ID: 1083826896

View in Genome Browser
Species Human (GRCh38)
Location 11:65209044-65209066
Sequence TTGGGTAGAAAGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083826896_1083826903 19 Left 1083826896 11:65209044-65209066 CCCTGCCCCATCTTTCTACCCAA 0: 1
1: 0
2: 0
3: 44
4: 353
Right 1083826903 11:65209086-65209108 ACACTCATTTCTTTTTACTTTGG 0: 1
1: 0
2: 5
3: 47
4: 557
1083826896_1083826904 30 Left 1083826896 11:65209044-65209066 CCCTGCCCCATCTTTCTACCCAA 0: 1
1: 0
2: 0
3: 44
4: 353
Right 1083826904 11:65209097-65209119 TTTTTACTTTGGACTAATTGTGG 0: 1
1: 0
2: 2
3: 33
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083826896 Original CRISPR TTGGGTAGAAAGATGGGGCA GGG (reversed) Intronic
901089043 1:6629424-6629446 TGGGGAGGACAGATGGGGCAGGG - Intronic
901849634 1:12007309-12007331 GTGGGAAGAGAGATGGGGAAGGG - Intronic
902137277 1:14320191-14320213 TTTGGTAGAATGAGGAGGCAGGG + Intergenic
902156730 1:14493473-14493495 TTGGGGAGGAAGATGGGGTGGGG + Intergenic
903445412 1:23419413-23419435 TTGGGAGGAAAGATGGGGAAGGG - Intronic
904191106 1:28744521-28744543 TTGGGCAGAATGATGAGGAATGG + Intronic
904433860 1:30481533-30481555 TTGGGAAAAAAGCTGAGGCAGGG + Intergenic
905009291 1:34736357-34736379 TTGGGGAGAAAGCTGGGTGAGGG + Intronic
905290565 1:36919133-36919155 TGGGGTAGAAAAATGGGTAAGGG + Intronic
906241715 1:44246293-44246315 CTGGGCAGAAAAATGGGGGAAGG - Intronic
906245438 1:44270248-44270270 TTTGGGAGAAAGATGGGGTGTGG - Intronic
907814340 1:57903503-57903525 TTGGGGAGAAAGAAGGTGGAAGG - Intronic
907857620 1:58319122-58319144 GTGGGGAGAAAGAGGGGGCTGGG + Intronic
908116025 1:60941047-60941069 GGGGGTAGGAAGATGGGGGATGG + Intronic
912135223 1:106652898-106652920 TGGGGTAGGGAGATGGGGGAGGG - Intergenic
912775995 1:112506899-112506921 TTGGGTGGAAAGTGGGGGCTGGG - Intronic
914391993 1:147232313-147232335 TTGGGAAGAAAGCTGAGGCAGGG + Intronic
914460686 1:147880898-147880920 TTGTGTAGTAATATGGGGTAAGG + Intergenic
914706852 1:150177283-150177305 TTGGGTAGAAAGTTGTGTCAGGG - Intergenic
914902258 1:151717002-151717024 CTGGGGAGTAAGATGGGGGAAGG - Intronic
915033121 1:152901163-152901185 CTGTGTAGAAAAATGTGGCAAGG - Intergenic
915401261 1:155623633-155623655 TTGGGGAAAAAGCTGAGGCAGGG - Intergenic
916875023 1:168959883-168959905 GTGGGGAGAGAGATGGGGTAGGG - Intergenic
916906159 1:169286423-169286445 TTTGGAAGTAAGATGGGGTATGG - Intronic
917290188 1:173464268-173464290 TTGGGAAGAAAGCTGAGGCAGGG + Intergenic
918363321 1:183781034-183781056 TTGGCCAGAGGGATGGGGCAGGG + Intronic
919097150 1:193051250-193051272 CTGGTCAGAAAGATGGGGGAAGG + Intronic
920456845 1:206108104-206108126 TGTGGTCTAAAGATGGGGCAAGG + Intergenic
922550596 1:226491430-226491452 TAGGCAAGAAAGATGGGGAAAGG + Intergenic
922828298 1:228536849-228536871 TTGGGAAAAAAGCTGAGGCAGGG + Intergenic
923117677 1:230958698-230958720 TTGCTTAGATAGACGGGGCATGG + Intronic
924876091 1:248105925-248105947 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
1063450409 10:6146367-6146389 TGGGGTAGAGAGATGGGGGAGGG + Exonic
1065204064 10:23341733-23341755 CTGGGTAGAAAGATGGTGCCTGG - Intronic
1065477408 10:26155169-26155191 TAGAGTAGACAGATAGGGCAAGG + Intronic
1066341823 10:34541881-34541903 TTGGGTGGGAAGGTGGGACAGGG + Intronic
1067394617 10:45903046-45903068 GGGAGAAGAAAGATGGGGCAGGG + Intergenic
1067414783 10:46094970-46094992 TTGGGAGAAAAGCTGGGGCAGGG + Intergenic
1067616553 10:47762220-47762242 GTGGGGAGGAAGAGGGGGCAAGG + Intergenic
1067862940 10:49872177-49872199 GGGAGAAGAAAGATGGGGCAGGG + Intronic
