ID: 1083823701

View in Genome Browser
Species Human (GRCh38)
Location 11:65186626-65186648
Sequence CTGGTGAACTGGACAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 3, 3: 48, 4: 341}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083823701_1083823705 -3 Left 1083823701 11:65186626-65186648 CCATCCTCTGTCCAGTTCACCAG 0: 1
1: 0
2: 3
3: 48
4: 341
Right 1083823705 11:65186646-65186668 CAGCCTCAGATTTCATCTCCTGG 0: 1
1: 0
2: 1
3: 27
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083823701 Original CRISPR CTGGTGAACTGGACAGAGGA TGG (reversed) Intronic
900226169 1:1534555-1534577 CTGGTGACCCTGAGAGAGGAGGG + Exonic
900824398 1:4914367-4914389 CTGGTGAGCAGGCCACAGGAAGG + Intergenic
900943778 1:5817866-5817888 CTGTGGAGCTGGACAGATGAGGG - Intergenic
901733342 1:11296266-11296288 CTGGTGAAGTGGAAAGAGTTTGG + Intergenic
901872596 1:12146773-12146795 CTGGTGGACGGGACAGACGGTGG + Intergenic
901928551 1:12582762-12582784 CTGGTGAACGGGAGAGTGGACGG - Intronic
903127999 1:21260747-21260769 CTGGTGCATGGGACAGAGGCCGG + Intronic
903337290 1:22633618-22633640 CTGTTGAAGTGGGCAGATGAAGG - Intergenic
903546663 1:24128277-24128299 GTGCTGAATTGGACAGAGAATGG + Exonic
903872452 1:26446256-26446278 CTGCTGAGCTGGAGAGAGCAAGG - Intronic
904012160 1:27395916-27395938 CTGGGGAGCTGGACAGAGGGTGG + Intergenic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
905877069 1:41438764-41438786 CTGGTGATCAGGATATAGGAGGG - Intergenic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
907468152 1:54653197-54653219 CTGGTGATCTGGAGGGAGGCTGG - Exonic
907709045 1:56860863-56860885 TTGGAGAACTGGCCAGAGGCAGG + Intronic
909119167 1:71579180-71579202 CAGGTGAAGTGGACAGAGCTGGG - Intronic
909364530 1:74803818-74803840 CTGGAGAGCTGGTCAGAGGCAGG + Intergenic
911153202 1:94615132-94615154 CTGGTGAGCTCTTCAGAGGAAGG - Intergenic
912798074 1:112704919-112704941 CGGGTGAGCTGGACTGAGGGAGG - Intronic
913273762 1:117118671-117118693 AGGGTGAACAGGACACAGGATGG + Exonic
913275357 1:117132440-117132462 CTGGAGCACTGGACTGGGGAGGG + Intergenic
913346170 1:117813308-117813330 CTGGTGAACTGTGTTGAGGATGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
915106072 1:153535862-153535884 CGGCTGAACTGGGCAGGGGATGG + Exonic
915405991 1:155660092-155660114 CTGGTTCAATGGACAGGGGAAGG + Exonic
915419154 1:155765885-155765907 CTGGTTCAATGGACAGGGGAAGG + Exonic
917087576 1:171319196-171319218 CTGGGGAGCTGGAAAGGGGATGG + Intronic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
918526737 1:185473085-185473107 CTGGTGAACTCGGCAGTGGTGGG - Intergenic
919062082 1:192646005-192646027 CTGGTGAAATGGAAAGAGCTAGG - Intronic
919748217 1:201021673-201021695 CTGGAGACCTGAACAGAGGTAGG + Intronic
920181996 1:204137794-204137816 CTGGGGAACTGGACTGGGGTGGG - Intronic
920676793 1:208043721-208043743 CTGGTGAGTTTGGCAGAGGAAGG - Intronic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
920971480 1:210746909-210746931 CTGCAGAATGGGACAGAGGAAGG + Intronic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
921768924 1:219010844-219010866 CTGGTGAACTTGACAGTCCAGGG - Intergenic
921834648 1:219765275-219765297 GTGGTGCATTGGACAGGGGAGGG + Intronic
921837812 1:219795716-219795738 GTGGTGAACTGGAGATAGGGTGG - Intronic
922367480 1:224879327-224879349 CTGATGAACCTCACAGAGGAAGG - Intergenic
