 TAAAATCCTGGCTGAGGAGTGGG + Intronic
1121123881 14:91393468-91393490 CCAGATCGGGGCTGAGGTGTGGG - Intronic
1121585230 14:95058719-95058741 CCAGATCCTTGCTGAGGCCTCGG - Intergenic
1121701953 14:95961411-95961433 CCAGAAGCTGGAAGAGGAATGGG + Intergenic
1121857874 14:97286916-97286938 CCAGTACCTGGATGATGAGAAGG - Intergenic
1122552190 14:102556165-102556187 CCAGATGCTGGAGGCGGAGGCGG - Intergenic
1124650196 15:31468773-31468795 CCAGATGCAGGATGAGAACTCGG - Intergenic
1130040007 15:80398562-80398584 CTAGATCGTGGATGAGGAAATGG + Intronic
1131997452 15:98145948-98145970 CAAGTTCCTGGATTAGGAGGTGG - Intergenic
1132993864 16:2812511-2812533 GCTGATCCTGGTTGAGGACTGGG + Intergenic
1134040753 16:11066432-11066454 GCTGATCCTGGAGGAGGAGCTGG + Intronic
1135824033 16:25710501-25710523 CCATATCCTGGCTGTGGAGCAGG + Intronic
1136141710 16:28292754-28292776 CCGGATCCTGGATGTGGAAGGGG - Exonic
1136157350 16:28392039-28392061 CAAGCGCCTGGATGAGGAGGAGG - Exonic
1136205737 16:28723245-28723267 CAAGCGCCTGGATGAGGAGGAGG + Exonic
1136989253 16:35142159-35142181 CTAGATCTAGGATGAGCAGTAGG + Intergenic
1137051658 16:35719068-35719090 CCTGCTCCTGGATGACTAGTGGG - Intergenic
1137529862 16:49272336-49272358 GCAGATCATGGAGGTGGAGTGGG - Intergenic
1138230958 16:55335883-55335905 CCATCTCCTTGGTGAGGAGTGGG - Intergenic
1139972261 16:70783536-70783558 TCAGATCCTGGTTCTGGAGTCGG - Exonic
1140201714 16:72900238-72900260 CAATATCCTGGGTGAGGAGCAGG + Intronic
1140630381 16:76845415-76845437 TGAGATCCTGGATGAGGAAAGGG + Intergenic
1141332766 16:83127223-83127245 CCTGCCCTTGGATGAGGAGTTGG + Intronic
1141620075 16:85232597-85232619 CCAGCTCCTGTGTGAGGACTGGG + Intergenic
1143592444 17:7893789-7893811 CCTGGACCTGAATGAGGAGTCGG - Exonic
1146417637 17:32651487-32651509 CCAGTCCCAGGATGAGCAGTGGG - Intronic
1147795090 17:43036562-43036584 TCTGGTCCTGGAGGAGGAGTTGG + Intergenic
1147977177 17:44254609-44254631 CCAGCCCCGGGCTGAGGAGTTGG + Exonic
1149010474 17:51851316-51851338 CCTGCTCCTGGATGAGGACATGG + Intronic
1149991326 17:61385134-61385156 CCAGAGCGTGGCTGAGGAGGCGG - Intronic
1150724468 17:67640342-67640364 CCAGACCCTGGAAGGGGAGAGGG - Intronic
1151745371 17:76009007-76009029 CGGGAGCCTGGATGAGGAGGTGG - Exonic
1153069247 18:1086803-1086825 CCTGCTCCTGGATGAGCATTGGG - Intergenic
1154947139 18:21173128-21173150 GCAGATACGGGGTGAGGAGTGGG - Intergenic
1157159848 18:45303890-45303912 CTAGATGCTGGAGGAGCAGTGGG - Intronic
1160554158 18:79715179-79715201 CCAGAGCATGGAGGAGGAGGAGG + Exonic
1161104844 19:2438189-2438211 CCAGAGCCTGCAGGAGGAGCTGG - Exonic
1161208453 19:3054234-3054256 CCTGATCCTGGGAGAGGAGAGGG + Intronic
1161884048 19:6979677-6979699 CCAGATACAGGAAGAGGAGGGGG + Intergenic
1162141290 19:8586837-8586859 TCAGATCCTGGATGAAGATGTGG + Exonic
1163244101 19:16081948-16081970 CCAGCTCGTTGAGGAGGAGTTGG + Exonic
1165005094 19:32798387-32798409 CCTGATCCTGGATGAGGTAGAGG + Intronic