1067878392 10:50024107-50024129 TTGGGTAGCTGGATGGGGAAAGG - Intergenic
1067878462 10:50024431-50024453 TTGGGTAGATGGAGGGGGGAAGG - Intergenic
1067893260 10:50153497-50153519 TTGGGTAGATGGAGGGGGGAAGG + Intergenic
1067893330 10:50153821-50153843 TTGGGTAGCTGGATGGGGAAAGG + Intergenic
1068356392 10:55915177-55915199 TTTGGTAGTAAGTTGTGGCAAGG - Intergenic
1071345024 10:84684464-84684486 TTGGGAAGAAAGCTGATGCAGGG + Intergenic
1071936494 10:90537312-90537334 TTGGGAAGACAGACGGGTCAAGG + Intergenic
1071954630 10:90744302-90744324 TAGGGTAGAAAGATGAGTAAGGG - Intronic
1072893045 10:99342043-99342065 TTGTGGAGAACGGTGGGGCAGGG - Intronic
1073575868 10:104622612-104622634 ATGGGTAGAAAGTGGGGGCTGGG - Intergenic
1073754837 10:106570665-106570687 TTAGGAAAAAAGATGGGGCTGGG - Intergenic
1073961447 10:108934699-108934721 TTGGGAGGTAAGCTGGGGCAGGG + Intergenic
1074251188 10:111749904-111749926 TGGGGTAGGAAGATGAGGAATGG + Intergenic
1074452222 10:113568453-113568475 ATGGGCAGAAAGATGAGGCCAGG + Intronic
1075303677 10:121348512-121348534 AGGGGAAGAAAGGTGGGGCAAGG - Intergenic
1076590263 10:131577908-131577930 CTGGGCAGATAAATGGGGCAGGG + Intergenic
1077289573 11:1782655-1782677 TTGGGTAGCAGGAAGGGGCAGGG - Intergenic
1077675411 11:4190216-4190238 TAGGGTAGAAATATGAGGAAGGG + Intergenic
1078618536 11:12886784-12886806 TTGTGAAGAAGGTTGGGGCATGG - Intronic
1079602871 11:22331029-22331051 TTGGGTAGAGAGATGGAGGCAGG - Intergenic
1080304365 11:30820542-30820564 TGGAGTAGGAAGATGGGGCTGGG + Intergenic
1080861154 11:36151306-36151328 TTGTGTAGTAAGATGGGCCAGGG + Intronic
1080881591 11:36326551-36326573 TTGGGTAAAAAGAGGGGAGAGGG - Intronic
1081183561 11:40014429-40014451 TTGGGTGGGGAGATGGGGGAGGG + Intergenic
1081703800 11:45168557-45168579 TTGTCTAGAAAGGTGGGGCTTGG + Intronic
1082767299 11:57180070-57180092 TTTGGGTGAAAGAAGGGGCAGGG + Intergenic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1084148064 11:67275477-67275499 TTGGGCAGGAAGAAGGGGAAGGG - Intronic
1084356513 11:68642132-68642154 TTGGGGAGAAGGGTCGGGCAGGG - Intergenic
1084867504 11:72071166-72071188 TTTGGCAGAAAGATGGGGTTTGG - Intronic
1084871990 11:72104723-72104745 TTGGATCAGAAGATGGGGCATGG - Intronic
1084958971 11:72706269-72706291 CTGGGTAGAAAGATGAAGGAGGG - Intronic
1084970863 11:72771391-72771413 CTGAGTCCAAAGATGGGGCAAGG - Intronic
1085026979 11:73242086-73242108 GTGTGTAGAGAGCTGGGGCAAGG + Intergenic
1088397284 11:109382634-109382656 TTGGGTTGACAGATGGGGTTTGG + Intergenic
1089144260 11:116312984-116313006 TTGGGGATAAAAATGGGGGAAGG + Intergenic
1089800119 11:121021056-121021078 TTGGGGAGAAAGATGGGAGGTGG + Intergenic
1090030142 11:123199080-123199102 TTGGGAAGAAAGATTTGACAGGG + Intergenic
1090203731 11:124873655-124873677 TTAAGTAGAAAGATAGGGAAAGG - Intronic
1090576095 11:128105601-128105623 TGGGGTAGAAAGATTAGGCATGG + Intergenic
1090598151 11:128341876-128341898 TTGGGTTGAAAGTTGGGGAGCGG - Intergenic
1092292342 12:7169177-7169199 TCCGGTAGAAACATGGGACATGG + Intergenic
1093216716 12:16370266-16370288 TTAGGAAGACAGATGGGACAAGG + Intronic
1094414236 12:30201199-30201221 TTGGGGAGAACGATGGGGGCGGG + Intergenic
1098099830 12:67003188-67003210 TTGGGTAGAAAGAAGGGCGTTGG - Intergenic
1099923142 12:88983996-88984018 TGGGGTAGAAATATGGTGAAGGG - Intergenic
1100271891 12:93033756-93033778 TTTGGGAGCAAGTTGGGGCAGGG - Intergenic
1100434490 12:94559437-94559459 CTGGTTAGAAAGAGGGGGAATGG + Intergenic
1100444223 12:94646248-94646270 TAGGTTAGAGAGATGGGGGAGGG + Intronic
1101594885 12:106155463-106155485 CTGGGTAGCAAGATAGGGGAAGG - Intergenic
