ID: 1083822992

View in Genome Browser
Species Human (GRCh38)
Location 11:65183005-65183027
Sequence CAGATCCTGGATGAGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083822986_1083822992 3 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822992 11:65183005-65183027 CAGATCCTGGATGAGGAGTAGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1083822979_1083822992 19 Left 1083822979 11:65182963-65182985 CCCACGGTGAGAGGGGCCATCCT 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1083822992 11:65183005-65183027 CAGATCCTGGATGAGGAGTAGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1083822987_1083822992 -1 Left 1083822987 11:65182983-65183005 CCTGGGTGGGACTCGGCTAAGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1083822992 11:65183005-65183027 CAGATCCTGGATGAGGAGTAGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1083822980_1083822992 18 Left 1083822980 11:65182964-65182986 CCACGGTGAGAGGGGCCATCCTG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1083822992 11:65183005-65183027 CAGATCCTGGATGAGGAGTAGGG 0: 1
1: 0
2: 1
3: 21
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083822992 Original CRISPR CAGATCCTGGATGAGGAGTA GGG Intronic
900490353 1:2945905-2945927 CAGATCCTGGCGGAGCAGGATGG + Intergenic
901170743 1:7255421-7255443 CAGCTTCTGAATGAGGAATACGG - Intronic
902618647 1:17637906-17637928 CAGCTCCTGGAAGAGGCGTGGGG - Exonic
902709243 1:18227355-18227377 CAGATCCTGGCTGCGTAGGATGG + Intronic
904486563 1:30828632-30828654 CAGATCTTGGAAGAAGAGTATGG - Intergenic
904568475 1:31442886-31442908 CAGATCCTGAGTGTGGAGTCAGG + Intergenic
905281795 1:36854018-36854040 CAGATCCTGGGAGATGGGTAGGG + Intronic
906708236 1:47910363-47910385 CTGATCCTGGCTGAGTAGTCAGG - Intronic
907415857 1:54313381-54313403 TAGTTCCTGGCTGAGGAGCAGGG - Intronic
907547670 1:55276296-55276318 CTGATCCTGGAGGTGGAGTCAGG - Intergenic
907592568 1:55689836-55689858 CAGAGCATGGATGAGGAGGTGGG + Intergenic
907862262 1:58364841-58364863 GAGATCCTGGCTGAGGAAAAGGG - Intronic
908849275 1:68358274-68358296 TTTATCCTGGCTGAGGAGTATGG - Intergenic
908991003 1:70089104-70089126 CAGCTCCTGGAGTAGGAGTTAGG - Intronic
909172718 1:72316324-72316346 CAGATCCTGGATAATGAGAGTGG - Intergenic
914906939 1:151754115-151754137 CAGATCTTGGAGAATGAGTATGG + Intergenic
914950630 1:152110653-152110675 CAGCTCCAGGAGGAGGAGGACGG - Exonic
915108788 1:153549972-153549994 CAGACCCTGGGTCAGGAGTCAGG + Intronic
915304569 1:154970194-154970216 CATGTCCTGGAGGAGGGGTAGGG + Exonic
916236769 1:162596555-162596577 CAAATCTTGGAGGATGAGTATGG + Intronic
917791591 1:178502624-178502646 GAGATCCTGGGACAGGAGTAAGG + Intergenic
920184456 1:204151631-204151653 CAGCTCCTGGATGAGGCGCAGGG + Exonic
920658057 1:207891042-207891064 GAGAGTCTGGATGAGGAGGAGGG + Intronic
921071299 1:211660385-211660407 CAGATCCTGAAGGAGAATTAGGG - Intronic