1165318343 19:35070815-35070837 CCAGACCCTAGAGGAGGAGATGG + Intergenic
1165349138 19:35267179-35267201 CCCGATCCGGGATGAGGAGTGGG + Exonic
1165385663 19:35509403-35509425 CAAGCTCCTGGGTGAGGCGTTGG - Intronic
1165951428 19:39475772-39475794 CCAGGTCCAGGAAGAGGAGCAGG + Intronic
1166270037 19:41708111-41708133 CCAGATCCTGCATGTGGAGGGGG - Intronic
1166539902 19:43598331-43598353 CCAGATCCTGGATGTCGGGCTGG + Intronic
1167412874 19:49355413-49355435 CCTGGTCCTGGAGGAGGAGGCGG + Exonic
925054591 2:847231-847253 CCAGAGCCTCGATGTGCAGTAGG - Intergenic
925300646 2:2809416-2809438 ACAGATCCTCTATTAGGAGTTGG + Intergenic
926288744 2:11511656-11511678 CGAGTTCCTGGATGAGGATGAGG - Intergenic
928219801 2:29394448-29394470 GCAGATGCTGGAGGAGGAGGTGG - Intronic
928870002 2:35964721-35964743 CCAGAGCCTGAAAGAGGAGGAGG - Intergenic
930154511 2:48092468-48092490 CCAGAGCCTGGATGAGGATGTGG - Intergenic
931764084 2:65439167-65439189 GCAGATCCTGGAGGTGGAGATGG + Intergenic
932100312 2:68893524-68893546 CCTGATCCTGAATGAGCATTGGG - Intergenic
932447265 2:71788522-71788544 CCAGATCCTGGAGGAGGGGAGGG - Intergenic
933760125 2:85667073-85667095 CCAGATCCTGGATGAAGGTTGGG - Intronic
936025854 2:109030710-109030732 ACAGAACCTGGATAAGAAGTGGG - Intergenic
937268046 2:120629699-120629721 CCAGGTCCTGCATCAGGAGAGGG - Intergenic
937336714 2:121066696-121066718 CCACATCCTGGATTAGCAGGAGG + Intergenic
938120638 2:128630958-128630980 GCAGATACTGGATGATGAGAAGG - Intergenic
940157040 2:150668213-150668235 CCTGCTCCTGGATGAGCACTGGG + Intergenic
941442492 2:165555561-165555583 CCAGATACTGGACTAGGAGCTGG + Intronic
941929566 2:170926531-170926553 CCAGTTCCTGGTTGAGTATTGGG - Intergenic
942796895 2:179831751-179831773 CCAAGCCCTGGATCAGGAGTGGG + Intronic
946191694 2:218010954-218010976 AGAGATCCTGGCTGAGGAGTCGG - Intergenic
947263860 2:228254303-228254325 CCAGACCCAGGATCAAGAGTAGG - Intergenic
947581045 2:231318797-231318819 CCTGTTCCTGGAACAGGAGTAGG - Intronic
947765330 2:232633968-232633990 CCAGGTCCTTGATGAGGCGGCGG - Exonic
948176901 2:235950517-235950539 CCTGATTCTGGATGAGAGGTGGG + Intronic
948526548 2:238574289-238574311 CCAGCTGCTGGCTGAGCAGTTGG + Intergenic
948540589 2:238689100-238689122 CCAGCTCCTCGTTGAGCAGTGGG - Intergenic
1168881444 20:1209545-1209567 CCAGATGCTGGACAAGGAGTTGG + Intergenic
1169911189 20:10648716-10648738 CCAAATCCTAGAAGAGGAGAAGG + Exonic
1170803202 20:19607383-19607405 CAAGACCAAGGATGAGGAGTGGG - Intronic
1172511363 20:35503403-35503425 CAAGATCCTGGAGGAGGACCTGG + Exonic
1172693339 20:36805212-36805234 GCAGATCCTGAGTGAGGAGAAGG - Intronic
1173205656 20:40991201-40991223 TGGGATCCTGGTTGAGGAGTTGG - Intergenic
1173847412 20:46196931-46196953 TAATATCCTGGGTGAGGAGTGGG + Intronic
1174087711 20:48020735-48020757 GGAGCTCCTGAATGAGGAGTGGG + Intergenic
1174128338 20:48325102-48325124 GGAGCTCCTGAATGAGGAGTGGG - Intergenic
1175855543 20:62118920-62118942 CCAGATCCTGAATGAGGGGACGG + Intergenic