922870790 1:228900356-228900378 CAGGAGAGCTGGCCAGAGGATGG - Intergenic
1062958705 10:1557285-1557307 CAGGTGCACTTGACAGAGGAGGG - Intronic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1064160257 10:12939261-12939283 CTGATGGACTGGACAGAAGTTGG - Intronic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1065158400 10:22894315-22894337 ATTGTGAACTGCACATAGGAGGG - Intergenic
1066662841 10:37753375-37753397 GGGGTGAACTGGACAGAAGGCGG - Intergenic
1066985997 10:42466873-42466895 CAGGTGAAAGGGAGAGAGGATGG + Intergenic
1069389376 10:67916666-67916688 CTTGTGAACTCGATAGAGCAAGG + Exonic
1070589862 10:77794173-77794195 CTGTTAGCCTGGACAGAGGAAGG - Intronic
1070825329 10:79387337-79387359 TGTGTGAACTGGACAGCGGAAGG + Intronic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1072577250 10:96711566-96711588 CTGTTGAAAAGGACAGAGGCAGG + Intronic
1073526267 10:104185040-104185062 CTGGTGAATGGGAGAGATGATGG - Exonic
1073735076 10:106336273-106336295 ATGGTGAGCTGGAAAGGGGATGG - Intergenic
1074139631 10:110660611-110660633 ATTGTGAACTGCACATAGGAGGG + Intronic
1076196476 10:128522100-128522122 CAGGTGACCTGGACAGAGAAGGG - Intergenic
1076667719 10:132102561-132102583 CAGGTGAACTGGGAAGAGGCTGG - Intergenic
1077025410 11:437839-437861 CTGGGGTTCTGGGCAGAGGAGGG - Intronic
1077087342 11:760546-760568 GTGTTGATCAGGACAGAGGAAGG - Intronic
1077375795 11:2204580-2204602 CGGCTGAACTGCACAGAGGGGGG + Intergenic
1077646488 11:3929973-3929995 CCGGACAACTGGACAGAGAATGG + Intronic
1077773820 11:5249683-5249705 CTGGTGACCAGGACAAGGGAGGG - Intronic
1077774323 11:5254607-5254629 CTGGTGACCAGGACAAGGGAGGG - Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1081739224 11:45426466-45426488 AAAGTGAACTGGGCAGAGGAGGG + Intergenic
1082771928 11:57214450-57214472 CTGCTCAACAGGACAAAGGATGG + Intergenic
1082848379 11:57744216-57744238 GTGGTGGACTGGACAGCAGAGGG - Exonic
1083206147 11:61150490-61150512 CTGGGCAAATGGGCAGAGGAGGG - Intronic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084951023 11:72665509-72665531 CTGGTGTCCTGGGCAGTGGAAGG - Intronic
1085125687 11:74000701-74000723 CTGGTGAGGTGGACAGGGAAGGG + Exonic
1085205018 11:74726494-74726516 ATGGGGTCCTGGACAGAGGAAGG + Intronic
1085286595 11:75366477-75366499 CTGGTGGACTGAACAAAGGAGGG + Intergenic
1085760794 11:79239539-79239561 ATGGTGCACTGGACAGAGCATGG - Intronic
1085979918 11:81712452-81712474 ATGGTGAACTGTATAGAGCATGG + Intergenic
1086430111 11:86728722-86728744 CTGGTAAGCTAGACAGAGTAAGG - Intergenic
1087390729 11:97529538-97529560 CTGGTGCACTCGACAGGGGCAGG - Intergenic
1088396911 11:109379130-109379152 CAGGTAAGCTGGACAGAGGATGG + Intergenic
1088972701 11:114787605-114787627 CTGGGGAGTTGGAGAGAGGAGGG + Intergenic
1088999363 11:115038198-115038220 CTGGGCAACTGGAAAGAGGAAGG - Intergenic
1089069553 11:115688933-115688955 CTGCTGAAATGGACTGAAGAAGG + Intergenic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1090224785 11:125063424-125063446 CTGGTGAGCGGGGCAGGGGAGGG + Exonic
1090414842 11:126533904-126533926 CTGGTGTTCAGGACAGAGGGTGG - Intronic
1090421790 11:126580395-126580417 CTGGTGAACCGGACAGCAGGAGG + Intronic
1090528090 11:127559544-127559566 TTGGTGAACTTGACAAAAGATGG + Intergenic
1091379404 12:46262-46284 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1091638969 12:2219881-2219903 CTGGTGACCTAGGCAGTGGAGGG + Intronic
