ID: 1083822993

View in Genome Browser
Species Human (GRCh38)
Location 11:65183009-65183031
Sequence TCCTGGATGAGGAGTAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 390}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083822979_1083822993 23 Left 1083822979 11:65182963-65182985 CCCACGGTGAGAGGGGCCATCCT 0: 1
1: 0
2: 0
3: 9
4: 84
Right 1083822993 11:65183009-65183031 TCCTGGATGAGGAGTAGGGATGG 0: 1
1: 0
2: 6
3: 36
4: 390
1083822980_1083822993 22 Left 1083822980 11:65182964-65182986 CCACGGTGAGAGGGGCCATCCTG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1083822993 11:65183009-65183031 TCCTGGATGAGGAGTAGGGATGG 0: 1
1: 0
2: 6
3: 36
4: 390
1083822986_1083822993 7 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822993 11:65183009-65183031 TCCTGGATGAGGAGTAGGGATGG 0: 1
1: 0
2: 6
3: 36
4: 390
1083822987_1083822993 3 Left 1083822987 11:65182983-65183005 CCTGGGTGGGACTCGGCTAAGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1083822993 11:65183009-65183031 TCCTGGATGAGGAGTAGGGATGG 0: 1
1: 0
2: 6
3: 36
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083822993 Original CRISPR TCCTGGATGAGGAGTAGGGA TGG Intronic
901425618 1:9180960-9180982 TCATGGCTGAGGAAGAGGGAAGG - Intergenic
901876670 1:12170569-12170591 TTCTGGAGGAGTAGCAGGGACGG + Intronic
901881662 1:12197666-12197688 TGCTGGTTGAGGAGTAGCGTGGG - Intronic
901892144 1:12275830-12275852 TCCAGGAGGAAAAGTAGGGATGG + Exonic
902402654 1:16166590-16166612 ACCTGGATGAGGAGCTGGGGAGG + Intergenic
903249146 1:22039769-22039791 TCCTGTAGAAGAAGTAGGGATGG + Intergenic
904096078 1:27978597-27978619 TGCTTGCTGGGGAGTAGGGATGG + Intronic
904328351 1:29742013-29742035 TACTGGGTGTGGAGAAGGGATGG + Intergenic
904397032 1:30228916-30228938 TCCAAGAAGAGGAGTCGGGAGGG - Intergenic
905092024 1:35437330-35437352 TCCTGACTGAGGAGGAAGGAGGG - Intronic
905696823 1:39980743-39980765 TCCTGGATGGTGAGCAGGCAGGG - Intergenic
908087740 1:60654293-60654315 TCATGGATGGAGAGTTGGGAGGG - Intergenic
908787276 1:67747796-67747818 TCCGGGAAGAGGAGGAGAGATGG - Intronic
915245481 1:154553171-154553193 TCCTGGAGGAGGTGTGGGGTGGG + Exonic
915303989 1:154967619-154967641 TCTTGGATTAGGATTAGGAAAGG - Intronic
916692347 1:167202420-167202442 GGATGGATGAGGAATAGGGATGG - Intergenic
918542878 1:185650372-185650394 TCCTAGATCTGGATTAGGGAAGG + Intergenic
918630924 1:186717489-186717511 TCCTAGATAAGGAATGGGGAAGG + Intergenic
918638893 1:186814245-186814267 TCTTGGTTGAGGAGAAGAGAAGG + Intergenic
919384157 1:196897776-196897798 GGCTGGATGAGGAGCATGGAGGG + Intronic
919820000 1:201466752-201466774 TCCTCTATGAGCAGTAGGGCAGG - Intronic
920987854 1:210907437-210907459 TTCTGCATGAGGAGAAGGAAAGG + Intronic
921234667 1:213113730-213113752 TTCTGTATGAGGTGTAAGGAAGG + Intronic
923051818 1:230395207-230395229 TCGGGGATGGGGAGGAGGGAGGG - Intronic
923325366 1:232875793-232875815 GCCTGGATGATGATGAGGGAAGG - Intergenic
923672320 1:236051276-236051298 TCTGGGAGGAGGAGGAGGGAGGG - Intronic
924253319 1:242157743-242157765 TCCTGGATGAGGTGTCTGGGAGG + Intronic
924510646 1:244726856-244726878 GCCTGCATGGGGAGCAGGGAGGG + Intergenic
1062938012 10:1402192-1402214 CCCAGGATGAGGGGTAGGGAAGG + Intronic
1063666405 10:8063229-8063251 ACCTGGAAGAGGGGGAGGGAGGG - Intronic
1065873211 10:29973970-29973992 TGCTTGATGAGGAGAAGGGAAGG + Intergenic
1066373248 10:34835421-34835443 TTCTGGAGGAGGTGAAGGGAAGG - Intergenic
1066672513 10:37855546-37855568 GCCTTCATGAGGACTAGGGAGGG + Intronic
1067947138 10:50696697-50696719 TGCTGGAAGAGGAGTTGGGGAGG - Intergenic
1068088298 10:52401778-52401800 CACTGGATGGGGAGTAGGGGAGG - Intergenic
1069720135 10:70544568-70544590 TCCTGGATGTGGGGTGAGGAGGG + Intronic
1069829441 10:71273562-71273584 ACCTGGATGAGCAGGAGTGAGGG - Intronic
1069859342 10:71460774-71460796 TCCTGAATGTGGAGTTGGGGCGG + Intronic
1070440373 10:76436948-76436970 TCCTGTTTGAGGAGTGGGAAGGG - Intronic
1070882449 10:79861685-79861707 TGCTGGAAGAGGAGTTGGGGAGG - Intergenic