1177195729 21:17901550-17901572 CCAGGTCCTGCAGGAGCAGTCGG + Intronic
1180228994 21:46414935-46414957 TCAGAGCCTGGAGGAGTAGTTGG - Intronic
1181640142 22:24191936-24191958 CCTGGTCCTGGAAGAGTAGTGGG - Intergenic
1181643868 22:24219874-24219896 CCAGATCCTGCCAGAGTAGTTGG + Exonic
1181823470 22:25494158-25494180 GTAGAAGCTGGATGAGGAGTAGG - Intergenic
1182733367 22:32513055-32513077 CCAGACCCTGTATGACAAGTGGG - Exonic
1183092208 22:35530185-35530207 CAGGATCCTGGGGGAGGAGTGGG + Intergenic
1183395096 22:37566933-37566955 CCACATCATGGATGGGGAGGGGG + Intronic
1184163897 22:42716181-42716203 CCTGAGCCTGGAGTAGGAGTGGG - Intronic
1184273666 22:43398664-43398686 CCAGATCCTGTAGGAGAACTTGG - Intergenic
1184551781 22:45208518-45208540 ACAGCTCCTGCATGTGGAGTCGG - Intronic
1184894178 22:47397513-47397535 CCAGATCCTAGCTGTGAAGTAGG + Intergenic
1185027708 22:48425116-48425138 CCCGATCCTGGAGGAGCAGCCGG - Intergenic
949380517 3:3440120-3440142 ACAGATCCAGGAAGAGGACTTGG - Intergenic
951555571 3:23917385-23917407 CCGGATCCTGGAGGAGGCGTGGG + Intronic
953588522 3:44228503-44228525 CCTGATCCTAGATGAAGACTTGG + Intergenic
953996144 3:47521521-47521543 CCAGCACCTGGAAGAGAAGTGGG - Intergenic
954542490 3:51403296-51403318 CCAGTTGCTGGAGGCGGAGTTGG - Exonic
956015043 3:64873588-64873610 CCTGACCCAGGATGGGGAGTGGG + Intergenic
956458206 3:69444391-69444413 CCAGTTGGTGTATGAGGAGTTGG + Intronic
956688585 3:71855512-71855534 CTAGATTCTGCATGAGAAGTAGG + Intergenic
956789225 3:72668057-72668079 CCAGCCCCTGAATGAGGAATGGG + Intergenic
957667491 3:83251654-83251676 CCAGCTACTGGGTGGGGAGTGGG + Intergenic
959119664 3:102217617-102217639 CCTAATGCTGGATGACGAGTTGG + Intronic
959280151 3:104327108-104327130 CCTGCTCCTGAATGAGCAGTGGG + Intergenic
959815389 3:110668107-110668129 CCAGATCCTGAATGATCATTGGG + Intergenic
959968847 3:112385545-112385567 CCAGATGTAGGATGAGGACTGGG - Intergenic
960716472 3:120580050-120580072 CCAGTTCCTGGAGTAGGGGTGGG + Intergenic
961209235 3:125112511-125112533 CCAGATTCTGCATGAGGTGCTGG - Intronic
961442798 3:126962742-126962764 ACAGAGCCTGGAAGAGGAGGAGG - Intergenic
962285730 3:134084428-134084450 CCAGACCCTGGCTGAGCAGCTGG + Intronic
965481911 3:169229187-169229209 TCAGTTCCTGTATAAGGAGTTGG - Intronic
967081105 3:186050406-186050428 CCCCATGCTGGATGTGGAGTTGG + Intronic
968426424 4:526464-526486 CCCGCTCCTGGGTGAGGAGATGG - Intronic
968426857 4:529356-529378 CCACATCCTGGCTGAGGAGCTGG - Intronic
969416594 4:7064153-7064175 CCAGAACCTGGAAGAGGACATGG - Exonic
970254656 4:14154870-14154892 CCAGAGCCTGGGTGAGGAAGGGG - Intergenic
970650762 4:18175398-18175420 CCTGATGCTAGATGACGAGTTGG - Intergenic
971957447 4:33440173-33440195 TCAGTACCTGGATCAGGAGTGGG + Intergenic
973092369 4:46153936-46153958 CCGGATCATGGATGAGAAATTGG + Intergenic
977820641 4:101468706-101468728 TCAGATCCTGAATGCAGAGTTGG + Intronic
979314452 4:119245047-119245069 CCAAATCCTTAATGAGGAGTTGG + Intronic
979832287 4:125317059-125317081 CCAGCTCCTGGTTGAGGTGGAGG + Exonic