922801598 1:228367154-228367176 CAGCTCCAGGATGAGGATGAGGG - Exonic
923128953 1:231058075-231058097 CACATTCTGGATCAGGAGTTTGG - Intergenic
1063013706 10:2052669-2052691 CAGACCCTGGATGGTGAGTGAGG + Intergenic
1063636744 10:7788964-7788986 CAGGTCCTGGGGGAGGAGTTCGG + Intronic
1065698437 10:28401749-28401771 CAGAACCAGGATGGGGATTAAGG + Intergenic
1068660410 10:59617338-59617360 GAGATCCTGGAAGAGAAATAGGG - Intergenic
1071098285 10:82004749-82004771 CAGAGCCTGTATGAGAAGTCTGG + Intronic
1071906474 10:90179924-90179946 CACATCCTGGATAAGTAGCAGGG + Intergenic
1074536375 10:114331078-114331100 AAGACCCTGGATGAGGAGGCAGG + Intronic
1075977234 10:126706461-126706483 CAGGTCCTGGGTGTGGAGTCAGG - Intergenic
1077640919 11:3880798-3880820 CAGGTCATGGTTGAGGAGTAAGG - Intronic
1078240257 11:9524692-9524714 TAGATGCTGCAAGAGGAGTATGG + Intronic
1080083342 11:28248401-28248423 CAGATACTGGATGACAAGCAAGG - Intronic
1083254906 11:61489976-61489998 CACGGCCTGGATGAGGGGTAGGG - Intronic
1083822992 11:65183005-65183027 CAGATCCTGGATGAGGAGTAGGG + Intronic
1085472550 11:76767562-76767584 CAGATCCGGGACGAGGAGCAGGG + Intergenic
1088218989 11:107547246-107547268 CAGATTCTAGGTGTGGAGTAAGG + Intronic
1088852816 11:113719257-113719279 AAGATCCTGGACTAGGAGTCAGG - Intergenic
1089369077 11:117941359-117941381 CAGTTTTGGGATGAGGAGTAAGG + Intergenic
1089422290 11:118340887-118340909 CAGACCACTGATGAGGAGTAGGG + Intronic
1089638563 11:119832249-119832271 CAGCTCCTGGCTGAGCAGCAGGG - Intergenic
1089971636 11:122698354-122698376 CAGAGCCTAGATGAGGGGCATGG - Intronic
1091304600 11:134529609-134529631 CAGATCCTGGAGGTGGACTTGGG + Intergenic
1092061177 12:5551809-5551831 CTGATTTTGGATTAGGAGTAGGG - Intronic
1095726859 12:45463378-45463400 GAGATCCTGATTGAGTAGTATGG - Intergenic
1096000254 12:48123396-48123418 CAGATCCGGTATGAGGTGGAGGG + Intronic
1096016736 12:48282987-48283009 CACATACTGGATGAGGACAAAGG - Intergenic
1096106465 12:48999220-48999242 GAGCTCCAGGATGAGGAGTCTGG - Exonic
1098993970 12:77096705-77096727 GAGATCCTGGATGTTGAGTATGG - Intergenic
1100052859 12:90471433-90471455 CAGAGCCTGGGTCTGGAGTATGG + Intergenic
1100992498 12:100266629-100266651 CAAATTCTGATTGAGGAGTAGGG - Intronic
1101951424 12:109179160-109179182 CAGATCCTCGCTGACCAGTATGG + Exonic
1102453096 12:113056069-113056091 GAGATCCTGGAGGAAGAGAAGGG - Intergenic
1102638030 12:114341625-114341647 CAGACCCTTGGTGTGGAGTAAGG - Intergenic
1103055395 12:117816194-117816216 CAGAACCTGGAGGAGGTGCATGG - Intronic
1106603354 13:31206070-31206092 CAGATCCTTGATGGGGGATATGG + Intronic
1107808440 13:44176384-44176406 AAAATCCTGGGTGATGAGTAGGG - Intergenic
1108521632 13:51251680-51251702 CTGTTCCTGCAGGAGGAGTACGG + Exonic
1110922900 13:81111093-81111115 AAGATCCTGGACTAGGAGAAGGG - Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114626317 14:24132366-24132388 CAGGTCCTCGATGAGCAGGAAGG - Exonic