1071598674 10:86945475-86945497 ACCTGGAAGAGGAGAAGGGCTGG + Exonic
1071649019 10:87377996-87378018 TGCTGGAAGAGGAGTTGGGGAGG - Intergenic
1071894576 10:90051589-90051611 GCCTGGATGTGGAGAAGAGAGGG + Intergenic
1072224992 10:93360855-93360877 TCCAGGATGAGAATTTGGGAGGG - Intronic
1072745487 10:97936365-97936387 ACCTGGAGGAGGAATGGGGAGGG + Exonic
1073204317 10:101760847-101760869 TTCCTGATGAGGAGTGGGGAAGG - Intergenic
1074759965 10:116659989-116660011 TGCAGGATGGGGAGTGGGGACGG + Intergenic
1075091437 10:119446100-119446122 TCCTGGAGGAGGGGTACAGATGG - Intronic
1076527648 10:131122388-131122410 TCCAGGATGAGGAGAGGGGTTGG + Intronic
1077026446 11:442021-442043 CGCTGGAGGAGGAGGAGGGAGGG - Intergenic
1077228698 11:1449271-1449293 TCCTGGTTGTGGACAAGGGAAGG + Intronic
1077510225 11:2955978-2956000 TGATGGAGGAGGAGAAGGGAGGG - Intronic
1078091390 11:8266694-8266716 TCCTGCATTAGGAGTGGGGGTGG + Intronic
1078426262 11:11253621-11253643 TCTTGGGTGAGGTGTTGGGAAGG - Intergenic
1078436036 11:11326829-11326851 TCCAGGATGATGAGGAGGAAAGG - Intronic
1078660202 11:13279170-13279192 TCCTCGCTGAGGAGTAGCGGTGG - Intronic
1080688665 11:34537075-34537097 TCCTGGATTTGAAGCAGGGAAGG + Intergenic
1081516263 11:43833339-43833361 TCCTGAATGACGGGTAGAGAGGG - Intronic
1081753373 11:45527855-45527877 CCTTGGATGAGGAGCAGAGAAGG + Intergenic
1081810909 11:45913718-45913740 CCCTGGATGAGGCGTGGGGAAGG + Intronic
1081814914 11:45933602-45933624 TCTTGGGTGGGGAGCAGGGACGG - Exonic
1082797249 11:57387228-57387250 TCCTTGAGGAGGAGGATGGAGGG - Exonic
1083083445 11:60117179-60117201 GCTTGGATGAGTAGCAGGGAGGG + Intergenic
1083083504 11:60118071-60118093 GCTTGGATGGGTAGTAGGGAGGG + Intergenic
1083673924 11:64315130-64315152 TCCTGGATGAAGAGGGGGCACGG + Exonic
1083822993 11:65183009-65183031 TCCTGGATGAGGAGTAGGGATGG + Intronic
1083989681 11:66239233-66239255 TCATAGATGGGGAGGAGGGAGGG - Exonic
1084308220 11:68300295-68300317 GCCTGGAGGAGGACAAGGGAGGG + Intergenic
1084660022 11:70541310-70541332 GCCAGGCTGATGAGTAGGGAAGG - Intronic
1084914671 11:72419633-72419655 TCCTGCATGAGGAGGAAGCAAGG - Intronic
1085237497 11:75026276-75026298 CCCTGGATGGGCAGCAGGGAGGG + Intergenic
1085528349 11:77176938-77176960 TCTTGGATGAGGAGGAGAGAGGG + Intronic
1088891559 11:114048751-114048773 TCCTGCATCAAGAGAAGGGAAGG - Intergenic
1088987236 11:114920054-114920076 TCCTGGAGAAAGAGGAGGGATGG - Intergenic
1089298366 11:117483056-117483078 TCTTGTCTGAGCAGTAGGGACGG - Intronic
1090321230 11:125845193-125845215 TCCTGTATGAGGTGTCTGGAGGG - Intergenic
1090366726 11:126212331-126212353 TTCTTTAGGAGGAGTAGGGAAGG - Intronic
1091369361 11:135045796-135045818 TCCTGGTTCAGAAGGAGGGAGGG + Intergenic
1091785331 12:3239808-3239830 TCCTTGATGGGGAATAAGGAAGG + Intronic
1092081879 12:5723331-5723353 ACCTGGATGAGCAGAAGGCAGGG - Intronic
1092145419 12:6211325-6211347 TCCTGGCAGAGGGGTAGGGCAGG + Intronic
1092571857 12:9734178-9734200 TCTTGGATGAGGGGTAGGGATGG - Intergenic
1093134810 12:15437666-15437688 TCCTGGGTGTGGAGCAGAGAGGG - Intronic
1093711837 12:22336190-22336212 TCCTGGAAAAGGGGAAGGGAAGG + Intronic
1093760120 12:22900292-22900314 TACTGGATTGGAAGTAGGGAGGG - Intergenic
1093778813 12:23110063-23110085 TGCTGGGTGAGGAGTAGGCTGGG + Intergenic
1096460862 12:51820939-51820961 TCGCTGATGAGGAGTACGGAGGG + Intergenic
1097249205 12:57623150-57623172 CCTTGGATGAGGAGAAAGGATGG + Intronic
1099170594 12:79359391-79359413 GCCAGGAAGAGGACTAGGGATGG - Intronic
1099469229 12:83026052-83026074 TCCGGGAAGAGGAGAAGGGATGG - Intronic
1099801390 12:87461070-87461092 TCCTGGCTGAGGACTCTGGAGGG + Intergenic
1100000823 12:89833127-89833149 TCCTTGCTGGGGAGTAGGGTGGG - Intergenic
1101171112 12:102094949-102094971 TGAGGGATGAGGAGGAGGGATGG + Intronic
1101328084 12:103734572-103734594 TCCTGGATGAGGACTCAGGATGG - Intronic
1101660903 12:106764825-106764847 ATCTGGATGAGGAGGATGGACGG + Intronic
1101806534 12:108069077-108069099 TCCAGGGTGTGGAGTCGGGAAGG - Intergenic