1101821024 12:108184340-108184362 TTGGACAGAAAGATTGGGCTTGG + Intronic
1102780136 12:115557208-115557230 TTGGGTAGACTGATGGGGCTGGG - Intergenic
1103953295 12:124563739-124563761 TTGGGGAGAAGGATAGGGCCTGG - Intronic
1104113373 12:125725176-125725198 TTGGGAAAAAAGCTGAGGCAGGG + Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1107743464 13:43479736-43479758 ATGGGCAGAAAGATGGAGCTGGG - Intronic
1107895562 13:44959172-44959194 TTGGGTGGGCACATGGGGCAGGG - Intronic
1108098741 13:46932779-46932801 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1108123246 13:47212586-47212608 TGGTGTAGGAAGATGGAGCAGGG + Intergenic
1108504384 13:51097995-51098017 TAGGGTAGGGAGATGGAGCAGGG - Intergenic
1109325590 13:60863703-60863725 TTGGGAATCAAGATGGGGCAAGG + Intergenic
1110660318 13:78053211-78053233 TTTGGTAGAGAAATGGGGAAAGG - Intergenic
1110887764 13:80659293-80659315 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1110927061 13:81166393-81166415 TAGGGTAAAAAAATGAGGCAGGG - Intergenic
1110944017 13:81390297-81390319 TTGGGAAGAAATATGGGAAAAGG - Intergenic
1111406410 13:87812478-87812500 TTTGGAAGAAAGATGGAGTATGG + Intergenic
1111805791 13:93039411-93039433 TTGGGAAGAAAGCTCAGGCAGGG + Intergenic
1111806442 13:93044395-93044417 TTGGGAAGAAAGCTGAGGCAGGG + Intergenic
1114424652 14:22611808-22611830 GTTGGGAGGAAGATGGGGCAAGG - Exonic
1114887355 14:26870470-26870492 TTCGGTAGCAAAATGGTGCATGG + Intergenic
1115791260 14:36881577-36881599 ATGGGTAGAAAAAAAGGGCAAGG - Intronic
1115863095 14:37711591-37711613 TTGGGTGGAAGGTTGGGGGAAGG + Intronic
1116043370 14:39713455-39713477 ATTGTTAGAGAGATGGGGCATGG + Intergenic
1116260830 14:42623570-42623592 TTGTGTGGGAAGATGGGGGAGGG + Intergenic
1117533693 14:56684472-56684494 TTGGAAAGGAAGAAGGGGCAGGG - Intronic
1117558549 14:56911412-56911434 CTTGGTGGAATGATGGGGCATGG + Intergenic
1118133071 14:62989505-62989527 TTAGCCAGAAAGATGGGGGAGGG - Intronic
1121077681 14:91083095-91083117 TAGGGTTGCAAGTTGGGGCAGGG - Intronic
1121816029 14:96929183-96929205 TTAGGTAGATGGATGGGGGATGG - Intronic
1122572006 14:102710469-102710491 TTGGGTAGAAAGACGGTACTTGG + Intronic
1122853471 14:104548756-104548778 CTGGGAAGAACGCTGGGGCAGGG - Intronic
1124690243 15:31815711-31815733 TTGGGTAGGAAGATGGCCCGTGG - Intronic
1124839455 15:33228407-33228429 AGGGGTGGAAAGATGGGGCGAGG - Intergenic
1124897597 15:33791480-33791502 TTGGGAATGAAGATGGGGAAAGG + Intronic
1126690492 15:51285505-51285527 TTGGGAAAAAAGCTGAGGCAGGG + Intronic
1128251202 15:66165547-66165569 TTGGGGCGAGAGCTGGGGCAGGG - Intronic
1128542117 15:68543502-68543524 CAGGGTAGAAAGATGGGGATTGG - Intergenic
1128744513 15:70104003-70104025 TTGGGTAGAAGGGTGGGGGTGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132291248 15:100705301-100705323 CTGCGTGGAAAGATGCGGCAGGG + Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134126816 16:11621755-11621777 TTGGGAAGAGAGTCGGGGCAGGG - Intronic
1135224197 16:20641375-20641397 TTGGGAAGAAAGCTGAGGCAGGG + Intronic
1135224963 16:20647757-20647779 TTGGGAAGAAAACTGAGGCAGGG + Intronic
1136022818 16:27450785-27450807 TTGGGGAGGAAGACGGGGCCGGG - Exonic
1136188472 16:28601510-28601532 ATTGCTTGAAAGATGGGGCAGGG - Intergenic
1136190940 16:28614504-28614526 ATTGCTTGAAAGATGGGGCAGGG - Intronic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1137244354 16:46690010-46690032 GTGGGTAGAAAAATGAGCCAGGG + Intronic
1137798899 16:51244661-51244683 TTGGGTAGGCAGATGGGTGAAGG - Intergenic
1139663045 16:68435245-68435267 TTGCCTAGAAAGGTGGGTCAGGG + Intronic
