ID: 1083822999

View in Genome Browser
Species Human (GRCh38)
Location 11:65183030-65183052
Sequence GGGACTCCATGTCCCTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083822994_1083822999 -3 Left 1083822994 11:65183010-65183032 CCTGGATGAGGAGTAGGGATGGG 0: 1
1: 0
2: 2
3: 31
4: 313
Right 1083822999 11:65183030-65183052 GGGACTCCATGTCCCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1083822987_1083822999 24 Left 1083822987 11:65182983-65183005 CCTGGGTGGGACTCGGCTAAGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1083822999 11:65183030-65183052 GGGACTCCATGTCCCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1083822986_1083822999 28 Left 1083822986 11:65182979-65183001 CCATCCTGGGTGGGACTCGGCTA 0: 1
1: 0
2: 3
3: 7
4: 101
Right 1083822999 11:65183030-65183052 GGGACTCCATGTCCCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 174
1083822990_1083822999 3 Left 1083822990 11:65183004-65183026 CCAGATCCTGGATGAGGAGTAGG 0: 1
1: 0
2: 1
3: 9
4: 170
Right 1083822999 11:65183030-65183052 GGGACTCCATGTCCCTGGTGGGG 0: 1
1: 0
2: 0
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083822999 Original CRISPR GGGACTCCATGTCCCTGGTG GGG Intronic
900311672 1:2036350-2036372 AGGCCACCATGTCCCTGGAGTGG - Intergenic
901322583 1:8348760-8348782 GGAACTCAATGTTCCTTGTGTGG - Intergenic
901526718 1:9827730-9827752 GGGAACTCATGTCCCCGGTGAGG - Intergenic
902820144 1:18938677-18938699 GGGAGTCTCAGTCCCTGGTGTGG - Intronic
903945335 1:26959397-26959419 GAGACTCCCTGTCCCTATTGTGG + Intronic
905850988 1:41274762-41274784 GGGACTCCATCTGGCTGCTGCGG + Intergenic
907399069 1:54213314-54213336 GGGACACCAGATCCCTGGTTTGG + Intronic
907716768 1:56933346-56933368 GGGACTCCATTTCCTTGGCAGGG + Exonic
912679491 1:111720138-111720160 CAGACTCAATGTCCCTAGTGGGG + Intronic
917980279 1:180264961-180264983 GGGATGCTGTGTCCCTGGTGGGG + Intronic
920257086 1:204662943-204662965 GGGCCTCCATTTCCCTTCTGAGG - Intronic
924515270 1:244760544-244760566 GGGAAGCCAGGGCCCTGGTGAGG + Intergenic
1062947788 10:1474295-1474317 GGGACGGCATGGCCCTGGGGAGG + Intronic
1063137896 10:3233150-3233172 GGGGCTCCAGGTGCCTGATGAGG - Intergenic
1064030492 10:11879976-11879998 GGGGCTGCCTGTTCCTGGTGGGG - Intergenic
1064428439 10:15250999-15251021 GGGACTCCATCTTCCTGGGCTGG - Intronic
1066597981 10:37073749-37073771 GGGGATCCATGTCCCTCTTGTGG - Intergenic
1072971629 10:100022361-100022383 GTCACTCAATGCCCCTGGTGGGG - Intergenic
1075521879 10:123148204-123148226 GTGCCTGCATGTCCCTGGCGCGG + Exonic
1076804935 10:132850574-132850596 GGGTCTCCAGGGCTCTGGTGTGG + Intronic
1076841601 10:133048630-133048652 GAGGCTCTGTGTCCCTGGTGGGG - Intergenic
1076859782 10:133135393-133135415 TGGTCTCCAGGTCCCTGTTGGGG + Intergenic
1077533498 11:3108085-3108107 GGGAGGGCATGTCCCTGCTGGGG - Intronic
1081875915 11:46408363-46408385 GGGAAACCATGTCGCTGCTGAGG + Intronic