1102010518 12:109615772-109615794 TCCTGGCTGAGGATTCTGGAGGG + Intergenic
1102453095 12:113056065-113056087 TCCTGGAGGAAGAGAAGGGCAGG - Intergenic
1103437483 12:120937959-120937981 TCCATGAGCAGGAGTAGGGAGGG - Intergenic
1103644842 12:122383134-122383156 CCCAGGGTGAAGAGTAGGGAAGG - Intronic
1103846289 12:123903875-123903897 TTCTGGATGAAGAGTGGGGAAGG - Intronic
1105344431 13:19560391-19560413 TCCTGGATGAAGAGGGGGCACGG - Intergenic
1105535602 13:21261183-21261205 TCCTGGATGAAGAGGGGGCACGG + Intergenic
1106282359 13:28286921-28286943 GCCAGGATGAGAAGTAGGTAGGG - Intronic
1107435197 13:40375612-40375634 TCCTGGAGGAGGAGTCTGTATGG - Intergenic
1108759977 13:53551445-53551467 AACTAGATGAGGAGTGGGGAAGG + Intergenic
1108960179 13:56217254-56217276 TCTAGGAGGAGGAGTAGGGGTGG - Intergenic
1110370063 13:74729853-74729875 TGCTGGATGTGGAGTCTGGATGG + Intergenic
1110660455 13:78054691-78054713 TCCTTGCTTAGGAGTAGGCAAGG - Intergenic
1111017830 13:82404218-82404240 TCCTGTATAAGGTGTAAGGAAGG - Intergenic
1111829916 13:93315075-93315097 TGATGGATGAGAAGGAGGGAGGG + Intronic
1111963369 13:94835245-94835267 TCCTGAAGGAGGAGTGGGGATGG + Intergenic
1112258212 13:97853872-97853894 GTCTGGATGAGCAGGAGGGAGGG - Intergenic
1112328884 13:98462141-98462163 TCCGGGAGGAGGAGGAGGGTGGG - Intronic
1113326047 13:109282256-109282278 TCCTGGATGGGGACTGAGGAAGG + Intergenic
1113869155 13:113547480-113547502 TCCGAGATGAGGAGCAGGGCCGG - Intronic
1114655352 14:24312251-24312273 GCTTGGATGAGGGGTAGGAATGG + Intronic
1115045356 14:28986043-28986065 TTCTGGATGAGGTTTGGGGAGGG + Intergenic
1115645113 14:35363930-35363952 TCCAGGATGATGAGTCTGGATGG + Intergenic
1117957060 14:61130969-61130991 TCCTGGAGGAGGAGGGAGGAGGG - Intergenic
1118704081 14:68463856-68463878 TCCTGGGTGAGGAGGAGAGCAGG + Intronic
1118895919 14:69945375-69945397 ACTTGGATTAGGGGTAGGGATGG + Intronic
1119392280 14:74299102-74299124 TACTGAATGAGGGGTAGGGGAGG + Intronic
1119401388 14:74364962-74364984 TCATGGAAGAGGAGGAGGGAAGG + Intergenic
1119410189 14:74425740-74425762 TGCAGGATGAGGGGTAGGGAGGG + Intronic
1119929886 14:78535258-78535280 TCCTGGAGGGAGAGTGGGGAGGG + Intronic
1121388116 14:93548687-93548709 TCCTGAATGAGGAAGAGGAAAGG - Intronic
1121710235 14:96032198-96032220 ACCTGGTGGAGAAGTAGGGAGGG - Intergenic
1123666873 15:22614891-22614913 TCCTGGAGGAGGAGGTTGGAGGG + Intergenic
1123678179 15:22734107-22734129 TGCTGGATTAGCAGAAGGGATGG - Intergenic
1124143505 15:27098619-27098641 TCCTGGAATAGGTTTAGGGAAGG - Intronic
1124320713 15:28709464-28709486 TCCTGGAGGAGGAGGTTGGAGGG + Intronic
1124330374 15:28808374-28808396 TGCTGGATTAGCAGAAGGGATGG - Intergenic
1125796387 15:42406958-42406980 TCCTAGATGAGCAGCATGGAAGG + Intronic
1125900160 15:43338781-43338803 TCTTGGATGTGGGTTAGGGATGG + Intronic
1127975053 15:63990936-63990958 GCCAGGCAGAGGAGTAGGGAGGG - Intronic
1128035468 15:64521386-64521408 GGCTGGATATGGAGTAGGGAGGG + Intronic
1128234717 15:66059657-66059679 TGCTGGCTGAGGAGTGGAGAGGG + Intronic
1128370357 15:67035449-67035471 TCCTGGGTGTGGGGTGGGGAGGG + Intergenic
1129358817 15:75011714-75011736 GCCCAGATGAGGAGTAGAGAGGG + Intronic
1129525945 15:76214453-76214475 CCCTGGTTGAGAAGGAGGGATGG - Intronic
1130033906 15:80341013-80341035 GCCTGGATGGGGAGGAGGGCTGG - Intergenic
1131256113 15:90863484-90863506 TCCTGCTTCAGGAGGAGGGAGGG + Intergenic
1132318014 15:100904423-100904445 TCCTGGAGGAGCAGGAGAGAGGG - Intronic
1132332443 15:101022238-101022260 TACTGGATCAGGGGGAGGGAAGG - Intronic
1132503175 16:293599-293621 TCTTGGATGAAGAGGTGGGAGGG + Exonic
1133727005 16:8547228-8547250 TGGAGGATGAGGAGTAAGGAAGG + Intergenic
1133849469 16:9488495-9488517 TCCTAGATTAGGACTAGAGAGGG + Intergenic
1134027578 16:10966041-10966063 TGCTGGGGGAGAAGTAGGGAGGG - Intronic
1135128267 16:19829625-19829647 TCCTGGCTGAGCAATAGGCATGG - Intronic
1135171309 16:20186519-20186541 GTCTGGATGAGAGGTAGGGAGGG - Intergenic