1140327359 16:74017828-74017850 TGGGGTAGAGATATGGGGAAGGG - Intergenic
1140464800 16:75172730-75172752 CAGGGTAGAAAGATGGAGGATGG + Intergenic
1140804722 16:78522688-78522710 TTTGGTAAAAAGTCGGGGCAAGG + Intronic
1140861303 16:79020611-79020633 CTGGGTAGAAAGATGGCGATGGG + Intronic
1141110140 16:81265456-81265478 GTGGGTAGATAGATGGTGGATGG - Intronic
1143300049 17:5902334-5902356 TTTGGGTGAAAGATGAGGCATGG - Intronic
1143529086 17:7490785-7490807 TTGGGTAGAAGGATGGGTGAGGG + Intronic
1144448489 17:15354536-15354558 TTGGGTAGAAGCAAGGGGAATGG - Intergenic
1144770078 17:17754773-17754795 TGGGTTAGGAAGATAGGGCAAGG + Intronic
1145795321 17:27652109-27652131 TTGGGAAGACAGATGGCTCATGG - Intergenic
1146482187 17:33213705-33213727 CTGGGTGGAAAGAAGGGGAAAGG - Intronic
1147632756 17:41942691-41942713 CAGGGCAGAAAGATGTGGCAGGG + Intronic
1148234884 17:45962148-45962170 TTGGGCAGGAATATGGAGCACGG + Intronic
1149436934 17:56640924-56640946 ATGGGTCGATAGATGGGTCAGGG + Intergenic
1149441034 17:56674005-56674027 ATGGTAAGAAAGATGGAGCACGG + Intergenic
1150287539 17:63962464-63962486 CTGTGTGGAAATATGGGGCACGG + Intronic
1150581743 17:66480624-66480646 TTGGTTAGAAAGGCAGGGCACGG - Intronic
1151573024 17:74936536-74936558 TCGGGCAGAAGGCTGGGGCAAGG - Intronic
1152654774 17:81514536-81514558 TGGGGAAGAAAGGTGGGGGACGG - Intronic
1153226418 18:2903415-2903437 GTGGGAAGAAGGATGGGGAAGGG - Intronic
1153905468 18:9657722-9657744 TTGGGTATAAAGCTGTGGCTGGG + Intergenic
1154983811 18:21528552-21528574 ATGGGTAGAATGATAGGGCACGG - Intergenic
1155263193 18:24065153-24065175 TTGGGAAGAAAAGTGTGGCAGGG + Intronic
1156632162 18:38983327-38983349 TTGGATAGAAAGATAGGGGATGG - Intergenic
1157684134 18:49629249-49629271 TTGGGCAGAAGCAGGGGGCAGGG + Intergenic
1158025525 18:52892385-52892407 CTGAGAAGAAAGATGGGGAAAGG - Intronic
1158093044 18:53737692-53737714 TAACGTAGAAAAATGGGGCAGGG - Intergenic
1160421784 18:78753075-78753097 GTTGGTAGAGAGATGTGGCACGG - Intergenic
1162043342 19:7983607-7983629 TGGAGCAGAAAGATGGGGCCCGG - Intronic
1162158593 19:8696305-8696327 TTGGGAAGATGGATGGGGGATGG + Intergenic
1162609389 19:11737910-11737932 TTGGGAAGAAAGAAGGGACTGGG + Intronic
1162612652 19:11768048-11768070 TTGGGAAGAAAGAAGGGACAGGG - Intronic
1162713223 19:12611370-12611392 TTGGGAAGAAAGAAGGGACTGGG - Intronic
1162938475 19:13993897-13993919 TTGGGAAGAAAGACGGGGATGGG + Intronic
1163430165 19:17262693-17262715 TTGGGAAGCAGGAAGGGGCAGGG - Exonic
1163704363 19:18803744-18803766 TGGGTTAGAGAGATGGGCCAAGG + Intergenic
1163823697 19:19511050-19511072 CTGGGTGGGAAGACGGGGCAAGG + Intergenic
1163901390 19:20103382-20103404 TTGGGAAGAAAGCTGAGGCAGGG - Intronic
1165413367 19:35676033-35676055 ATGGATAGACAGATGGAGCAGGG - Intronic
1165867152 19:38945878-38945900 TTGGGTAGGTAGTTGGGGGACGG + Intronic
1165959049 19:39519213-39519235 CCGGGTAGGAGGATGGGGCAGGG + Intronic
1166123256 19:40698659-40698681 TTGTGGAGAAAGAAGAGGCAAGG + Intronic
1166474175 19:43106610-43106632 TGGGGTGGGAAGATGGGGGAGGG + Intronic
1166885751 19:45960089-45960111 TGGGGGAGAAGGATGGAGCAGGG + Intronic
1167754428 19:51402919-51402941 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
1167797141 19:51716860-51716882 TTGGGAACAAAGATGCAGCAGGG - Intronic
926982913 2:18590676-18590698 TTGGGTAGAATGCTGGGGGTTGG - Intergenic
928444857 2:31324680-31324702 GTGGGGAGAATGGTGGGGCAGGG + Intergenic
928626296 2:33143021-33143043 TTGGGGTGGAAGAAGGGGCAGGG - Intronic
929489085 2:42380623-42380645 TTGGGAAGAGAGATGGGGTCAGG + Intronic
929679331 2:43973998-43974020 TTGGGTAGAAAGAGGATGCGGGG - Intronic