1083159899 11:60848437-60848459 TGAACTCCATGTCCCCGGTATGG + Intronic
1083311499 11:61786164-61786186 GGCACCCCTGGTCCCTGGTGTGG - Exonic
1083822999 11:65183030-65183052 GGGACTCCATGTCCCTGGTGGGG + Intronic
1084084186 11:66847408-66847430 GAGACTCCATCTCCGGGGTGGGG + Intergenic
1084525501 11:69695264-69695286 TTAACTCCATGTCCGTGGTGTGG + Intergenic
1085351433 11:75800415-75800437 GGGCCTCCATGTACATGGTGTGG - Exonic
1090446405 11:126768380-126768402 GGCACTGCATGTCCCAGGTCTGG + Intronic
1091262435 11:134245281-134245303 GCACCTCCCTGTCCCTGGTGTGG - Intronic
1091584187 12:1806564-1806586 GCGACTCCTTGTCCCTGCTAGGG - Intronic
1093191117 12:16076550-16076572 GGCACTCTATGGCCCTGGTGGGG - Intergenic
1093535448 12:20217798-20217820 GGAAATCTATGTCCCTGGTGGGG + Intergenic
1093875563 12:24345392-24345414 TGGACTACAAGTCCCTGGAGAGG - Intergenic
1094094288 12:26686619-26686641 GGGACTCCATCTCTCTGTTGAGG + Exonic
1097244185 12:57597355-57597377 GGGCCTCCAAGTTCCTGGTTAGG + Intronic
1102683231 12:114704492-114704514 GGGACTCCAAGTTCCTGGCGTGG - Intergenic
1104066311 12:125310101-125310123 GGGACTCCATGGGCCTTGTGAGG - Intronic
1104359714 12:128121241-128121263 TGGACCCCATGTCACTGGTGAGG + Intergenic
1105294849 13:19078864-19078886 GGGACTACATTTCCCTGGGATGG - Intergenic
1105673059 13:22642186-22642208 GGGGCTGCATGTCCCTGGGCAGG - Intergenic
1106781815 13:33066542-33066564 GGGACTTCCTGGCCCTGGTGGGG + Intergenic
1113708888 13:112451634-112451656 GTGACTCCATGTCCCGGGACTGG + Intergenic
1118257024 14:64214372-64214394 TGGACTCCATCCCCCTGGAGTGG + Exonic
1118320362 14:64749076-64749098 GGGAGCCCCTGTCCCTGGAGCGG + Exonic
1118843406 14:69528631-69528653 AGGCCTGCATGGCCCTGGTGTGG - Exonic
1119956908 14:78808569-78808591 AGGAGGCCATGCCCCTGGTGAGG - Intronic
1120848611 14:89148441-89148463 GTGTCTCCATTTCCCTGGTGGGG + Intronic
1121605996 14:95240460-95240482 AGGACTCCATGGACCTGGAGGGG + Intronic
1122930659 14:104931777-104931799 GCGCCTCCAGGTCCCGGGTGCGG - Exonic
1123465989 15:20516289-20516311 TGGCCTCCATGTCCCTTTTGGGG + Intergenic
1123652125 15:22484750-22484772 TGGCCTCCATGTCCCTTTTGGGG - Intergenic
1123742545 15:23293610-23293632 TGGCCTCCATGTCCCTTTTGGGG - Intergenic
1123760780 15:23430876-23430898 TGGCCTCCATGTCCCTTTTGGGG + Intergenic
1124276713 15:28332265-28332287 TGGCCTCCATGTCCCTTTTGGGG + Intergenic
1124305987 15:28579341-28579363 TGGCCTCCATGTCCCTTTTGGGG - Intergenic
1126849466 15:52788633-52788655 GGGACTCCCTGTGCCTGGAAGGG - Intronic
1128818600 15:70631833-70631855 GGGACTCCCTGCCCCAGGTCCGG - Intergenic
1130055631 15:80523089-80523111 GGGGCTCCTTGTCCCTGGCATGG + Intronic
1130656386 15:85794624-85794646 GGGACTACGTGTCCCGGGAGGGG - Intronic
1132113010 15:99116010-99116032 TGGACTCCATGTCCCTGGGAAGG - Intronic
1132543154 16:520870-520892 GGGACTCCAACACCCTGGAGTGG + Exonic
1132598390 16:763305-763327 GGGTCTTCAGGTCCCAGGTGGGG + Intronic