1136066830 16:27765104-27765126 TCCAGGGTGTGGAGTGGGGAAGG + Intronic
1136229219 16:28877114-28877136 TCCTGGAGCAGGGGTGGGGAGGG + Intergenic
1136760213 16:32726788-32726810 TCCTGGATGATGAGCACGGGCGG + Intergenic
1136807891 16:33143598-33143620 TCCTGGATGATGAGCACGGGCGG - Intergenic
1137977199 16:53041954-53041976 GCCTGGAGGAGCAGGAGGGATGG - Intergenic
1139431323 16:66912429-66912451 ATCTGGAGGAGGAGGAGGGATGG + Exonic
1139505870 16:67397850-67397872 TCATGGATGAGGAGAAGTGATGG + Intronic
1139845066 16:69914999-69915021 CCCAGGAGGAGGAGAAGGGAAGG + Intronic
1140201716 16:72900243-72900265 TCCTGGGTGAGGAGCAGGGAAGG + Intronic
1140307175 16:73814018-73814040 TCCTACATGATGATTAGGGAAGG - Intergenic
1141158907 16:81616336-81616358 TCCTGGCCGAGGTGTGGGGAGGG + Intronic
1203062367 16_KI270728v1_random:987110-987132 TCCTGGATGATGAGCACGGGCGG + Intergenic
1142608712 17:1096445-1096467 TCCTAGCTGAGGGGTGGGGAGGG + Intronic
1143091199 17:4450022-4450044 TCCAGGAGGAGGAGGAGAGAAGG - Intronic
1143360273 17:6363804-6363826 ACCTGGCTGAGGGGTAGGCAGGG - Intergenic
1143374937 17:6461859-6461881 TCCTGGAGGAGGAGGAGGGAGGG - Intronic
1145024514 17:19457943-19457965 TCATGGATTAGGAAAAGGGAGGG - Intergenic
1147189848 17:38731984-38732006 TTCTGGAAGAAGAGTAGAGAGGG - Intronic
1147309753 17:39588326-39588348 TCTTTGAAGAGGGGTAGGGAAGG - Intergenic
1147464169 17:40597941-40597963 TCCAGGCTGGGGAGTAGAGAAGG + Intergenic
1148139486 17:45317905-45317927 TCGGGGGTGGGGAGTAGGGAAGG + Intergenic
1148188607 17:45662848-45662870 TGCTGGATGAAGAGAAGGGAAGG + Intergenic
1148733065 17:49849623-49849645 TCCTGGAACAGGGGTAGGGGTGG - Intergenic
1148773689 17:50081289-50081311 TCCTGGATTGGGAGTGGGGTGGG - Exonic
1149621774 17:58050646-58050668 TCCTGGAGGCGGAGGAGGGCTGG + Intergenic
1150461918 17:65360760-65360782 TCCTGGTTGAGAAGTAATGAGGG - Intergenic
1150901423 17:69282300-69282322 TCCTGGGTGAGCAGTGGAGAAGG - Intronic
1150946700 17:69754431-69754453 TATTGGATCAGGAGAAGGGAGGG - Intergenic
1151341968 17:73477343-73477365 TCCTGGAGGAGCAGCAGGGCCGG + Intronic
1151550883 17:74821909-74821931 TCCTGGATGAGGGGAAGGGACGG - Intronic
1151745369 17:76009002-76009024 GCCTGGATGAGGAGGTGGGCCGG - Exonic
1151980905 17:77507877-77507899 CCAAGGAAGAGGAGTAGGGAAGG - Intergenic
1152238249 17:79149446-79149468 TCCTGGGGGAGGAGCAGGGCTGG + Intronic
1154031224 18:10755984-10756006 TGGAGGATGAGGAGGAGGGATGG + Intronic
1154031240 18:10756043-10756065 TGCAGGATGAAGAGGAGGGATGG + Intronic
1154031259 18:10756122-10756144 TGGAGGATGAGGAGGAGGGATGG + Intronic
1154173143 18:12064896-12064918 CCCTGGAGGTGGAGTACGGACGG + Intergenic
1155813279 18:30267697-30267719 TCCAGGAAGAGGAATAGGGAGGG + Intergenic
1157310493 18:46549089-46549111 TCCTGGAGGAGGAAGAGGCAGGG - Intronic
1157873273 18:51249403-51249425 TCAAGGATGTGGTGTAGGGAGGG + Intergenic
1158559168 18:58499282-58499304 TCCAGCAGGAGGGGTAGGGAGGG + Intronic
1158581423 18:58687299-58687321 TTCTGGATGTGGAGTGTGGAGGG + Intronic
1158720329 18:59918775-59918797 TACTGGCTGAGGAGTGAGGAGGG + Intergenic
1160202034 18:76803963-76803985 TCCTGGAAGAGGAGGCGGGCTGG + Intronic
1160760667 19:782534-782556 TCCTCGAGGAGGACAAGGGAGGG + Intergenic
1160971089 19:1768069-1768091 TCCTGGAGGAGGTGCAGGGCTGG + Intronic
1161242329 19:3229323-3229345 GTCTGGATGGGGGGTAGGGATGG - Intronic
1161804079 19:6432222-6432244 ACCTGGCTGAGGATGAGGGAGGG - Intronic
1162003527 19:7763338-7763360 TCCTGGGTAAGGGGAAGGGATGG + Intronic
1162880564 19:13655854-13655876 AGCTGAATGAGGAGTTGGGAGGG + Intergenic
1163528365 19:17835054-17835076 TCCTGGAGGTGGAGGAGGGAGGG - Intronic
1164447928 19:28333598-28333620 TGCTGGTAGAGAAGTAGGGAAGG - Intergenic
1165176579 19:33934871-33934893 TCAGGGGTGAGGGGTAGGGAAGG - Intergenic
1165766864 19:38356983-38357005 TCCTGGTTGAGGAGTAGCAGTGG + Intronic
1165942634 19:39422879-39422901 TCCAGGACGTGGAGTGGGGAAGG - Exonic
1166878059 19:45910070-45910092 GACTGGATAAGGAGGAGGGAAGG + Intergenic