929901164 2:46005032-46005054 TTGGGTATGATGATGGGGGAGGG - Intronic
930816496 2:55603312-55603334 TGGGGTAGTAGGATGGGACAAGG + Intronic
931321809 2:61179536-61179558 TAGGGAAGAAAGATGGCACAAGG - Intronic
931516879 2:63055297-63055319 TTGAGCAGAAGGATGGGGGAGGG + Intronic
932749505 2:74362370-74362392 TGGGGTAGAACGGTTGGGCATGG - Intronic
933614631 2:84471132-84471154 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
933615303 2:84477387-84477409 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
935277994 2:101492275-101492297 CTGCGTAGAAACATGGAGCATGG - Intergenic
936032984 2:109087042-109087064 TTAGGTAGCAAGTTGGGACAGGG + Intergenic
937111523 2:119370272-119370294 TTCGGTAGAAAAATGGGGCTAGG + Intronic
937227781 2:120379514-120379536 GTGGGTAGAAAGACTGGGGAGGG + Intergenic
937260702 2:120585346-120585368 GAGGCTAGAAAGATGGGGGAGGG + Intergenic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
937458724 2:122067093-122067115 TTGGGAAGATGGATGGTGCAGGG + Intergenic
939625031 2:144466500-144466522 TTATGTAGAAAGATGGGCCATGG - Intronic
939954013 2:148509763-148509785 TTGGGAAGAAAGTTGGGCCACGG - Intronic
940205406 2:151196525-151196547 TTGGGAAAGAAGTTGGGGCATGG - Intergenic
940716054 2:157224851-157224873 TGGGGTAGGAGGATGGGGGAGGG + Intergenic
942044105 2:172089179-172089201 TTGGGTAGAAAGAGGGAGCGAGG + Exonic
942141657 2:172983558-172983580 TGTGGTAGAAAGATGGGATAAGG - Exonic
942364898 2:175215221-175215243 TGGGGTAGAAGGAGGGGGGAGGG - Intergenic
943968335 2:194367759-194367781 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
945007264 2:205422107-205422129 TGTGATAGAAAGATGGGGCTGGG + Intronic
945470871 2:210226325-210226347 TTGGGAAGAAAGCTGAGGCAGGG + Intergenic
945762831 2:213935457-213935479 ATGGGAAGAAAGAAGGGGCAAGG - Intronic
948020990 2:234733042-234733064 TAGGGAAGAAAGATGGTCCATGG - Intergenic
948728923 2:239951395-239951417 TTGGGAAGAAAGTGGGGCCAGGG + Intronic
1169317019 20:4601170-4601192 TTGGTTAGAAATCTGGGGTATGG - Intergenic
1169713776 20:8593113-8593135 TTGGGGCAAAAGATGGGGAAAGG - Intronic
1172230832 20:33334421-33334443 TTGGGTAGATGGATGGTGGATGG + Intergenic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1172470490 20:35190456-35190478 TTGGGTGGGAAAAGGGGGCAAGG - Intergenic
1173880159 20:46406203-46406225 TTGGGTGGGAAGATCGGGGAGGG - Intronic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1175390158 20:58622025-58622047 ATGGGTTGAAAGCTGGGGAAGGG - Intergenic
1175440117 20:58984470-58984492 TTGGATAGACAGATGGGAGATGG + Intronic
1175451586 20:59073263-59073285 TAGGGGAGAAGGATGGGGCTTGG - Intergenic
1176367955 21:6045071-6045093 TTGGGTGGCAAGAGAGGGCAGGG - Intergenic
1178297598 21:31423452-31423474 ATGTGTATAATGATGGGGCAGGG - Intronic
1178762557 21:35417669-35417691 TTGGGTAGAGAGGTGGGGAAAGG - Intronic
1178860441 21:36284567-36284589 TGGGGTAGAAAGAAGGAACAGGG - Intronic
1179200232 21:39211483-39211505 TTGGCTTGAAAGATGGAACAAGG + Intronic
1179308179 21:40173754-40173776 ATGGGAGGAAAGATGAGGCAAGG + Intronic
1179492995 21:41753544-41753566 TTGGGTGGGAAGATGAGGAAAGG - Intronic
1179755564 21:43493471-43493493 TTGGGTGGCAAGAGAGGGCAGGG + Intergenic
1180596913 22:16982768-16982790 TTGGGAAAAAAGCTGAGGCAGGG + Intronic
1181456975 22:23065271-23065293 TGGGGTAGAAAGGCGGAGCAGGG + Intronic
1182556981 22:31134423-31134445 TGGGGTAGGCAGATGGGCCAAGG + Exonic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1182845072 22:33423774-33423796 TTTGTTACAAATATGGGGCAAGG + Intronic