1091798905 12:3312440-3312462 CTGCTCACCTGGACACAGGAAGG + Intergenic
1093494812 12:19744099-19744121 TTGGTGGACTGGAGAGATGAAGG - Intergenic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1093751791 12:22808083-22808105 ATGGGGAACTGGAAACAGGATGG + Intergenic
1096181678 12:49554603-49554625 CTGGTGAAGTGGGCAGAGGCTGG + Intronic
1096919888 12:55072457-55072479 CAGGGGAGCTGGACAGGGGATGG + Intergenic
1097017429 12:55997381-55997403 CTGCTGAGCTGGGCAGCGGAGGG + Intronic
1097192805 12:57227426-57227448 CGGGTCAACTGAAAAGAGGAGGG + Intergenic
1097282110 12:57851530-57851552 TTGGGGAACTGGGCAGATGATGG - Intergenic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098205517 12:68105243-68105265 CTGGGTAACAGGACAGAGAAGGG - Intergenic
1100927771 12:99569313-99569335 CTGGGGAACTGGACAGAAATTGG + Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101941903 12:109105650-109105672 CTGGACAACTGGGCAGATGATGG - Intronic
1102585271 12:113918576-113918598 CTGGTCTAGAGGACAGAGGATGG + Intronic
1103148915 12:118619966-118619988 ATGGTGAACTGAAAAGAAGATGG - Intergenic
1103447639 12:121004559-121004581 CTGGTGACCTGGACCAAGGGAGG - Intronic
1105418574 13:20232973-20232995 CTGGTGCACTGTCCCGAGGAAGG - Intergenic
1106138491 13:26991903-26991925 TTGGTCAACTGGACAGAGGTTGG - Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108314794 13:49226511-49226533 CTGGTGTACACTACAGAGGAGGG + Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1113819754 13:113204595-113204617 CGGGTGACCTGACCAGAGGAGGG + Intronic
1114320015 14:21539439-21539461 GTGGTGAAGTGGAGAGGGGAGGG + Intergenic
1115404669 14:33001216-33001238 CTGGTGAAATGGACAGAAAATGG + Intronic
1117119678 14:52553538-52553560 GTGGAGAACTGGAGACAGGAGGG - Exonic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1118988986 14:70781032-70781054 CTGGGGAAAAGCACAGAGGATGG - Intronic
1120806129 14:88752897-88752919 ATGGCGAACTGGAGAGGGGATGG - Intronic
1121172709 14:91868157-91868179 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1121921731 14:97888319-97888341 GTGGAGAACTGTTCAGAGGATGG - Intergenic
1122276556 14:100593741-100593763 ATGGTGGTCTGGACAGAGGTGGG - Intergenic
1122723174 14:103733679-103733701 CAGGTGATCTGGACACAGGAAGG - Intergenic
1123766485 15:23483735-23483757 CTGGCTAACTTGACAGATGAGGG - Intergenic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1130803432 15:87291956-87291978 ATGGGGAGCTGGACAGGGGATGG + Intergenic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1131735128 15:95323848-95323870 CTGGTGAACTAAACAGGAGATGG - Intergenic
1132523059 16:400292-400314 CTGGTGAGCTGGGCAGACGGGGG + Exonic
1132607263 16:798801-798823 CTGCTGAAGTGGATCGAGGACGG - Exonic
1132655691 16:1040908-1040930 CTGGGGGTCTGGGCAGAGGAGGG - Intergenic
1134625762 16:15721356-15721378 CTGGTGAATAGCACAGAGGGTGG + Intronic
1134826117 16:17285678-17285700 CTGGTGAAGGAGACAGAGGCAGG - Intronic
1135007344 16:18838141-18838163 CTGGTGGACTGGACAGCAGGAGG - Exonic
1137035934 16:35569905-35569927 CTGGTGAGCTGTACTGAGGCAGG + Intergenic
1137036429 16:35573564-35573586 CTGGTGGGCTGGATAAAGGAGGG + Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1138293438 16:55867471-55867493 CTGGAGAACTGGAAAATGGAGGG - Intronic
1139963020 16:70728727-70728749 CTGGAGAACTGGGCTGAGGTGGG - Intronic
1140048539 16:71459066-71459088 CTGTAGAACTGGACTGAGGATGG - Intronic