1166980194 19:46627570-46627592 TCCTGCATCAGGAGCAGGTAGGG + Intergenic
1167622915 19:50568785-50568807 TCCTGGATGAAGGGGAGGGGAGG + Intergenic
1168048324 19:53810057-53810079 TCCTGGACGAGGGGGAGGGCGGG - Exonic
1168231145 19:55032395-55032417 TCCTGGAAGAGGAGCAGGGCTGG + Exonic
1168258755 19:55181188-55181210 TATTGGATTGGGAGTAGGGATGG - Intergenic
925348782 2:3187628-3187650 AGGTGGATGAGGAGTGGGGAGGG - Intergenic
925727008 2:6882987-6883009 TCCAGGACAAGGAGTGGGGATGG + Intronic
925860016 2:8165562-8165584 CCCTGCATGAGGAGAAAGGAAGG + Intergenic
926309865 2:11667761-11667783 CCGTGGATGTGGAGTATGGAGGG - Intronic
927576449 2:24205572-24205594 TACTGGATGCAGAGGAGGGAAGG - Intronic
928202346 2:29256246-29256268 TCCTGGGTAAGGAGTTGGGGTGG + Intronic
928226891 2:29457355-29457377 GCCTCGGTTAGGAGTAGGGAGGG + Intronic
928236509 2:29546521-29546543 TGCTGGAGGAGGAGGACGGAAGG + Intronic
928437374 2:31263616-31263638 TCCTGGAGGAGGAGCAGACAGGG - Intronic
929438832 2:41949568-41949590 TCCTGTGTGTGGAGTGGGGAGGG - Intronic
929581923 2:43086836-43086858 TCCTGGAAGGAGAGCAGGGAGGG - Intergenic
930834934 2:55783150-55783172 GCCAGGATGAGGAATAGGGTAGG + Intergenic
930877229 2:56232732-56232754 ACCTGGATGTGGAGTGGTGAGGG - Intronic
932128724 2:69168589-69168611 TCCTGGGGCAGGGGTAGGGAAGG - Intronic
932751943 2:74376761-74376783 CGCTGCATGAGGAGTAGGAAAGG + Exonic
936820205 2:116510868-116510890 GCCTGGATGTGGAGTGGAGAGGG + Intergenic
936907286 2:117551574-117551596 TCATGCAGGAGGACTAGGGAGGG + Intergenic
938026615 2:127954918-127954940 TGCTGGAGGAGAATTAGGGAAGG + Intronic
938856253 2:135314537-135314559 ACATGGATGAGGATTAGGTAAGG + Intronic
940791136 2:158031487-158031509 CCCTGGAGGAGGCTTAGGGATGG + Intronic
940850271 2:158681850-158681872 TCCTGGATTAGGAATGGGGTAGG + Intronic
941407849 2:165114041-165114063 ACCTGGAAGTGGAGTGGGGAAGG - Intronic
942373421 2:175310699-175310721 TCCTGGATAAGGAAGAGGAAAGG + Intergenic
942447250 2:176086154-176086176 TCCGGGCTGCGGAGCAGGGAGGG - Intergenic
943610770 2:190031238-190031260 TACAGGATGTGGAGTAGGGAAGG + Intronic
946032717 2:216717791-216717813 TCCTGAAGGAGGAATGGGGAGGG + Intergenic
946750400 2:222889644-222889666 ACCTAGATGAGAAGTATGGAAGG + Intronic
947185985 2:227456196-227456218 GCCTGGCTGAGAAATAGGGATGG + Intergenic
947439336 2:230104734-230104756 TTTTGGATGAGGTGTAAGGAAGG + Intergenic
947581044 2:231318792-231318814 TCCTGGAACAGGAGTAGGTCAGG - Intronic
947860937 2:233356648-233356670 TTCTGGTTGAGGAGGAGTGATGG + Intronic
947983743 2:234431210-234431232 TCCTACATGAGGACTAGGGCAGG + Intergenic
948570716 2:238915547-238915569 TCATGGAAGATGAGTGGGGAAGG + Intergenic
948947206 2:241226871-241226893 GGCTGGAGGAGGAGGAGGGAGGG - Intergenic
1168881446 20:1209550-1209572 TGCTGGACAAGGAGTTGGGATGG + Intergenic
1169219295 20:3812137-3812159 TCATGGAGGATGAGCAGGGATGG + Intergenic
1169823044 20:9735138-9735160 TCCAGGATGTGGTGCAGGGAGGG + Intronic
1170648321 20:18216237-18216259 CTCTGCTTGAGGAGTAGGGAGGG - Intergenic
1170781376 20:19428641-19428663 TCCCCGATGAGGATTAAGGATGG - Intronic
1171954953 20:31454599-31454621 TCCTGGATGGGGATGTGGGAGGG + Intergenic
1172011068 20:31845776-31845798 CCAGGGATGAGGAGTTGGGAAGG + Intergenic
1172273248 20:33666480-33666502 TCCTGGTTGTGGAGAGGGGAGGG - Exonic
1172644081 20:36459085-36459107 TCCAGGCTGGGGATTAGGGAGGG + Intronic
1173205653 20:40991196-40991218 TCCTGGTTGAGGAGTTGGTGGGG - Intergenic
1173847414 20:46196936-46196958 TCCTGGGTGAGGAGTGGGCAGGG + Intronic
1174761414 20:53210403-53210425 GGCTGGATGAGGAGTTGGGAGGG + Intronic
1175379822 20:58554995-58555017 CCCTTCATGGGGAGTAGGGAAGG + Intergenic
1175741847 20:61425258-61425280 TCCGGGAACAGGAGCAGGGAGGG + Intronic
1176043310 20:63079608-63079630 TCCTGGAGGTGGAGTGTGGAGGG + Intergenic
1176117739 20:63440329-63440351 GCCTGGATGAGGGGAAGCGAAGG + Intronic
1176126779 20:63479070-63479092 TCCTGGATGTGGGGTGGGGAGGG - Intergenic
1177412579 21:20749349-20749371 TGGTGGATGAGGGGTGGGGAGGG + Intergenic