980992764 4:139752400-139752422 CCACACACTGGAAGAGGAGTTGG - Intronic
982109612 4:152041731-152041753 CCAGATCCTGGAAAAAGAGGAGG - Intergenic
982724919 4:158896229-158896251 TCACTTCCTGGAGGAGGAGTAGG + Intronic
983348320 4:166555505-166555527 CCTAATGCTGGATGATGAGTTGG + Intergenic
984833236 4:183995753-183995775 CCAGATCCTGGTTGACAAGAAGG - Intronic
990531591 5:56679443-56679465 TCAGATTCAGGATGAGAAGTAGG + Intergenic
994329879 5:98492276-98492298 CCAGGTCCTGCAGGAGCAGTTGG - Intergenic
995457484 5:112367539-112367561 CCAGATGGGGGATGCGGAGTGGG - Intronic
995686785 5:114780536-114780558 CCAGATCCTCAATGGGGAATGGG - Intergenic
997066787 5:130569786-130569808 CCTGATGCTAGATGACGAGTTGG - Intergenic
997662427 5:135599781-135599803 CCTGATCCTGTATAAGGAGCTGG + Intergenic
999183849 5:149690778-149690800 ACAGATGCTGAAAGAGGAGTAGG - Intergenic
1001753168 5:174146850-174146872 CCAGATCCTGGGCCAGGTGTTGG - Intronic
1001945840 5:175777328-175777350 CAAGAAGCGGGATGAGGAGTGGG - Intergenic
1002655455 5:180743105-180743127 CCAGACCATGGATGAGGAAATGG - Intergenic
1005565095 6:27083623-27083645 CCAGAGCCTGCATGAGGGGGAGG + Intergenic
1007427993 6:41759579-41759601 CCAGGGCCTGGATAAGGAGCAGG + Intergenic
1011789478 6:90883049-90883071 CCAGCTCCTGAATGAGCATTGGG - Intergenic
1011890498 6:92153407-92153429 CCAGATTCTGGAGGGTGAGTCGG + Intergenic
1016240788 6:141927401-141927423 CCAGTTCCTGGAGTAGGGGTGGG + Intergenic
1016699109 6:147033850-147033872 CCAGACCCTGTATGACAAGTGGG + Intergenic
1018707774 6:166475495-166475517 CCAGATGCTGGACGGGGTGTGGG - Intronic
1019015925 6:168879144-168879166 CCATGTCCTGGAGGTGGAGTGGG - Intergenic
1019285242 7:220018-220040 CCAGACCCAGGGTGAGGAGCGGG - Intronic
1019373095 7:673822-673844 CCAGATCCAGGATCAGCAGGTGG + Intronic
1019603026 7:1894767-1894789 ACAGAGTCTGGAGGAGGAGTGGG + Intronic
1019705987 7:2497641-2497663 CCAATCCCTGCATGAGGAGTGGG + Intergenic
1020921848 7:14275277-14275299 CCAGGGCCTGTATTAGGAGTTGG - Intronic
1020935697 7:14460983-14461005 CCAGATCCTGAATGAGTACGGGG + Intronic
1022191190 7:28018209-28018231 ACAGCTCCTGGAGGAGGAGTCGG + Intronic
1023740951 7:43280112-43280134 CCAGATGCTGGGTCAGGACTAGG + Intronic
1025615538 7:63113743-63113765 TCACCTCCTGGGTGAGGAGTCGG + Intergenic
1025739230 7:64182755-64182777 TCACCTCCTGGGTGAGGAGTCGG - Intronic
1026224505 7:68428628-68428650 AGAGATTCTGGATGTGGAGTGGG + Intergenic
1026903215 7:74048334-74048356 CAGGATCCTGGGGGAGGAGTGGG + Intronic
1026913363 7:74105777-74105799 CCAGATCCAGGGTGAGCAGGTGG - Intronic
1026978350 7:74512490-74512512 TCAAGTCCTGGATGAGGAGGAGG - Intronic
1027266151 7:76496298-76496320 TCTGTTCCTGGATGGGGAGTGGG + Intronic
1027317528 7:76994416-76994438 TCTGTTCCTGGATGGGGAGTGGG + Intergenic
1028835842 7:95374089-95374111 ACAGATCATGGAGGGGGAGTGGG - Intronic
1029438280 7:100574314-100574336 CCACATCCTGGAAGAGGAGGGGG - Intronic
