ID: 1083823271

View in Genome Browser
Species Human (GRCh38)
Location 11:65184243-65184265
Sequence CTGTCCTTGCCCGCCTTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083823262_1083823271 15 Left 1083823262 11:65184205-65184227 CCCTCCTTCTGCCTGGTTAGAGA 0: 1
1: 0
2: 0
3: 20
4: 249
Right 1083823271 11:65184243-65184265 CTGTCCTTGCCCGCCTTGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1083823266_1083823271 -9 Left 1083823266 11:65184229-65184251 CCCCTTACCCTACTCTGTCCTTG 0: 1
1: 0
2: 3
3: 36
4: 290
Right 1083823271 11:65184243-65184265 CTGTCCTTGCCCGCCTTGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1083823263_1083823271 14 Left 1083823263 11:65184206-65184228 CCTCCTTCTGCCTGGTTAGAGAG 0: 1
1: 0
2: 1
3: 16
4: 221
Right 1083823271 11:65184243-65184265 CTGTCCTTGCCCGCCTTGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1083823264_1083823271 11 Left 1083823264 11:65184209-65184231 CCTTCTGCCTGGTTAGAGAGCCC 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1083823271 11:65184243-65184265 CTGTCCTTGCCCGCCTTGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1083823265_1083823271 4 Left 1083823265 11:65184216-65184238 CCTGGTTAGAGAGCCCCTTACCC 0: 1
1: 0
2: 1
3: 5
4: 83
Right 1083823271 11:65184243-65184265 CTGTCCTTGCCCGCCTTGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1083823267_1083823271 -10 Left 1083823267 11:65184230-65184252 CCCTTACCCTACTCTGTCCTTGC 0: 1
1: 0
2: 1
3: 19
4: 323
Right 1083823271 11:65184243-65184265 CTGTCCTTGCCCGCCTTGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083823271 Original CRISPR CTGTCCTTGCCCGCCTTGCG CGG Intronic