1178403810 21:32308806-32308828 TCCAGGAGGAGGACTAGGGCTGG + Intronic
1178768944 21:35484283-35484305 TTATGGAGGAGTAGTAGGGAGGG - Intronic
1178787358 21:35666256-35666278 TCCTGGATGAACACTAGGGAGGG - Intronic
1179210395 21:39320053-39320075 TCCTGGGTGTGGAGCAGGGAGGG - Intronic
1179673212 21:42964223-42964245 GCTTGGATGAGGAGTGGGGTAGG - Intergenic
1179948559 21:44697037-44697059 TGCTGGATGGGCAGGAGGGAGGG - Intronic
1179948569 21:44697078-44697100 TGCTGGATGGGCAGGAGGGAGGG - Intronic
1180371663 22:12043710-12043732 TTCTGTATGAGGTGTAAGGAAGG - Intergenic
1181582083 22:23834120-23834142 GCCTGGAAGAGGAGTGGGGAGGG - Exonic
1181851673 22:25754136-25754158 CTCTGGAGGAGGAGTAGGGTGGG + Intronic
1181936100 22:26440054-26440076 TCCTGGAAGAGGAGCTGGGATGG - Intronic
1182065806 22:27430933-27430955 TCTTGGCTGAGGAGGAGGGCTGG + Intergenic
1182075016 22:27489597-27489619 TCCTAGATGAGTAATAGTGAAGG + Intergenic
1182311401 22:29411099-29411121 TCCTGGATAAGGAAGAGGAAAGG + Intronic
1182920265 22:34072806-34072828 TGCTGGATGTGGAGGAGAGATGG + Intergenic
1183709507 22:39494612-39494634 TACTGGCTGAGGAAAAGGGAAGG + Intergenic
1183820423 22:40341570-40341592 TCCTGGAAAAGAAGTAGGGGAGG - Intergenic
1184661346 22:45967026-45967048 CCCTGGGTGAGGGGCAGGGATGG + Intronic
949118714 3:359647-359669 ACTTGGATCAGGAGTGGGGAAGG + Intronic
950825059 3:15809964-15809986 TTGTGGATGAGGAGGTGGGAGGG - Intronic
951569244 3:24044646-24044668 TCCTGGAGCAGGAGCAGGGCAGG + Intergenic
952488831 3:33845545-33845567 TGCTGGATTAGCAGAAGGGATGG - Exonic
953769539 3:45768773-45768795 TCAAGGATAGGGAGTAGGGAGGG - Intronic
954439539 3:50514208-50514230 TTCTGGAGGTGGAGTAGAGAAGG + Intergenic
954582858 3:51712452-51712474 ACCTGGGGGAGGAGTAGAGAAGG - Exonic
954841749 3:53517429-53517451 TCCTGTCTGAAGGGTAGGGAAGG - Intronic
956009520 3:64816003-64816025 TGCGGGATGAGGAGCAGAGATGG - Intergenic
957687528 3:83521801-83521823 ACTTGGATGGGGGGTAGGGATGG - Intergenic
958774738 3:98468415-98468437 TTCTGGATGAGTAGTGGTGATGG - Intergenic
960052593 3:113252504-113252526 TCCTGGGAGGAGAGTAGGGAGGG + Intronic
961554376 3:127688228-127688250 TGCTGGAGGAGGAGAAGGCAGGG + Intergenic
961610465 3:128133150-128133172 TTCTGCATGAGGAAAAGGGAGGG + Intronic
961642420 3:128372969-128372991 TCCTGTCTGAGGAGGAGGCAGGG + Intronic
962743183 3:138378136-138378158 CCCTGGGTGAGGAGTAAGAAGGG - Intronic
962911622 3:139856210-139856232 TCCTGGGTGTGGAGCAGAGAGGG + Intergenic
962962766 3:140326303-140326325 TTCTGGATGTGGAGTTGGGGAGG + Intronic
963793086 3:149604370-149604392 CTCTGGATGATGAGTAGAGATGG - Intronic
964414537 3:156433486-156433508 TCCTGGAGGAAGAGTAGTAAAGG + Intronic
965481910 3:169229182-169229204 TCCTGTATAAGGAGTTGGTAAGG - Intronic
966323896 3:178732944-178732966 TCTGGGATGAGGAGCAGTGATGG + Intronic
967187736 3:186959913-186959935 TCCTGGGTGCTGAGTGGGGATGG + Intronic
967306688 3:188066448-188066470 TTCTGGATGAGAACTGGGGAAGG + Intergenic
968081263 3:195848147-195848169 CCCTGGATGTGGAGGAGGGAGGG + Intergenic
968955719 4:3717982-3718004 TCCTGGATGGGGAGGTGGGGAGG - Intergenic
969115778 4:4869860-4869882 TCCTGAAAGAGTAGAAGGGAAGG + Intergenic
969370157 4:6726929-6726951 TCCTGGGGGAGGAGGAGAGAAGG + Intergenic
969502208 4:7559945-7559967 TTCTGGTTGGGGAGCAGGGAGGG + Intronic
974373305 4:61044844-61044866 TACTGGATGAGGAGTAGAGAGGG + Intergenic
975976542 4:80103622-80103644 TCCTTCACCAGGAGTAGGGATGG + Intronic
976666159 4:87594906-87594928 TTCTGGAGGTGGAGGAGGGAGGG + Intergenic
977713173 4:100150484-100150506 TCCTGGTTGAAGTGGAGGGAAGG + Intergenic
977764277 4:100778266-100778288 GCCTGGATGTGGAGCAGAGAGGG + Intronic
978589039 4:110304155-110304177 TCCTTGAGCAGGAGGAGGGAAGG + Intergenic
979505003 4:121485532-121485554 GCTTGGATGTGGAGTAGAGAGGG + Intergenic
981900991 4:149863030-149863052 TACTGGATGAGGAGAATTGAAGG + Intergenic
982888228 4:160811228-160811250 TGCAGGATGAAGAGTAGGCAAGG - Intergenic
985676189 5:1232411-1232433 TCCTGGATGAGAGGTGGGGCGGG + Intronic