1140856436 16:78981856-78981878 CTGGCAAAGTGGACACAGGAAGG - Intronic
1140894947 16:79316746-79316768 CTGGAGATAGGGACAGAGGAAGG + Intergenic
1141107128 16:81242886-81242908 GTCGTGAACTGCACATAGGAGGG + Intronic
1141488169 16:84354903-84354925 CTGGGGATCAGGACAGATGAGGG - Intergenic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1141883403 16:86874794-86874816 CTGGAGAACTGGACGTAGAAAGG + Intergenic
1142087345 16:88190701-88190723 TTGGAGAACTCAACAGAGGAGGG + Intergenic
1142121556 16:88388960-88388982 CTGGTGTAAGGCACAGAGGATGG - Intergenic
1143488172 17:7266874-7266896 TTGGTTAGCTGGATAGAGGAAGG - Intergenic
1143502408 17:7347074-7347096 CTGGTGGAATGGCCAGGGGAAGG + Exonic
1143962734 17:10734025-10734047 CTGGTGTGCTGGACAGAGGGAGG - Intergenic
1144251363 17:13419930-13419952 CTGATGAACTGGCCAAAGGAGGG - Intergenic
1146313608 17:31790013-31790035 CTGGTAAGGTGGGCAGAGGAGGG - Intergenic
1147410114 17:40244638-40244660 TTGGTGTATTGGACAGAGAAGGG + Intronic
1148701832 17:49592149-49592171 TTGATGAATTGGACAGAGTAAGG - Intergenic
1149242040 17:54662485-54662507 CTGGAGAAATGGACAGAAGTAGG - Intergenic
1149666393 17:58367691-58367713 CTGGGTGACTGGACAGAGGGTGG + Intronic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1150398048 17:64836573-64836595 TTGGGGAGCTGGACAGGGGATGG + Intergenic
1150426108 17:65078355-65078377 CTGAGGACCTGGACAGGGGAGGG + Intergenic
1150583140 17:66493572-66493594 CTTGTGAACGGGAGACAGGAAGG - Intronic
1151397788 17:73835855-73835877 GTGGGGGACTGGACAGAGAAGGG + Intergenic
1151563403 17:74883177-74883199 CTTGTGGACTGGTCAGGGGATGG - Intronic
1151604010 17:75124916-75124938 CTGGTGGAAGGGACAGAGCAAGG + Intronic
1152420306 17:80189220-80189242 CAGGTGCACTGGAGAGAGGGGGG + Intronic
1152690526 17:81715857-81715879 CTGGTGTCCTGGGCATAGGAGGG + Intronic
1153047653 18:871425-871447 CTGGGAAACTGAACAGAGGGAGG - Intergenic
1153369192 18:4294832-4294854 ATGGGAAACTGGACAGGGGATGG + Intronic
1155101339 18:22613318-22613340 TTGGTGCACTGCACAGAGCAAGG + Intergenic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1156458895 18:37310311-37310333 CTGCTGAACTGGATAGAGGGAGG - Intronic
1160222202 18:76985583-76985605 CTGCTGAGCCGGACAGAGGGAGG + Intronic
1161070278 19:2256404-2256426 CTTGTGGACAGGACGGAGGATGG + Exonic
1161271976 19:3394805-3394827 ATGGTGAACTGAACATAGGAGGG + Intronic
1162893014 19:13747710-13747732 GTAGTGGGCTGGACAGAGGATGG + Intronic
1164072965 19:21786152-21786174 CTGGTGGACTGAAGAAAGGAGGG + Intergenic
1164155279 19:22592081-22592103 ATTGTGAACTGCACATAGGAGGG - Intergenic
1164781631 19:30897584-30897606 CTGGGGAGATGGCCAGAGGAGGG - Intergenic
1165159590 19:33808206-33808228 CTGGTCCTCTGGATAGAGGAAGG - Intronic
1166259135 19:41625912-41625934 ATAGTGAACTGGACAGTGGTGGG + Exonic
1166794395 19:45417599-45417621 CTGGAGAACTGGGTAGAGGTTGG + Intronic
1167148442 19:47695752-47695774 CAGGTGATATGGACACAGGACGG + Intronic
1167418142 19:49387981-49388003 TTGGTGAAATGGGCTGAGGAAGG - Intergenic
1167435164 19:49474859-49474881 ATGGGGAGATGGACAGAGGAGGG + Intronic
1167808192 19:51804754-51804776 CTGGTGGACTGAACAAAGGGGGG + Intronic
1168075169 19:53977308-53977330 CTGCAGAACTGGACAGAGCTGGG + Intronic
1168326400 19:55540898-55540920 CTGGAGGAGTGGACAGATGAGGG - Exonic
1168368859 19:55814165-55814187 ATTGTGAACTGCACATAGGAGGG + Intronic