1182941137 22:34278508-34278530 TTGGGTGGGAAGTTGGGGGAGGG + Intergenic
1183869317 22:40729290-40729312 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
1184255205 22:43282525-43282547 TGTGGTAGAAAGAGAGGGCAAGG - Intronic
1185013655 22:48331287-48331309 CTGGGTAGGCAGGTGGGGCAAGG - Intergenic
1185044177 22:48520695-48520717 ATGGGCAGGAAGAGGGGGCATGG + Intronic
949934606 3:9106952-9106974 TTGGGAAGGTAGGTGGGGCAGGG + Intronic
949952455 3:9240484-9240506 TTGGAAAGAAAGATGAGGCAAGG - Intronic
950577647 3:13842361-13842383 GTGGGTAGAAACCTGGGGTAAGG + Intronic
951186668 3:19721736-19721758 TTGGGTAGACAACTGGGGAAGGG + Intergenic
951824464 3:26853053-26853075 TTGGGTGGAAGGATGGGACTAGG - Intergenic
952059511 3:29490740-29490762 TTGAGAAGAAAGCTGGGCCATGG + Intronic
952228041 3:31399403-31399425 TTGGACAGGATGATGGGGCAAGG - Intergenic
952537349 3:34324851-34324873 TTAGGTAGAAAGTTTGGGGAAGG + Intergenic
952820803 3:37484110-37484132 ATGGGAAGGAAGATTGGGCAGGG - Intronic
955321512 3:57977912-57977934 TTGTGTAAAAAGGTGGAGCAAGG - Intergenic
955528593 3:59848174-59848196 TGGGGCTGAAAGATGGGGAATGG + Intronic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
962250307 3:133832192-133832214 TTGGGTAGAAAGTGGGGGTTGGG + Intronic
962501649 3:136000176-136000198 TTGGGGAGAAAAATGATGCAGGG - Intronic
962704241 3:138027860-138027882 CTGGGTAGGATGAGGGGGCAGGG + Intronic
962851932 3:139314399-139314421 CTGGGAAGAAAAATGGGGGAAGG + Intronic
964651990 3:159022129-159022151 TTGGGAAAAAAGCTGAGGCAGGG + Intronic
965180129 3:165391892-165391914 TTAGGGAAAAAGATGAGGCAAGG - Intergenic
965363763 3:167773460-167773482 TTATGTAGAAAGATGTGTCAAGG - Intronic
966271630 3:178114649-178114671 ATGGGGAGAGAGATGAGGCAAGG - Intergenic
968614233 4:1570167-1570189 CTGGGTAGGAAGAGGGTGCAAGG + Intergenic
968887198 4:3341287-3341309 AAGGGTAGAGAGATGGGGTATGG + Intronic
968922872 4:3531792-3531814 TTGGGTAGAAAGACGTGTCCAGG - Intronic
969084565 4:4646264-4646286 TTGGGAAGAAAGATATTGCATGG + Intergenic
969323570 4:6427551-6427573 TTGGCCAGGAAGATGGGGTAGGG - Intronic
970551674 4:17188001-17188023 TAGGGTACAAAGATGAGGTAAGG - Intergenic
971220651 4:24702817-24702839 TTTGGTGGAATGATGGGGGAGGG + Intergenic
971638729 4:29100636-29100658 TTGGTTAGAAAGATGGAGGCAGG - Intergenic
971963277 4:33517105-33517127 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
972984209 4:44744130-44744152 TGGGGTGGAGAGATGGGGGAGGG - Intergenic
974173800 4:58299526-58299548 TTGGGTAGAATGATGAGGGAAGG - Intergenic
976184880 4:82433246-82433268 TTGGGGAAAAAGGTGGGGGAGGG - Intronic
976205233 4:82617877-82617899 ATAGGTAAAAAGATGGGGGAAGG - Intergenic
976647691 4:87402474-87402496 TTGGGAAAAAAGCTGAGGCAGGG - Intergenic
976957426 4:90917512-90917534 TGGGGTAGAAGGAGGGGGGAGGG + Intronic
978506577 4:109464160-109464182 TTAGGCTGAAAGATGGGGAAGGG + Intronic
980498507 4:133616627-133616649 TTGGGGAGGAAAGTGGGGCATGG + Intergenic
982144389 4:152367126-152367148 TGGGGTTGAGGGATGGGGCAAGG + Intronic
983534253 4:168840423-168840445 TTGTGTATAAAGAAGGGCCAAGG - Intronic
983544384 4:168947533-168947555 TTGGGGAGAAGGATGGGAGAGGG - Intronic
984599043 4:181705108-181705130 GTGGGTAGAGGGATGGGGAATGG + Intergenic
985143297 4:186865259-186865281 TTGGGAAGAAATTTGGGGGAAGG - Intergenic
986580911 5:9264879-9264901 GTGGGAAGAAACATGGGGCGAGG + Intronic
986811099 5:11360598-11360620 GTGGGTAGCAAGTTGGGGCATGG - Intronic
987063615 5:14266322-14266344 CTGGGTAGAAAGATGGATGAAGG - Intronic
988929496 5:36022642-36022664 TTGGGGAGAAAACTGAGGCAAGG - Intergenic