1132661802 16:1064941-1064963 GGGGCTCCACGCCCCTGCTGCGG + Intergenic
1132743956 16:1429050-1429072 GGGAGCCCATGCCCCAGGTGAGG - Intergenic
1133047627 16:3097662-3097684 GGCACTCCATCGCCCTAGTGGGG - Intronic
1133172636 16:3991324-3991346 GGCACTGCGTGTCCCTGGAGAGG + Intronic
1134038656 16:11051197-11051219 GAGAATCCCTGTCCCTGCTGAGG + Intronic
1136374865 16:29859375-29859397 GGGCCTCCATCTCCCTGGGCAGG + Intronic
1138554247 16:57762758-57762780 GGGCCTCGAGGTCCCGGGTGGGG - Intronic
1140209858 16:72961341-72961363 GAGACCTCATGTCCCTGGGGAGG + Intronic
1143773298 17:9181811-9181833 GGGACTCCTGGTCCATGGTTTGG + Intronic
1146910362 17:36644587-36644609 GTGACTGCATGTGGCTGGTGGGG + Intergenic
1152041977 17:77909502-77909524 TGGACTCCAGTTCTCTGGTGGGG - Intergenic
1155226918 18:23737187-23737209 TGTACTCCATGTCCCTTCTGGGG + Intronic
1155381536 18:25227395-25227417 GGTACTTCTTGTCCCCGGTGTGG + Exonic
1156518339 18:37699788-37699810 GGGATATTATGTCCCTGGTGCGG + Intergenic
1159624060 18:70671061-70671083 TGGACTCTCTGTCCCTGCTGAGG + Intergenic
1160394175 18:78559702-78559724 GGGACTCCTTGCCCCTGGGCGGG + Intergenic
1161331577 19:3690953-3690975 GTGACCCCGTCTCCCTGGTGGGG + Intronic
1163006731 19:14401603-14401625 GGGACCCCAGGTACCAGGTGGGG - Intronic
1163234361 19:16022355-16022377 AGAACTCCATGTCCCTGGCTGGG - Intergenic
1163632060 19:18422545-18422567 GGGACACCAGGGCCCTGGAGAGG + Intronic
1163641820 19:18466399-18466421 TGGAGTCCATGTCCTTTGTGGGG - Intronic
1164254509 19:23515661-23515683 AGGACTCCTTGTACTTGGTGTGG + Intergenic
1164296155 19:23911846-23911868 AGGACTCCTTGTACTTGGTGTGG - Intergenic
1166283374 19:41809555-41809577 GGAACTCAGTGTCCCTGCTGTGG - Intronic
925006941 2:450824-450846 GGGACTCCATGTGCTGGCTGGGG + Intergenic
925142549 2:1559937-1559959 TGGACTCCATGTCCATGGCCTGG + Intergenic
926018473 2:9474631-9474653 GGGACTCCATCACCCAGGTACGG + Exonic
926144348 2:10387500-10387522 GGGCCACACTGTCCCTGGTGAGG - Intronic
927516322 2:23673945-23673967 GGGACTGAAGGTCACTGGTGTGG - Intronic
928440511 2:31288193-31288215 CTGACTCCAAGTCCCTGCTGTGG - Intergenic
933713490 2:85344214-85344236 GGGGCTGCACGTCCCGGGTGAGG - Intronic
934970131 2:98756534-98756556 AGGACTCCTTGTACTTGGTGTGG - Intergenic
935114268 2:100121085-100121107 GGGAGGGCAGGTCCCTGGTGAGG + Intronic
936528297 2:113257333-113257355 GGGGCTCTGTTTCCCTGGTGGGG + Intronic
936884569 2:117294634-117294656 GGGACTCTATGACCTTGGTGAGG - Intergenic
937919124 2:127118011-127118033 GGGATTCCCTTTGCCTGGTGAGG + Intergenic
937976704 2:127586869-127586891 GGAGCTCCCTGCCCCTGGTGGGG + Intronic
938079920 2:128364508-128364530 GGGACTCCAGCTCCCTGGCCGGG - Intergenic
938541723 2:132288571-132288593 GTAGCTCCAGGTCCCTGGTGAGG + Intergenic
940337895 2:152547628-152547650 GGGCCACCAAGTCCCAGGTGTGG + Intronic
946688325 2:222293156-222293178 TGAACTCCAAGTCCCAGGTGAGG + Intronic