1168687733 19:58358536-58358558 CTGGTCCCCAGGACAGAGGAGGG - Exonic
927908073 2:26876234-26876256 CTGGTGAACAGAATGGAGGAAGG + Intronic
928429433 2:31205497-31205519 CTCCTGAAATGGAGAGAGGACGG + Exonic
928842806 2:35631196-35631218 ATGGTGAACTAGACCCAGGAAGG + Intergenic
929581133 2:43082396-43082418 CTGGTGAACAGGACAGCTAATGG + Intergenic
929780993 2:44956840-44956862 CAGGTGGTCTGGAAAGAGGATGG + Intergenic
931131465 2:59341159-59341181 CTGGAGATCTGGAAAGAGGGTGG + Intergenic
931467442 2:62503434-62503456 CTGGTGTACTGAACAGATCATGG + Intronic
932393707 2:71422532-71422554 GGGGTTAACTTGACAGAGGAGGG + Intronic
933113299 2:78432130-78432152 CTGGAGAACTGGTCTGGGGAAGG + Intergenic
933823651 2:86138836-86138858 CTGATGAACTAGAGACAGGAAGG - Exonic
933901505 2:86853620-86853642 TTGGTGTCCTGGAGAGAGGAAGG + Intronic
934907377 2:98217056-98217078 CTGGGGAGCTGGGCAGAGGGTGG + Intronic
935200191 2:100849749-100849771 CTGGAAAACTGGAGAGAGGTTGG + Intronic
935784262 2:106534568-106534590 CTGGTGAATTTGACAGAAGGGGG + Intergenic
936498295 2:113042487-113042509 CTGGTGAATAGGACGGGGGATGG - Intronic
936564362 2:113571665-113571687 CAGGAGAGCTGGACAGAGGAAGG + Intergenic
939441015 2:142249298-142249320 CTGCAGAACTACACAGAGGAGGG + Intergenic
940198569 2:151124452-151124474 CTTGAGAACTGGACAAAGCAAGG + Intergenic
941334981 2:164230819-164230841 CTGGTGAAATGGACAGGGAATGG + Intergenic
941687096 2:168457591-168457613 CTGATGAATTGGGCAGAGGAAGG - Intronic
945415095 2:209560914-209560936 ATGATAAATTGGACAGAGGACGG + Intronic
946359136 2:219208484-219208506 CTGGTGAGTTGGGCAGAGGTTGG + Exonic
946506942 2:220311961-220311983 GTGGAGGACTGGACAGAGGACGG - Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
948025504 2:234772957-234772979 ATTGTGAACTGCACACAGGAGGG + Intergenic
948386593 2:237584632-237584654 CAGGTGAGCTGGACTGGGGATGG - Intronic
948641595 2:239378903-239378925 CTGGGGAACTAGACAGAGCTTGG - Intronic
949050152 2:241893459-241893481 GTGGTCTCCTGGACAGAGGAGGG - Intergenic
1169029975 20:2399546-2399568 CTGTTCACCTGGGCAGAGGAGGG - Exonic
1169209730 20:3759322-3759344 ATGGTGGGCTAGACAGAGGAAGG - Intronic
1169674266 20:8135866-8135888 CTGGTGAGGTAGACAGTGGAAGG + Intronic
1170008750 20:11697596-11697618 CTGATGGGCTGGACAGAGTATGG - Intergenic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1171301442 20:24064360-24064382 ATTGTGAACTGCACAGGGGAGGG + Intergenic
1171433855 20:25104302-25104324 GTGGTGGAAAGGACAGAGGAGGG - Intergenic
1171780271 20:29411056-29411078 TGGGTGAACTCGATAGAGGAGGG + Intergenic
1171824235 20:29879320-29879342 TGGGTGAACTGGATAGAGGAGGG + Intergenic
1173550641 20:43930984-43931006 CTAGTGAAGGGGATAGAGGAGGG - Intronic
1173885762 20:46457636-46457658 ATGGCGAGCTGGACTGAGGATGG - Intergenic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1175272617 20:57745360-57745382 CTGGTGCAGTGCACAGAGGGAGG - Intergenic
1175597127 20:60244200-60244222 CAGGTGCACTGGATGGAGGATGG + Intergenic
1176118217 20:63442455-63442477 CTGGTGTACTTGGCAGAGAAGGG - Exonic
1176163770 20:63662361-63662383 CGGGGGTACTGGACAGAGGGAGG - Intronic
1177639049 21:23822462-23822484 CTTGTGAAGTGGAAAGAGAATGG + Intergenic
1178839325 21:36126239-36126261 TTGCTAAACTGGACAGAGAAGGG - Intergenic
1179991410 21:44949921-44949943 CTGGTGATCTGGCCAGCAGAGGG + Intronic
1181048845 22:20229233-20229255 CATGTGCACAGGACAGAGGAGGG - Intergenic