1114656162 14:24316767-24316789 CAGTACCTGGAGGAGGAGCAGGG + Exonic
1116942984 14:50809336-50809358 CAGATCCTGGAGGAGAAGGCAGG - Intronic
1118150608 14:63185391-63185413 AAAATCGTGGATGAGGAATAAGG - Intergenic
1122149455 14:99717140-99717162 CAGGTCCTGGATGAGGCTTCTGG + Intronic
1122295575 14:100703895-100703917 CAGTTTATGGATGAGGAGTCTGG + Intergenic
1132993865 16:2812512-2812534 CTGATCCTGGTTGAGGACTGGGG + Intergenic
1134079113 16:11312869-11312891 CAGATCCTGGGTGGGGAGTGAGG - Intronic
1135911009 16:26560729-26560751 CAGAGCCTAGATGAGGAACAGGG + Intergenic
1137977200 16:53041958-53041980 CAGAGCCTGGAGGAGCAGGAGGG - Intergenic
1138184798 16:54968221-54968243 CAGATCCTGGATGAGAACCAAGG - Intergenic
1138673310 16:58632556-58632578 CAGAACAAGGATGAGGAATAAGG + Intergenic
1140201715 16:72900239-72900261 AATATCCTGGGTGAGGAGCAGGG + Intronic
1142995184 17:3755822-3755844 CAGATCCTGGATGAGGTACGTGG - Exonic
1143658351 17:8310533-8310555 CAGAGCCTGGCTGAGCAGCATGG - Intronic
1143714220 17:8755645-8755667 CACATCCTGGAAGAGGAAGATGG + Intronic
1147795091 17:43036563-43036585 CTGGTCCTGGAGGAGGAGTTGGG + Intergenic
1148783961 17:50136172-50136194 CAGAGCCTGGAGCAGGAGAAGGG - Exonic
1149642781 17:58214917-58214939 CAGGTCCTGGATGAGGTTTCAGG - Intronic
1149773394 17:59339076-59339098 GATATCCTGGATGACGTGTAGGG - Intronic
1151331285 17:73410727-73410749 CAGAAACTGGTGGAGGAGTAAGG - Intronic
1154290633 18:13102942-13102964 CTGAGCCTGGAGGAGGCGTAGGG - Intronic
1158412888 18:57223207-57223229 AAAAGCCTGGAAGAGGAGTAAGG - Intergenic
1158523222 18:58189057-58189079 CAGATATTGGATGAGGATAAAGG - Intronic
1158653328 18:59307144-59307166 AAAGTCCTGGATGAAGAGTAAGG + Intronic
1160386688 18:78501228-78501250 CAGATCTTGGGTGAAGAGAACGG + Intergenic
1164589878 19:29500835-29500857 CAGGACCTGGATGGTGAGTAAGG + Intergenic
1164656653 19:29926809-29926831 CAGGTCCTGAAGGAGGAGCAAGG + Intronic
1165227717 19:34366098-34366120 CAGACCCTGGATGAGGAGCCCGG - Intronic
1165349140 19:35267180-35267202 CCGATCCGGGATGAGGAGTGGGG + Exonic
1165396642 19:35567925-35567947 CAGATCCTGCCTGTGGACTAAGG - Intergenic
1165834147 19:38744113-38744135 CAGCTCGTGGATGAGGAGGCTGG - Exonic
1165867113 19:38945765-38945787 CAGAGCCTGGGGGAGGAGTCTGG + Intronic
1166259478 19:41627581-41627603 CAGCTCCTGGATGTGGAGGGAGG + Intronic
925239037 2:2306045-2306067 CTGATCCTGGAACAGGAGCAAGG + Intronic
925285871 2:2715457-2715479 CAGATGCTGAAGGAGGAGGATGG - Intergenic
925300647 2:2809417-2809439 CAGATCCTCTATTAGGAGTTGGG + Intergenic
925314254 2:2909134-2909156 CAGCTCCTGGGAGAGGAGGACGG - Intergenic
926329406 2:11812401-11812423 CAGTGCCTGGGTGAGGAGTGAGG + Intronic
927203790 2:20594335-20594357 AAGATCCTGGAGGAGGTGAATGG + Intronic
930154510 2:48092467-48092489 CAGAGCCTGGATGAGGATGTGGG - Intergenic