948087966 2:235266650-235266672 GTGACTCCTTGTCCCTTGTTGGG + Intergenic
948928005 2:241111741-241111763 CAGACTCCATGTCACTGGAGTGG - Intronic
949017096 2:241719664-241719686 GAGACTCCAGCTCCCTGTTGGGG + Intronic
1169916285 20:10686868-10686890 GCGACTCCATGTATCTGCTGAGG - Intergenic
1171870598 20:30521447-30521469 GTAGCTCCAGGTCCCTGGTGAGG + Intergenic
1172785159 20:37463942-37463964 GGGAGTCCATGGCCCTGGACTGG + Intergenic
1173510242 20:43622173-43622195 GAGAAGCCATGTCCCTAGTGAGG - Intronic
1174394386 20:50237651-50237673 GGCTCTCCCTGTCCCCGGTGTGG + Intergenic
1175685446 20:61024796-61024818 GGGCCTGCATGTCCCTGTGGCGG - Intergenic
1175987477 20:62771167-62771189 GTGACTCGCTGTCCCTGGGGAGG - Intergenic
1176728543 21:10465811-10465833 AGAACCCCAGGTCCCTGGTGTGG + Intergenic
1177872606 21:26591513-26591535 GGGAATCCAGGGTCCTGGTGAGG - Intergenic
1180109323 21:45640723-45640745 GGGCCTCCATCCCCCTGCTGGGG - Intergenic
1180183180 21:46127030-46127052 GGGAGCCCATGTCCCGGATGTGG + Intronic
1182556675 22:31133108-31133130 GGGACGACATGCCACTGGTGCGG + Exonic
1182920047 22:34070944-34070966 GGGCCTCCTAGTCCATGGTGAGG - Intergenic
1183258398 22:36777928-36777950 GGGGCTGCATGTCTCTGGTCGGG - Intergenic
1183315199 22:37133252-37133274 GGGAAACCATGTCCCTGTAGAGG - Intronic
1184391984 22:44207930-44207952 TGGGCTCCAGGTACCTGGTGTGG - Exonic
1184414836 22:44346240-44346262 GGGACACCAGCTTCCTGGTGTGG - Intergenic
1184640733 22:45868628-45868650 TGGGCTCCCTGCCCCTGGTGTGG + Intergenic
1185373937 22:50473659-50473681 AGAACTCCAGGTCCTTGGTGGGG + Intronic
950139802 3:10607633-10607655 TGGATGCCATGTCCCTAGTGTGG - Intronic
950490750 3:13303491-13303513 GTGCCTCCATTTCCCAGGTGTGG + Intergenic
953818443 3:46182998-46183020 GGGACTCCCTGACACTGGTAGGG + Intronic
953931456 3:47007873-47007895 GGGACACCACGTGCATGGTGTGG + Exonic
955750883 3:62184625-62184647 GGGACTGCCTGGCCCTGGTGGGG - Intronic
958516378 3:95121376-95121398 AGGACTCCATTGCTCTGGTGGGG - Intergenic
960987637 3:123291051-123291073 GGGCCTACAAGTCCCTGGTATGG - Intronic
961691058 3:128669887-128669909 AGGACTCCTTGTACTTGGTGTGG - Intronic
966537665 3:181052420-181052442 AGGACTGCATGTCTCTGGTCGGG - Intergenic
968459766 4:718724-718746 GGGGCTCGATGTCACAGGTGTGG + Intronic
970845446 4:20532570-20532592 GTTACTCCATGCCCCTGGGGAGG + Intronic
972814552 4:42629541-42629563 GGCTCTCCATGTCACTGCTGAGG - Intronic
973700950 4:53536586-53536608 GGGCCTCTGTGTCCCTGGTTTGG + Intronic
974079550 4:57197947-57197969 GAGACTGCATGTCCGTGATGGGG + Intergenic
978546368 4:109875870-109875892 GAGACTCCCTATCCATGGTGAGG + Intergenic
979763516 4:124436452-124436474 GGGACTCAATGTCCAGGTTGTGG + Intergenic
982702513 4:158672177-158672199 GGGACTCCAAGTCCCAGCCGGGG - Exonic
983186403 4:164705969-164705991 GGGAGAGCAGGTCCCTGGTGAGG + Intergenic
985487095 5:158060-158082 TGGACTCCACTTGCCTGGTGTGG - Intronic