1183025911 22:35065927-35065949 CTGGGGAACTGGCCAGAGCAGGG - Intergenic
1184005654 22:41706556-41706578 CTGTTGAAGTGGACTGAGCATGG + Intronic
1184770553 22:46594471-46594493 CGGGAGCACTGGCCAGAGGAGGG + Intronic
1185332064 22:50256369-50256391 TTGGTGCACTGGCCAGAGGGAGG - Intronic
1185428140 22:50785241-50785263 CTGGTGGCCTGGACAGTGAAGGG + Intergenic
949802107 3:7915266-7915288 ATGGGGAGCTGGACAGGGGATGG - Intergenic
949916143 3:8966112-8966134 GTGATAAAATGGACAGAGGAGGG + Intergenic
951085056 3:18502597-18502619 CTTATGAACTGGACAGGGGGAGG - Intergenic
951731616 3:25816014-25816036 ATGGGGAGCTGGACAGGGGATGG - Intergenic
952958861 3:38577282-38577304 CTGGTGTGCTGGACAGAGCCCGG + Intronic
955910950 3:63859694-63859716 GCAGTGAACTAGACAGAGGAGGG - Intronic
956153709 3:66271328-66271350 CTGGTGTACTGGTTAGATGAGGG + Intronic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
959179752 3:102963201-102963223 CCGGTGATGTGGACAGAGCAAGG + Intergenic
959486634 3:106934500-106934522 GTGGGGAACTGGAAAGGGGATGG - Intergenic
963103259 3:141624875-141624897 CTGGTGATCTGGACTGTGGGTGG - Intergenic
963762202 3:149295276-149295298 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
964256988 3:154786618-154786640 CAGGTGAATGGGAGAGAGGAAGG + Intergenic
967099377 3:186203631-186203653 CTGCTGGACTGGATTGAGGAAGG + Intronic
967888343 3:194347818-194347840 GGGCTGAACTGGGCAGAGGATGG - Intronic
967888366 3:194347896-194347918 GGGCTGAACTGGGCAGAGGATGG - Intronic
967888422 3:194348075-194348097 GGGCTGAACTGGGCAGAGGATGG - Intronic
967888445 3:194348153-194348175 GGGCTGAACTGGGCAGAGGATGG - Intronic
968562584 4:1292416-1292438 CTGGTGAAGTGGGAAGAGAATGG + Intronic
968876546 4:3270644-3270666 CTGGAAAACTGGACAGAACATGG - Intronic
968984209 4:3866447-3866469 CTGGTGAGCTGGACAGGCAAGGG + Intergenic
969376038 4:6763813-6763835 TCAGTGAACTGCACAGAGGAAGG + Intergenic
970926289 4:21456262-21456284 TTGGTGAACTGGAAAGGGCAAGG - Intronic
971468658 4:26994361-26994383 CTGATGAAATGGACAGGGGCTGG - Intronic
972994239 4:44860285-44860307 CTGGTGACCAGGACACAGCAAGG - Intergenic
978760415 4:112351270-112351292 GCAGTGAACTGGACAGAGGAGGG + Intronic
979979463 4:127236881-127236903 CTGGTGAAATGGAGAATGGATGG - Intergenic
981945078 4:150332175-150332197 GTGGTGAAATGGACAGTGGTTGG - Intronic
982990140 4:162263471-162263493 CTGGTGGACTGAACAAAGGGGGG - Intergenic
983444881 4:167837206-167837228 CAGGTTAAATGGACAGGGGATGG - Intergenic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
983698669 4:170564926-170564948 ATGGTGAAATGGAAAGAGCATGG - Intergenic
983762135 4:171424319-171424341 CTGGTGTGCTGGACAGAGAGTGG + Intergenic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984551225 4:181161425-181161447 CTGGCAGCCTGGACAGAGGAAGG - Intergenic
984829308 4:183956963-183956985 GTGGTGTTCTGGACACAGGAAGG + Intronic
985699636 5:1362791-1362813 TTGCTGAACTAGAAAGAGGATGG - Intergenic
986305155 5:6509051-6509073 GTGGTGACCTTCACAGAGGAAGG - Intergenic
986768531 5:10950123-10950145 CACGTGGAATGGACAGAGGAAGG + Intergenic
987271584 5:16314736-16314758 ATGGGGACCTGGACAGGGGATGG - Intergenic
988816819 5:34842430-34842452 CTGGTGGACTGAACAAAGGAGGG + Intronic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992417825 5:76569096-76569118 CTAATGAACTAGATAGAGGAAGG - Intronic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