930774756 2:55160908-55160930 CTGATGCTGGATGAGGAGGAAGG - Intergenic
931052215 2:58428076-58428098 CAGTTTCTGGAAGAGGAGGAGGG - Intergenic
931764085 2:65439168-65439190 CAGATCCTGGAGGTGGAGATGGG + Intergenic
932420575 2:71599040-71599062 CAGCTCCTCGATGAGAAGAAGGG - Intronic
933760124 2:85667072-85667094 CAGATCCTGGATGAAGGTTGGGG - Intronic
933812892 2:86044206-86044228 CAGTTCCTGTATGGGGAGGATGG - Exonic
937864473 2:126738547-126738569 CAGTGCCTGGAAAAGGAGTATGG + Intergenic
938105511 2:128527209-128527231 CAGACCCTGGGTGCAGAGTAGGG + Intergenic
941040833 2:160621185-160621207 CAGAATCTGGATGTGGAGTCTGG + Intergenic
946308545 2:218870254-218870276 CAGATCCTGGAGCAAGAGAAGGG + Intronic
946663688 2:222027971-222027993 CAGATGCTTGAGGAGGAGAAAGG + Intergenic
948528472 2:238588026-238588048 CAGAAACTGGATGAGAAGCAAGG - Intergenic
1168881445 20:1209546-1209568 CAGATGCTGGACAAGGAGTTGGG + Intergenic
1169153043 20:3305601-3305623 CACATCCTGGGTGAGGAATCTGG + Intronic
1169911190 20:10648717-10648739 CAAATCCTAGAAGAGGAGAAGGG + Exonic
1170130423 20:13013134-13013156 CAGATGCTGGAAGAAGAGAAAGG + Intronic
1170814171 20:19698651-19698673 CAGACCCTGGCTGTGGATTACGG + Exonic
1171255379 20:23686051-23686073 CACAGCCTGGGTGAGGAGGATGG + Intronic
1171262720 20:23747973-23747995 CAGAGCCTGGGTGAGGAGGATGG + Intronic
1171328641 20:24318203-24318225 CAGAGCCGGGATGGGGAGCAGGG - Intergenic
1175283514 20:57821081-57821103 CAGACCCTGGTTGAGGAGCCTGG + Intergenic
1175855544 20:62118921-62118943 CAGATCCTGAATGAGGGGACGGG + Intergenic
1175874196 20:62221732-62221754 GGGAGCCTGTATGAGGAGTAGGG - Intergenic
1176169245 20:63689604-63689626 CAGTTCCTGGATGAGATGAAGGG + Exonic
1177411038 21:20730946-20730968 CAGATCCTGAGAGAGGTGTAGGG - Intergenic
1179692742 21:43092158-43092180 CAGATCCTGCTGGTGGAGTAGGG - Intergenic
1180228993 21:46414934-46414956 CAGAGCCTGGAGGAGTAGTTGGG - Intronic
1180231742 21:46430504-46430526 CAGATCCATGCTGAGCAGTAAGG + Exonic
1180901482 22:19376519-19376541 CAGATCATGGAGGAGAAGAATGG - Intronic
1180962586 22:19768682-19768704 CACATCCTGGATGTGGAGTACGG - Intronic
1181458547 22:23072855-23072877 CAGAACCTGGTGCAGGAGTATGG + Intronic
1181540272 22:23569245-23569267 TAGATCCGGGATGTGGGGTAGGG + Intergenic
1181823469 22:25494157-25494179 TAGAAGCTGGATGAGGAGTAGGG - Intergenic
1182004419 22:26947533-26947555 CATTTCATGGATGAGGAATATGG + Intergenic
1184535258 22:45082340-45082362 CAGAGCCTGGGAGAGGAGTCAGG + Intergenic
951091227 3:18576287-18576309 CAGATACTGGCTGAGGAATCTGG - Intergenic
951366862 3:21793997-21794019 CTGATCCTTGATGAGTGGTATGG - Intronic
951555572 3:23917386-23917408 CGGATCCTGGAGGAGGCGTGGGG + Intronic
955713710 3:61806419-61806441 CAGAACCTGGATAAGGATGATGG - Intronic
955871785 3:63446583-63446605 CAGCTTCTGGATGAGAAGCAGGG + Intronic
956164701 3:66387572-66387594 CAAATCCTGGGGGAGGAGAAAGG + Intronic