989293640 5:39797753-39797775 TTGGGTAGGAAGATGACACAAGG - Intergenic
989445443 5:41522984-41523006 TTGGGTAGAAAGTTGGGGAGAGG + Intergenic
990022327 5:51142888-51142910 TGGGGTGGAAGGATGGGGGAGGG + Intergenic
990227498 5:53671688-53671710 TGGGGTAGAAGGATGGGGGGTGG + Intronic
994115645 5:96059005-96059027 TTAGCTGGAAACATGGGGCAAGG + Intergenic
996789846 5:127281177-127281199 TAGGTTAGGAAGATGGTGCAAGG - Intergenic
998179386 5:139925862-139925884 GTGGGTAGAGAGGTGGGGCCTGG - Intronic
1002168895 5:177364350-177364372 ATGGGAAGAAAGATGGGGGCAGG + Intronic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1002880081 6:1243237-1243259 TTGGGCAGAAGGATGGGGGAGGG - Intergenic
1003378149 6:5598094-5598116 TTTAGGTGAAAGATGGGGCAAGG + Intronic
1003915510 6:10782991-10783013 TTGTTTGGGAAGATGGGGCATGG - Intronic
1003935716 6:10973240-10973262 TTGGGCTGATAGGTGGGGCATGG + Intronic
1004536922 6:16511984-16512006 TTGAGGAGAAAGATGGGGGCTGG - Intronic
1004630898 6:17420171-17420193 CTGGGGATAAAAATGGGGCAGGG - Intronic
1005520705 6:26598203-26598225 TTAGGGAGAAAGATGAGACAAGG - Intronic
1006133254 6:31881149-31881171 TTGTGAAGAGAGATGGGGCCTGG - Intronic
1006920205 6:37622954-37622976 TTGGGCAGGAAGCTGGGGGAGGG + Intergenic
1007111560 6:39315958-39315980 TTGGGTGGAAGGCTGTGGCAGGG + Intronic
1007119296 6:39366991-39367013 TGGGAAAGAAAGCTGGGGCAAGG + Intronic
1007141313 6:39577408-39577430 TTGGGTAGTAAGAATGGGCCAGG - Intronic
1007842819 6:44730687-44730709 TGGAGAAGAAAGATGGGGGAAGG - Intergenic
1007843921 6:44738634-44738656 CAGGGTAAAAAGATGGGGCCTGG + Intergenic
1008247410 6:49194917-49194939 GTGAGGAGAAACATGGGGCAGGG - Intergenic
1008395341 6:51000079-51000101 TTGGGTGAAAAGATTGGGGAGGG - Intergenic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1010121467 6:72380247-72380269 TGGGGTGGAAGGATGGGGGAGGG + Intronic
1011325478 6:86146726-86146748 TTGGGAAAAAAGCTGAGGCAGGG + Intergenic
1011668938 6:89663517-89663539 TTGGACAGAAATTTGGGGCAAGG + Intronic
1011750108 6:90446968-90446990 CTGGGTGGAAAGTTGAGGCATGG + Intergenic
1013076393 6:106775369-106775391 TTGGGTATAAAAAGGGGGCTGGG - Intergenic
1013481139 6:110553805-110553827 CTGTGTAGAAGGATGGGGCTGGG - Intergenic
1017596002 6:156029210-156029232 TGGGGGATAAAGATGGGGAAGGG - Intergenic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1019069138 6:169327114-169327136 TTTGGTAGAGAGAAAGGGCATGG - Intergenic
1019069654 6:169333225-169333247 GTGGGTAGAAAACAGGGGCATGG - Intergenic
1019287267 7:229971-229993 TGGGATAGAAAGATGGGGTAGGG + Intronic
1019553590 7:1617303-1617325 TTGGGAAGGAAGATGGTGCCTGG + Intergenic
1020263029 7:6541779-6541801 TTGGGTAGAAGGATGGGCTTTGG - Intronic
1021604628 7:22397533-22397555 TTTATTAGAAAGATGGGGAAAGG + Intergenic
1022030729 7:26489843-26489865 TTGGTTGGAGAGGTGGGGCAGGG + Intergenic
1022347427 7:29530010-29530032 TTGGGTAGGGGGATGGGGGAGGG - Intergenic
1022617418 7:31946217-31946239 TTGGGAAAAAAGCTGAGGCAGGG + Intronic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023620439 7:42066443-42066465 CTGGGTTAAAAGATGGGGAAAGG + Intronic
1024006311 7:45226991-45227013 ATGGTGAGAAAGATGGGACATGG - Intergenic
1024970855 7:55068860-55068882 ATGTGTAGAAAGAAGGGTCAGGG + Intronic
1029544604 7:101203568-101203590 CTGGGCTGGAAGATGGGGCAGGG + Intergenic
1030443872 7:109624714-109624736 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1031687407 7:124748057-124748079 TTAGCTAGAAAAATGGGGCAAGG + Intronic
1032158020 7:129485942-129485964 TTGGGCCTAAAGATGGTGCAAGG + Exonic
1032522822 7:132559306-132559328 GTGGGGAGAAACAGGGGGCAGGG - Intronic