996629701 5:125612682-125612704 CTAGAGAACAGGAAAGAGGAAGG + Intergenic
996729710 5:126705282-126705304 TTGGTGAACTGAACTGAGGAAGG - Intergenic
997466501 5:134091448-134091470 ATTGTGAACTGGACATTGGAAGG + Intergenic
997656355 5:135557653-135557675 CTGCTGCAGTGGAGAGAGGATGG + Intergenic
999554172 5:152722501-152722523 CTGGTGAACTGGAAATTCGAGGG - Intergenic
1001937482 5:175715589-175715611 CAGGGGAACTGGAGAGAGCAGGG + Intergenic
1002459946 5:179368379-179368401 CTGGGGATGTGGACAGAGGAGGG - Intergenic
1002899577 6:1399605-1399627 CTGGGGACCTGGAGAGAGAATGG - Intergenic
1005303881 6:24495446-24495468 CTGGGGAACTGAGCACAGGAGGG - Intronic
1005974793 6:30789852-30789874 CTGGGGACCTTGCCAGAGGAAGG - Intergenic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1006506773 6:34494217-34494239 CTGGGGAACTGGGCAGAGCAGGG - Intronic
1006604864 6:35248989-35249011 CTGGTAAAATGGGCAGTGGAAGG - Exonic
1007287958 6:40761794-40761816 TGGGTGAACAGGACAGAGGGAGG + Intergenic
1009050935 6:58275793-58275815 CAGGCAAACTGGTCAGAGGAGGG + Intergenic
1009239489 6:61166591-61166613 CGGGCAAACTGGTCAGAGGAGGG - Intergenic
1010455283 6:76047604-76047626 AAGGTGAACTGGAGAGGGGAGGG - Intronic
1011466648 6:87664842-87664864 CTCGTGGACTGGTCAGAGGTAGG + Exonic
1011622757 6:89258016-89258038 CTTGTGAGGTGGGCAGAGGAGGG + Intronic
1011633236 6:89347441-89347463 CTGTTGAACTGAACTGAGTAGGG - Intronic
1011716511 6:90111239-90111261 GTGGTGGCCTGGACAGAAGATGG - Intronic
1013177650 6:107691088-107691110 CTGCTGAACTGGAGAGACGATGG + Intergenic
1013205594 6:107942390-107942412 CCAGGGAACTGGAAAGAGGAGGG - Intronic
1016695090 6:146984807-146984829 CTGGTGAGCTGGGTAGAGGTTGG - Intergenic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1018131036 6:160732800-160732822 CTGGTGCACTGGAGAGGGCATGG - Intronic
1018244983 6:161813982-161814004 CAGGTAAAATGGACAGAGGTGGG + Intronic
1019102342 6:169641420-169641442 CTGGCCAACTGAAAAGAGGAGGG - Intronic
1020009701 7:4801358-4801380 CTCCTGCACTGGGCAGAGGAAGG - Intronic
1020933281 7:14427441-14427463 CTGGGTAACTGGGCAGAGGTTGG - Intronic
1021041910 7:15872800-15872822 ATGGGGAGCTGGACAGAGGATGG - Intergenic
1021510139 7:21426180-21426202 TTGGTGAACTGGGAGGAGGAGGG + Intergenic
1022457673 7:30573175-30573197 ATAGTGGACTGGCCAGAGGAAGG + Intergenic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1024146411 7:46521982-46522004 GTGGTGACCTGAACAGAGGGTGG + Intergenic
1024256058 7:47540767-47540789 TTGGTGAACTGGCCAAAGGCTGG + Intronic
1026175372 7:67991887-67991909 CTGTTGATCTGGGCAGAGGCTGG - Intergenic
1027606988 7:80313048-80313070 CTGGTGGACTGAACAAAGGGGGG + Intergenic
1029235341 7:99111703-99111725 CTGCTGAACTGGGGAGTGGATGG - Intronic
1029411327 7:100413271-100413293 CTGGATAACTGGAAAGAGGGAGG - Intronic
1029667568 7:102005705-102005727 CAGGTGGAGTAGACAGAGGAGGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033969051 7:147015269-147015291 TTGGTAAAATGGACAGAGTAGGG + Intronic
1034239525 7:149599115-149599137 CTGGTGAACTGCAGAGCTGAGGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1037888580 8:22608670-22608692 CATGTGAACTGGAGAGAAGACGG - Intronic
1038068405 8:23986900-23986922 CTGATGCACAGGAGAGAGGAGGG + Intergenic
1038077386 8:24091605-24091627 CTGGTGAAGTGGAGTGAGCAAGG + Intergenic
1038406284 8:27325261-27325283 CAGGTGGAGTGGACAGAGGATGG + Intronic