985677330 5:1238787-1238809 GGGACTGGATGTCCCTGCTCTGG + Intronic
985846575 5:2354070-2354092 GGGACTCCAGCCCCTTGGTGTGG + Intergenic
986050806 5:4088449-4088471 AGGACTCCATGTCCTAGGTAAGG + Intergenic
994041826 5:95267674-95267696 GAGACTTCATGTCCTTGGTCTGG - Intronic
999134288 5:149307501-149307523 AGGCCTCCATGCACCTGGTGAGG + Exonic
999889253 5:155958946-155958968 GGGACTGAAGGTCCCTGGTATGG - Intronic
1000137102 5:158363568-158363590 GGGACTCAATGTCCCTGTGATGG - Intergenic
1001411998 5:171518809-171518831 GGGCCACCATCTCCATGGTGAGG + Intergenic
1001576580 5:172768704-172768726 GGGACTCCATGCTCCTTGAGAGG - Exonic
1003903073 6:10673192-10673214 CTGACTGCATGCCCCTGGTGGGG + Intronic
1006844287 6:37051713-37051735 TGGGCTCCATGTGCCTGCTGAGG - Intergenic
1007092080 6:39190796-39190818 GGGACGCCTGGCCCCTGGTGGGG - Exonic
1017239205 6:152148166-152148188 TGGACTCCATCCCCCTGGAGTGG - Exonic
1020639227 7:10734915-10734937 GGTAGTCCGTGTGCCTGGTGAGG - Intergenic
1022155866 7:27661904-27661926 GGGGCCTCATGTCCCTCGTGCGG + Intronic
1023951214 7:44847805-44847827 GGGGCGCCATGTCCCAGCTGCGG - Intronic
1029058696 7:97774228-97774250 GGGACCCTAAATCCCTGGTGAGG - Intergenic
1030560029 7:111073683-111073705 GGGATTCCATTTCCCTTGAGAGG + Intronic
1033306706 7:140230737-140230759 GGGACACCCTTTCCCTGGCGGGG - Intergenic
1034785985 7:153925973-153925995 GGGACTGCAGGTACCTGCTGTGG - Intronic
1037935976 8:22915327-22915349 AGAACTTCATGGCCCTGGTGTGG - Intronic
1039794392 8:40899958-40899980 GGATCTCCATGTCTTTGGTGAGG + Intergenic
1042857052 8:73277998-73278020 GGGACCACATGCCCATGGTGAGG + Intergenic
1047760346 8:127949784-127949806 GGGCCTCCCTGTCCCTGGGTGGG - Intergenic
1049683602 8:143930557-143930579 GGGTCTCCATGGCCCTCGTCTGG - Intronic
1049780386 8:144426102-144426124 GGGGCTGCAGGACCCTGGTGAGG + Intronic
1054577751 9:66878681-66878703 AGGAATCCCTGTGCCTGGTGTGG - Intronic
1055145003 9:72922664-72922686 GGGAATCCATGTGCCTGTTGAGG - Intronic
1059367377 9:113797134-113797156 GTGCCTGGATGTCCCTGGTGGGG + Intergenic
1060052817 9:120389254-120389276 GGGACTGCATGTTCCTGGATGGG + Exonic
1060191795 9:121598561-121598583 GGGCCTCCCTGCCCCTGCTGGGG + Intronic
1185513117 X:677749-677771 GGTACCCCATGTCCCTGCAGAGG - Intergenic
1186885235 X:13906396-13906418 AGGACACCATGTCCCTATTGGGG + Intronic
1187443393 X:19339971-19339993 GTGACTGCATATGCCTGGTGGGG - Intergenic
1192209127 X:69116341-69116363 GTGCCTGCATGTCCATGGTGAGG - Intergenic
1193154522 X:78158505-78158527 GGAAGTCCTTCTCCCTGGTGGGG - Intergenic
1194920856 X:99761847-99761869 GGTTCTCCAAGTCCTTGGTGGGG - Intergenic
1199595942 X:149505754-149505776 GGGGCTCTATGTCCCTGCTTTGG + Intronic
1200061819 X:153487196-153487218 AGGACTTCAGGACCCTGGTGAGG - Intronic
1200133403 X:153863367-153863389 GTGACTTCAGGTCCCTGGAGAGG - Exonic
1201175836 Y:11307858-11307880 GGGACCCCAGGTCCCCGATGCGG + Intergenic