986172558 5:5326229-5326251 TGCTGGAGGAGGAGCAGGGCTGG + Intergenic
986291868 5:6406610-6406632 TCCTTGCTGAGGAGTGGGGGGGG - Intergenic
987669637 5:20990367-20990389 GCCTGGAGGTAGAGTAGGGAGGG - Intergenic
988646938 5:33105209-33105231 GCCTGGATGTGGAGAAGAGATGG + Intergenic
989003788 5:36787815-36787837 GCCTGGATAAGGAGTATGCATGG + Intergenic
990052761 5:51528271-51528293 TAGGGGGTGAGGAGTAGGGAGGG + Intergenic
992077620 5:73205681-73205703 TCCTTGGTGAGGGGTAAGGAAGG - Intergenic
993727787 5:91388365-91388387 TACTGGAGCAGGAGTAGGAAGGG - Intergenic
994986664 5:106941880-106941902 TCCAGGAGGTGGAGTAGGGAAGG - Intergenic
996402294 5:123075520-123075542 TCCTGGAAGTACAGTAGGGAGGG + Intergenic
997429833 5:133830008-133830030 GCCTGGATGAGGATGAGGGGTGG + Intergenic
997595067 5:135101790-135101812 TCCTGGAGAAGGAGCAGTGAGGG + Intronic
999096026 5:148978978-148979000 TCCTGGATGAGGAGGAGGCAGGG + Intronic
999512410 5:152266474-152266496 GCCTAGATGAGGGGAAGGGATGG + Intergenic
999775930 5:154813204-154813226 CCCTTGAGGAGGAGAAGGGAGGG + Intronic
1000719884 5:164693368-164693390 CCCTGGCTGATGAGGAGGGATGG - Intergenic
1002053573 5:176585712-176585734 TTCTGGGTCAGGAGCAGGGAAGG + Intronic
1002382577 5:178840912-178840934 ACCTGGAGGAGGAGAAGGAAAGG + Intergenic
1002907583 6:1463368-1463390 TCCTGGATCAGGGCAAGGGACGG - Intergenic
1003860906 6:10320958-10320980 TCCTTCAAGAGGAGTAGGAAGGG - Intergenic
1004075691 6:12342235-12342257 TGCTGGAGGAGGAGTGGAGAAGG - Intergenic
1005430690 6:25753706-25753728 TCCTGGGCCAGGAGTAGGGTTGG + Intergenic
1006149711 6:31980381-31980403 TAATGGATGAGGAGGAGAGATGG + Intronic
1006429019 6:33983812-33983834 TCCTGGCTCAGCAGTAGGGTAGG + Intergenic
1006452806 6:34114812-34114834 TCCTGGATGGGGAGGTGTGATGG - Intronic
1007094138 6:39203115-39203137 TCCTGGACAAGCAGTAGAGAAGG + Intronic
1007653051 6:43434923-43434945 TGCTGGCTGAGAAGGAGGGAGGG + Intronic
1007690086 6:43695297-43695319 TCCTGGGTGAGGTGGAAGGAAGG - Intergenic
1010055885 6:71563315-71563337 TCCAGGTTGTGGTGTAGGGAGGG + Intergenic
1012050420 6:94335168-94335190 GTCTGGAGGAGAAGTAGGGATGG + Intergenic
1014432928 6:121390607-121390629 TACGGGATGTGGAGAAGGGAGGG - Intergenic
1014818986 6:125964851-125964873 GCCTGGATCAGCAGTAGGAATGG + Intronic
1016122162 6:140357605-140357627 TCCTGGAGGAGGATGTGGGAGGG - Intergenic
1016923420 6:149317761-149317783 TCCTGGCTGAGGGGGAGGGGAGG - Intronic
1017059623 6:150469975-150469997 TCCTGGAAGAGGTGTGTGGATGG - Intergenic
1017074803 6:150607757-150607779 TTCTTGATGAGGAATAGCGAGGG + Intronic
1017247465 6:152241800-152241822 TCCTTGACGAGGACAAGGGAGGG + Intronic
1017374405 6:153751128-153751150 TCCTGGAAGAGGAGGAATGAAGG + Intergenic
1018390325 6:163336588-163336610 TCAGGGTTGAGAAGTAGGGAAGG - Intergenic
1019265599 7:115871-115893 TGCTGGATGAGGGATATGGACGG + Intergenic
1019703202 7:2484447-2484469 TTATGGATGAGGAGTAAGGGCGG - Intergenic
1020092891 7:5351180-5351202 TTCTGGGTGGGGAGGAGGGAGGG + Intronic
1020441910 7:8226245-8226267 TGGTGGATGAGGAGTGGGGAAGG - Intronic
1020718827 7:11715779-11715801 TCAGGGATGAGGATTAAGGAGGG - Intronic
1022095815 7:27140593-27140615 TCCCGGGTGAAGAGTGGGGAAGG + Intronic
1022140829 7:27491886-27491908 ACCTGGAGGAGGAGTAGGAGAGG - Intergenic
1022191191 7:28018214-28018236 TCCTGGAGGAGGAGTCGGCCAGG + Intronic
1022266015 7:28755549-28755571 TGGAGGATTAGGAGTAGGGAGGG + Intronic
1022467979 7:30664041-30664063 CCCTGGATGAAAAGTAGGGTTGG - Intronic
1023035817 7:36130681-36130703 TCCTGGATGCAGAGTAGGAAGGG + Intergenic
1023451074 7:40286094-40286116 TAATAGATGAGGAGCAGGGATGG - Intronic
1023843866 7:44110489-44110511 ACCAGGCTGAGGAGTGGGGATGG - Intronic
1023932391 7:44713714-44713736 CCCTGGATGAAGGGTGGGGAGGG - Intergenic
1024393191 7:48838139-48838161 TCCTTGTTGGGGAGTAAGGATGG + Intergenic
1025805939 7:64835051-64835073 TGCTGGGTGAGGAGTGGGCAGGG + Intergenic
1026477165 7:70746730-70746752 GCCTTGATGAGGAGTTGGGAGGG + Intronic