956688586 3:71855513-71855535 TAGATTCTGCATGAGAAGTAGGG + Intergenic
957299943 3:78379021-78379043 CTGATTCTGGCTGAGGAGAATGG - Intergenic
962853043 3:139322237-139322259 CAGAACCTGGAAGGGGAGCATGG - Intronic
964672206 3:159238896-159238918 CAGACCTTGGCTGAGGAGTTTGG + Intronic
966284533 3:178278422-178278444 AATATCATGCATGAGGAGTAAGG + Intergenic
967081622 3:186054870-186054892 CTGATCCTGGGTGAAGAGAAAGG + Intronic
967409375 3:189152013-189152035 CAGAACCTGGAATAGGAGTATGG + Intronic
968426856 4:529355-529377 CACATCCTGGCTGAGGAGCTGGG - Intronic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
968864490 4:3199108-3199130 CAGCTCCTGGAGAAGGAGTCAGG - Intronic
969231511 4:5835066-5835088 CACATACTGGAGAAGGAGTATGG - Intronic
970210809 4:13708079-13708101 GAGATTATTGATGAGGAGTATGG + Intergenic
974137966 4:57843515-57843537 CAGATCATGGATGAAGAGAATGG - Intergenic
978133967 4:105234480-105234502 CAGATTCTGAATGAGCAGGAGGG + Exonic
982763918 4:159321586-159321608 CAGAGCCATGGTGAGGAGTAAGG + Intronic
985261287 4:188117414-188117436 AAAATCCTGGATTAGGAGTCAGG - Intergenic
987306425 5:16642008-16642030 CAGATCCTGGAGGATGACAATGG - Intergenic
988298844 5:29396070-29396092 AAGTTCCTGGAGGAGGAGGAGGG - Intergenic
988787611 5:34579110-34579132 CAGATGCTGCAAGAGGAGAAAGG + Intergenic
990531592 5:56679444-56679466 CAGATTCAGGATGAGAAGTAGGG + Intergenic
991636506 5:68711289-68711311 CAGATTCTGGGGGAGGAGGAGGG - Intergenic
992221737 5:74580254-74580276 CAGATCCTACATGAGAAATAGGG - Intergenic
992998684 5:82357877-82357899 CAGATCGCTGATGAAGAGTAAGG - Intronic
993859604 5:93119101-93119123 CTGGTCCTGGAAGAGGACTATGG - Intergenic
996960935 5:129248761-129248783 TAGATGCTGGAAGAGGAGAAAGG + Intergenic
997498049 5:134347110-134347132 CAGAAACTGGGTGAGGACTATGG + Intronic
999183848 5:149690777-149690799 CAGATGCTGAAAGAGGAGTAGGG - Intergenic
999633312 5:153594120-153594142 CAGCTTCTGGAGGAGGAGAAGGG - Intronic
999698352 5:154205815-154205837 CAGAAGCTGGAAGAGGAGGAAGG + Intronic
1000309649 5:160029821-160029843 CAGATCCTGGAAGTGGGCTAGGG + Intronic
1000754645 5:165142990-165143012 CAGATCTTGGACGAGGAGAAAGG + Intergenic
1002511338 5:179720463-179720485 CAGCTCCTGGATGTGGTGTCTGG + Exonic
1002878300 6:1230447-1230469 CAGAACCTGGGTGAGTATTATGG + Intergenic
1003543819 6:7041502-7041524 CATATTCTGGATGAGGAGCATGG + Intergenic
1005688293 6:28276792-28276814 CTGATGGTGGGTGAGGAGTAAGG - Exonic
1007112697 6:39322232-39322254 CAGCTCCTGGGTGAGGACTGTGG + Intronic
1011149641 6:84256369-84256391 CAGGTCCTGGAGGAGAACTATGG + Intergenic
1013294082 6:108743320-108743342 CAGACCCTGGATGAGGGCGAGGG - Intergenic
1013485287 6:110590637-110590659 CAGAAGCTGGCTGAGGAGTTAGG + Intergenic
1014630923 6:123789196-123789218 CAGCTGCTGGATGAAGAGCATGG + Intergenic
1015526042 6:134175866-134175888 CAGAACTTGGAAGAGGAGGAAGG + Intronic
1017147523 6:151248201-151248223 TAAATCCAGGATGAGGTGTAGGG - Intronic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022807942 7:33841987-33842009 CAGAGCCTAGAAGAGGAGTCAGG + Intergenic
1026916413 7:74122510-74122532 CAGGACCTGGGTGGGGAGTACGG - Exonic
1027266152 7:76496299-76496321 CTGTTCCTGGATGGGGAGTGGGG + Intronic
1027317529 7:76994417-76994439 CTGTTCCTGGATGGGGAGTGGGG + Intergenic
1028686479 7:93594712-93594734 CAGAACGTGGATGAGGAGGGAGG + Intronic
1028835841 7:95374088-95374110 CAGATCATGGAGGGGGAGTGGGG - Intronic
1030064848 7:105651754-105651776 GACATTCTGGAAGAGGAGTAAGG + Intronic
1033291879 7:140092072-140092094 TAGATCCTGAAGGAGGAGGAAGG + Exonic
1033528784 7:142243257-142243279 CAGATCTGGGATGGGGGGTAAGG + Intergenic
1033989347 7:147264923-147264945 CAAATCCTACATGAGGAGGAAGG + Intronic
1036293699 8:7517987-7518009 CAGATCCTAGGTGTGGAGGATGG - Intergenic
1036328862 8:7803008-7803030 CAGATCCTAGGTGTGGAGGATGG + Intergenic
1042058369 8:64790247-64790269 CTGATCCTGAATGTGGGGTATGG - Intronic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1044199239 8:89414168-89414190 CAGATGCTGGCTGAGAAGCATGG - Intergenic
1045616528 8:103920037-103920059 CAGATACTGCATGAGCAGCATGG + Intronic
1047742764 8:127820095-127820117 CTGAGCCTGGAAGAGAAGTATGG + Intergenic
1049048029 8:140168411-140168433 CAGGTCCTGGGTGGGGAGAAGGG - Intronic
1049319720 8:141989610-141989632 CAGATTCCGCATGAGGAGTGGGG - Intergenic
1054452699 9:65411904-65411926 CAGATCCTGGATTGGGGGCATGG + Intergenic
1056812776 9:89777121-89777143 CAGTTCCTGGAGTGGGAGTAAGG + Intergenic
1057791213 9:98126471-98126493 CAGATCCAGGCTGAGAAGAAGGG - Intronic
1059473524 9:114525338-114525360 CGGATGCTGGATGACGAGCATGG + Intergenic
1061451397 9:130668821-130668843 CAGATGCTGGATATGCAGTATGG + Intronic
1061457195 9:130707412-130707434 CAGATACTGGATGAACAGCATGG - Intergenic
1186853575 X:13604253-13604275 AAGATTCTGGTTGAGGAGTAGGG + Intronic
1188588233 X:31802860-31802882 CAGGGCCTGGATGAGGACTTGGG + Intronic
1189685927 X:43563510-43563532 CATATCCTGGATGAGGGGCAGGG - Intergenic
1190048328 X:47130100-47130122 CGGATTCTGGATGAGGACAATGG + Intergenic
1190789003 X:53682634-53682656 CAGCTCCTGGAAAAGGAGTATGG + Intronic
1191220739 X:57985550-57985572 CAGATGCTGGCTGGGGAGCACGG + Intergenic
1191740582 X:64432710-64432732 CATGTCCTGGAGGAGGGGTAGGG - Intergenic
1197712439 X:129681183-129681205 CAGATCCTGGATAAGAGGTGGGG + Intergenic
1197905740 X:131423663-131423685 CAGATGCTGGAAGGGGATTATGG + Intergenic
1198435059 X:136609080-136609102 CAGGTACTGGCTGAGGAGTTTGG + Intergenic
1198572092 X:137968427-137968449 CAGATCCTGCCTTGGGAGTAGGG - Intergenic
1201053001 Y:9959313-9959335 CATATCCTTCATGAGGAGCAGGG - Intergenic
1201754300 Y:17469513-17469535 GGGATCCTGGATTAGGATTAGGG + Intergenic
1201847252 Y:18436472-18436494 GGGATCCTGGATTAGGATTAGGG - Intergenic