1030539544 7:110812615-110812637 ACATATCCTGGATCAGGATTGGG + Intronic
1032850446 7:135790549-135790571 CCAGATCCTGGCTGAGAATCGGG - Intergenic
1032960882 7:137032802-137032824 CCAGCTCCTGGAGGATGAGATGG + Intergenic
1034970709 7:155417711-155417733 CCAGATCCAGGAGGAGCAGGAGG - Intergenic
1035009165 7:155697179-155697201 CCACCTCCTGGAGGAGGAGGAGG + Intronic
1035302041 7:157903837-157903859 CCACAGCCTGGATGGGGAGACGG - Intronic
1035536331 8:393974-393996 CCAGCTCCTGGGTGGGGAGATGG - Intergenic
1039599034 8:38818283-38818305 TCTGATCCTGGATTAGGATTAGG + Intronic
1040471576 8:47738692-47738714 CCAGATGCGGGAAGAGGCGTGGG + Exonic
1042465895 8:69129755-69129777 CCAGCTCGTTGAGGAGGAGTTGG + Intergenic
1042853623 8:73241599-73241621 CCAGAACCTGGAGGAGGAGGTGG + Exonic
1043499501 8:80838663-80838685 GCAGAACCTGGAGGAGGAGGAGG + Intronic
1043648597 8:82557834-82557856 CCAGTTCCTGGATGACCACTAGG + Intergenic
1045254445 8:100508053-100508075 CCAGGAGCTGGGTGAGGAGTGGG + Intergenic
1045280762 8:100747715-100747737 GCAGATCCTGGAGGAGCAGGAGG + Intergenic
1048909440 8:139120532-139120554 CTAGAGCCTAGGTGAGGAGTAGG - Intergenic
1049319721 8:141989611-141989633 CCAGATTCCGCATGAGGAGTGGG - Intergenic
1049693979 8:143974769-143974791 CCAGATCCTGGCTCAGGAAGAGG + Intronic
1050690407 9:8221247-8221269 ACAGATGCTGACTGAGGAGTTGG + Intergenic
1055354922 9:75428034-75428056 CCAGTTCATGGCTCAGGAGTTGG - Intergenic
1056680841 9:88716666-88716688 CCAGATCCAGGAAGAGAATTGGG - Intergenic
1060029000 9:120198019-120198041 CCAGTTCCTGCAGGAGGGGTGGG - Intergenic
1060553692 9:124497705-124497727 GCAGAGCCTGGAGCAGGAGTGGG - Intronic
1061109479 9:128558143-128558165 CCAGATCTCGGAAGAAGAGTGGG - Intronic
1061832550 9:133304824-133304846 CCACATCCTGGAGGAGGAAGGGG - Intergenic
1186486331 X:9936968-9936990 CCACATCCTGGATGAGGCAGAGG - Intronic
1186853574 X:13604252-13604274 TAAGATTCTGGTTGAGGAGTAGG + Intronic
1188588232 X:31802859-31802881 ACAGGGCCTGGATGAGGACTTGG + Intronic
1189055755 X:37698051-37698073 CCAGATCTTGGAGGATGGGTTGG + Intronic
1189095507 X:38134533-38134555 ACAGAGCCAGGCTGAGGAGTGGG + Intronic
1189261568 X:39682654-39682676 CCAGATTCTGGCAGAGGAGATGG + Intergenic
1189685928 X:43563511-43563533 CCATATCCTGGATGAGGGGCAGG - Intergenic
1189812864 X:44797302-44797324 CCAGCTACTGGATGAGGTGGTGG - Intergenic
1192006002 X:67213031-67213053 CCAGAAGCTGCATTAGGAGTTGG + Intergenic
1193785783 X:85758153-85758175 CCAGCTCCTGAATGAGCATTGGG - Intergenic
1196810749 X:119627341-119627363 CCAGTTCTGGGATGAGGAATGGG + Intronic
1197195967 X:123700927-123700949 CCAGATCAAGGATGGGGAATAGG - Intronic
1197712438 X:129681182-129681204 ACAGATCCTGGATAAGAGGTGGG + Intergenic
1198572093 X:137968428-137968450 CCAGATCCTGCCTTGGGAGTAGG - Intergenic
1199852432 X:151735253-151735275 ACAGATCTTAGATGAGCAGTGGG - Intergenic
1200909534 Y:8517603-8517625 CCAGATGGTGGTTGAGGAGAAGG - Intergenic
1201053002 Y:9959314-9959336 CCATATCCTTCATGAGGAGCAGG - Intergenic