1034073794 7:148213128-148213150 TTGGGGTGAAAGCTGAGGCAGGG - Intronic
1035947436 8:3980973-3980995 GTGGGTACAAAGGTGGGGAAAGG - Intronic
1036498174 8:9288760-9288782 TTGGGAAGAAAGCTTGGGAAGGG - Intergenic
1038217603 8:25577063-25577085 TTGGTTTAAAAGATGGGGCGAGG - Intergenic
1039782148 8:40796308-40796330 TTGGGAAGGAAAATGTGGCATGG - Intronic
1040487380 8:47886351-47886373 TTTGGAAGAAATATGGGTCAAGG - Intronic
1040552229 8:48446471-48446493 TGGGGTAGGAAGATGGGTTATGG + Intergenic
1041618508 8:59936088-59936110 GTGGGTACAAAAGTGGGGCAAGG + Intergenic
1041929112 8:63267800-63267822 TGGGGTAGAAACATGGGGATAGG - Intergenic
1042135087 8:65625284-65625306 TTGGGCAGAATGATTGTGCAAGG - Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043865048 8:85365033-85365055 GTGGGTGGTCAGATGGGGCAGGG + Intronic
1044179257 8:89168065-89168087 TGGGGTAGAGGGATGGGGGAGGG + Intergenic
1044753207 8:95436043-95436065 CTGGGTAGAAACATGGGCCAAGG + Intergenic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1045400445 8:101811315-101811337 TTGGCTAGGAAGATGGAGGAAGG + Intronic
1046027298 8:108740186-108740208 TTGGGAAGAAAGCTGAGGCAGGG - Intronic
1047030097 8:120867398-120867420 GTGGGTAAGAAGCTGGGGCAGGG - Intergenic
1048614947 8:136063937-136063959 TGGGGTAGGGAGATGGGGGAGGG - Intergenic
1049359959 8:142207673-142207695 ATGGGTAGATGGATGGGGAATGG + Intergenic
1049464417 8:142744451-142744473 ATGGGTGGATAGATGGGGGATGG + Intergenic
1049464907 8:142746690-142746712 GTGGATAGATAGATGGGGGATGG + Intergenic
1050686175 9:8171803-8171825 TTTGGTGAAAAGGTGGGGCACGG - Intergenic
1051359905 9:16272760-16272782 TTGGGCAGAAAAATAGGGCAAGG - Intronic
1052093847 9:24361456-24361478 TTTGTTACAAAGATGGAGCAAGG + Intergenic
1052879230 9:33590481-33590503 TGGGGGTGAAAGATGGGGCTGGG + Intergenic
1053496748 9:38553738-38553760 TGGGGGTGAAAGATGGGGCTGGG - Intronic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1056055349 9:82817229-82817251 TTTGGAAGAAAGATGTGGCATGG + Intergenic
1057062165 9:92014985-92015007 TTGGATAGCAAAATGGGGAAAGG + Intergenic
1057191848 9:93092773-93092795 ATGGGGACAAGGATGGGGCAGGG + Intergenic
1057676663 9:97141294-97141316 TGGGGGTGAAAGATGGGGCTGGG - Intergenic
1057829475 9:98395778-98395800 GTGGTTAGAAGGATGGAGCAAGG + Intronic
1058634573 9:107024023-107024045 TTGTGTAGACAGATGGTCCATGG - Intergenic
1059167829 9:112095893-112095915 TTGGGTAGAAATAGGGCTCAAGG + Intronic
1059483157 9:114607806-114607828 TCAGGTAGAACGATGGGGCTGGG + Intergenic
1060413671 9:123415963-123415985 TTGGGTGGGAAGAGGGGGTAAGG + Intronic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1061761880 9:132857139-132857161 TAGGGAAGAAAGGTGGGGGAAGG - Intronic
1186864218 X:13702917-13702939 TTTGGTAGAACGATTGGGAAAGG - Intronic
1190001634 X:46694045-46694067 TTGGGTGGAAAGATGGGGAGTGG + Intronic
1190845058 X:54183386-54183408 TTGGGTAGAGAGAAGGGGAGGGG + Intergenic
1192001985 X:67161211-67161233 TGGGGCAGAAAGTTGAGGCATGG + Intergenic
1192331296 X:70177405-70177427 GTGGGTAGGAAGTTGGGGCGGGG + Intergenic
1193158102 X:78195952-78195974 TTGGGTGGAAAGAGTGGGAAGGG + Intergenic
1193248019 X:79253176-79253198 TTGGGTAGATAGAGGTGGGAAGG + Intergenic
1194033393 X:88842665-88842687 TTGGGAAGAAAGCTGAGGCGGGG - Intergenic
1194034049 X:88848796-88848818 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1194076501 X:89400548-89400570 TTGGGCAGAATCCTGGGGCATGG - Intergenic
1197222787 X:123929631-123929653 TTTGGTAGAAGTATGGAGCATGG - Intergenic
1200429141 Y:3056068-3056090 TTGGGCAGAATCCTGGGGCATGG - Intergenic