1028608753 7:92684465-92684487 TCCTGGATGGAGGGTAGGGAAGG + Intronic
1028682420 7:93551685-93551707 TCCTGGATGGAGAGGATGGAAGG + Intronic
1029139431 7:98400241-98400263 TCAGGGAAGAGGAGAAGGGACGG + Intronic
1031354496 7:120774754-120774776 TCCAGGATGTGGTGAAGGGAGGG - Intergenic
1032134800 7:129266300-129266322 TAGTGGATGAGAAGGAGGGAGGG + Intronic
1032298285 7:130662575-130662597 AGCTGGATGTGGAGTGGGGAAGG - Intronic
1033214135 7:139482000-139482022 TCCTGGATAAGGAGACTGGAGGG - Intronic
1034471477 7:151256906-151256928 TCCTTGGTGTGGAGGAGGGACGG - Intronic
1034819573 7:154204323-154204345 TCCTGGATGGGAAGTGGGGAGGG + Intronic
1035312422 7:157977873-157977895 TCGTGGCTGAGGAGGAGGGAAGG + Intronic
1036057431 8:5272105-5272127 TGCTGGATGACCAGTAGAGATGG - Intergenic
1036693198 8:10957684-10957706 TCCTGGATGGCCAGGAGGGATGG - Intronic
1038379334 8:27077601-27077623 TCCCGGATGAGAAGGTGGGAGGG + Intergenic
1039384887 8:37126713-37126735 TCCAGGCTGTGGAGCAGGGAGGG - Intergenic
1040436646 8:47397919-47397941 TCCTGGAGAAGAGGTAGGGAAGG + Intronic
1041705086 8:60838137-60838159 TCATGGATGAGGAGGATGAAGGG + Exonic
1044413370 8:91909747-91909769 TGCTGGAAGAGGAGGAGGAAGGG + Intergenic
1044780021 8:95734459-95734481 TGGTGGATGAGGAGCAGGGATGG + Intergenic
1045040998 8:98224545-98224567 ACGTGGATGTGAAGTAGGGAGGG - Intronic
1045055602 8:98365407-98365429 TCCTTGATGAAGAGAAGGGAGGG + Intergenic
1046018895 8:108639794-108639816 TCCTCGATCGGGAATAGGGAAGG + Intronic
1047304760 8:123643684-123643706 TCCAGGCTGAGGAGCAGGGCTGG + Intergenic
1047487993 8:125350141-125350163 TCCTGGAAGAGAACGAGGGAGGG + Intronic
1049471356 8:142776380-142776402 TGCTAGAGAAGGAGTAGGGATGG + Intronic
1049612773 8:143563088-143563110 TCCTGGATCTGGGGTAGGGTGGG + Intergenic
1051061393 9:13049207-13049229 TCCTGGATAAGGAGAAGGAAAGG + Intergenic
1052348405 9:27433634-27433656 TCCTGGAAGAGAAGCAGCGAAGG + Intronic
1055522100 9:77091746-77091768 TACTGGTAGAAGAGTAGGGAAGG + Intergenic
1055736551 9:79336722-79336744 TGCTGGATGTGGAGCAGAGAGGG + Intergenic
1056019799 9:82430115-82430137 TGCTGGAAGAGGAGTGGGGGAGG + Intergenic
1056791747 9:89630236-89630258 TTCTGGAAAAGGAGGAGGGATGG - Intergenic
1056842924 9:90013345-90013367 TCGTGGAGTAGGAGTAGGAAGGG + Intergenic
1056928023 9:90851218-90851240 TCTTGCATGGGGAATAGGGAGGG - Intronic
1057072039 9:92106915-92106937 TGCTGGAAGAGGAGGAGGGGAGG - Intronic
1058635770 9:107037026-107037048 TCATGGATAAGAAGTAGGGGAGG + Intergenic
1060201210 9:121652542-121652564 CCCTGGCTGAGTAGGAGGGAGGG + Intronic
1060204067 9:121671932-121671954 GACTGGATGAGTAGGAGGGAAGG + Intronic
1060205972 9:121683076-121683098 TCCTGGAAGGGAAGGAGGGAAGG + Intronic
1061551078 9:131335027-131335049 ACCTGGAGAAGGAGTAGGGGTGG - Intergenic
1062370390 9:136235798-136235820 TCTTGGATGTGGAGAAGAGACGG - Intronic
1187294543 X:17986121-17986143 TTCTGCATTAGGACTAGGGAAGG - Intergenic
1187305119 X:18088009-18088031 TCTTGGATGAGGAATATAGATGG - Intergenic
1192209041 X:69115793-69115815 CCTTGGATGAGGAGTAGGTTGGG - Intergenic
1194449246 X:94022832-94022854 TCCTGGAAGGAGAGTGGGGAGGG + Intergenic
1194483451 X:94456122-94456144 TTCTAGATCAGGACTAGGGAAGG + Intergenic
1195617337 X:106922643-106922665 GCCTGGGTGAGGAGCAGGGAGGG + Intronic
1195751494 X:108164827-108164849 TCCTGGCCGTGGAGTGGGGAAGG + Intronic
1195993492 X:110707614-110707636 TCTTGCATGAGGTGTAAGGAAGG - Intronic
1198494523 X:137178059-137178081 TCACTCATGAGGAGTAGGGATGG + Intergenic
1199078375 X:143549528-143549550 TCCTCCATGAGGAGCTGGGAGGG + Intergenic
1199320592 X:146433547-146433569 TGCTGGTGAAGGAGTAGGGATGG + Intergenic
1199600687 X:149539789-149539811 TCCTGGAGGAGGAGCAGGGCGGG - Intergenic
1199679250 X:150214223-150214245 TCCTGGAAGAGGGTCAGGGAAGG + Intergenic
1200000610 X:153058041-153058063 TCCTGCGTGAGGAGGAGGAATGG + Exonic
1200038474 X:153348245-153348267 ATCTGGATGTGGGGTAGGGAGGG + Exonic
1200068712 X:153517587-153517609 AGCTGGGTGAGGAGGAGGGAGGG - Intergenic