1039718523 8:40136974-40136996 CTAGTGATCTGGATAGAGGTGGG - Intergenic
1041738771 8:61137762-61137784 CTGCTGAACTTGACAGGGCAAGG + Intronic
1042837397 8:73091088-73091110 ATGGTGAACAGGACAGATGCTGG - Intronic
1042883687 8:73523754-73523776 CTGATGAACTGGAAAGTGGGAGG + Intronic
1043211687 8:77527376-77527398 CTGGTGAAAAGGACAGTGGGGGG - Intergenic
1046904790 8:119560737-119560759 CTGATAAATTGGAAAGAGGATGG + Intronic
1048074990 8:131060505-131060527 ATGGAGAGCTAGACAGAGGATGG - Intergenic
1048706456 8:137158939-137158961 GTGGTAAACTGGAGAGAAGAAGG + Intergenic
1048872950 8:138813796-138813818 CTGGTGACCTGGAGAGAGGATGG - Intronic
1049104174 8:140601104-140601126 CTGGGGAACTTGAGAGTGGAGGG - Intronic
1049888061 9:41543-41565 CAGGAGAGCTGGACAGAGGAAGG - Intergenic
1051849071 9:21487808-21487830 CGGGTGATATGGACAGAGAATGG + Intergenic
1052344396 9:27394196-27394218 CTGCTGAACTGGACAGAAAGCGG + Intronic
1052527456 9:29636810-29636832 CTGGTGAACTGGGCAGTGGAGGG + Intergenic
1052969224 9:34366550-34366572 CTGGTGCTATGTACAGAGGACGG + Intergenic
1053206197 9:36188602-36188624 CTGGTGGACTGAACAAAGGTGGG - Intergenic
1053748971 9:41234899-41234921 TAGGTGAACTCGATAGAGGAGGG - Intergenic
1056162038 9:83906387-83906409 CTGGAGAACCTGCCAGAGGAGGG - Intronic
1056200891 9:84275393-84275415 TGGGTGGACTGGACAGAGTACGG + Intergenic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057569199 9:96190980-96191002 TTGGTGAGTTGGAGAGAGGAAGG - Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1060229953 9:121819029-121819051 TTGGGGGACTGGACAGAGGCTGG + Intergenic
1061558935 9:131390239-131390261 CTGTTGAACTGGGCAGAGAAGGG - Intergenic
1061921533 9:133785159-133785181 CTGGTGAAATGGAGAGGGGAAGG - Intronic
1062105419 9:134752474-134752496 CGGGCAGACTGGACAGAGGAGGG - Intronic
1062259849 9:135656072-135656094 CTGGGGAACTTGACAGAAGAGGG + Intergenic
1062367132 9:136216139-136216161 CTGCTGATCTGGACTAAGGAGGG + Intronic
1203377303 Un_KI270442v1:385765-385787 TGGGTGAACTCGATAGAGGAGGG + Intergenic
1203707786 Un_KI270742v1:68399-68421 CTGGGGATGCGGACAGAGGAGGG - Intergenic
1186305375 X:8251081-8251103 CTGGTAAACTGGAGACAGCATGG + Intergenic
1186501280 X:10052807-10052829 TTGGAGATCTGGACAAAGGAAGG - Intronic
1186964510 X:14772800-14772822 CTGGTGGCCTGGACTGAGGAGGG + Intergenic
1187831708 X:23389075-23389097 CTGGGGAATGGGACAGAGAATGG - Intronic
1190460967 X:50674901-50674923 GTGGTTAAGTGCACAGAGGACGG + Intronic
1190569375 X:51766173-51766195 CTGGGGAGCTGGAAAGGGGATGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191210545 X:57880417-57880439 GTGGACAACTGGACAGTGGAGGG + Intergenic
1191771482 X:64764430-64764452 CTTTTCAACTTGACAGAGGAAGG + Intergenic
1191882970 X:65860670-65860692 CTGGAGAAGTAGACAAAGGATGG + Intergenic
1195351430 X:104000181-104000203 CTGGTGAACTGCACATAAGAGGG - Intergenic
1196634822 X:117990306-117990328 CTGCTGAACTGAACTGAGTAAGG + Intronic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198122450 X:133607590-133607612 CTGGTCAAAGGGACAGAGGTTGG - Intronic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1198465683 X:136902744-136902766 GAAGTGAACTGGAAAGAGGATGG + Intergenic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1199656432 X:149999616-149999638 GTGCTGAACAGGTCAGAGGAAGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic