ID: 1083827469

View in Genome Browser
Species Human (GRCh38)
Location 11:65211625-65211647
Sequence CCCACTCAGCACCACCGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 253}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083827462_1083827469 -1 Left 1083827462 11:65211603-65211625 CCTCTCCCCACTTCAGAGGCCAC 0: 1
1: 1
2: 6
3: 51
4: 404
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827461_1083827469 0 Left 1083827461 11:65211602-65211624 CCCTCTCCCCACTTCAGAGGCCA 0: 1
1: 0
2: 9
3: 53
4: 411
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827457_1083827469 18 Left 1083827457 11:65211584-65211606 CCAGCATCCTGATGTGTCCCCTC 0: 1
1: 0
2: 1
3: 20
4: 194
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827456_1083827469 19 Left 1083827456 11:65211583-65211605 CCCAGCATCCTGATGTGTCCCCT 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827465_1083827469 -8 Left 1083827465 11:65211610-65211632 CCACTTCAGAGGCCACCCACTCA 0: 1
1: 0
2: 4
3: 17
4: 232
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827454_1083827469 28 Left 1083827454 11:65211574-65211596 CCGGGTTTCCCCAGCATCCTGAT 0: 1
1: 0
2: 1
3: 30
4: 210
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827453_1083827469 29 Left 1083827453 11:65211573-65211595 CCCGGGTTTCCCCAGCATCCTGA 0: 1
1: 1
2: 3
3: 36
4: 283
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827455_1083827469 20 Left 1083827455 11:65211582-65211604 CCCCAGCATCCTGATGTGTCCCC 0: 1
1: 0
2: 0
3: 22
4: 254
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827458_1083827469 11 Left 1083827458 11:65211591-65211613 CCTGATGTGTCCCCTCTCCCCAC 0: 1
1: 0
2: 2
3: 33
4: 381
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827452_1083827469 30 Left 1083827452 11:65211572-65211594 CCCCGGGTTTCCCCAGCATCCTG 0: 1
1: 0
2: 6
3: 17
4: 214
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827464_1083827469 -7 Left 1083827464 11:65211609-65211631 CCCACTTCAGAGGCCACCCACTC 0: 1
1: 0
2: 3
3: 17
4: 200
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827463_1083827469 -6 Left 1083827463 11:65211608-65211630 CCCCACTTCAGAGGCCACCCACT 0: 1
1: 1
2: 3
3: 42
4: 379
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253
1083827460_1083827469 1 Left 1083827460 11:65211601-65211623 CCCCTCTCCCCACTTCAGAGGCC 0: 1
1: 0
2: 5
3: 62
4: 457
Right 1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG 0: 1
1: 0
2: 1
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083827469 Original CRISPR CCCACTCAGCACCACCGGCC TGG Exonic
900130819 1:1086444-1086466 CCCACTCACCTCCACCTGCCTGG + Intronic
900167243 1:1248659-1248681 CCCACTCTGCCCTACAGGCCGGG + Intergenic
900167264 1:1248725-1248747 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167326 1:1248923-1248945 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167349 1:1248989-1249011 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167372 1:1249055-1249077 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167396 1:1249121-1249143 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167420 1:1249187-1249209 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167444 1:1249253-1249275 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167468 1:1249319-1249341 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167492 1:1249385-1249407 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167516 1:1249451-1249473 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167540 1:1249517-1249539 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900167564 1:1249583-1249605 CCCACTCCGCCCTACAGGCCGGG + Intergenic
900556630 1:3283995-3284017 CCCAGCCAGGACCACAGGCCAGG - Intronic
904681897 1:32234971-32234993 GGCACTGAGCACCACCTGCCTGG - Intergenic
905911977 1:41661694-41661716 CCCATTCAGCAGCTCCCGCCGGG + Intronic
906662449 1:47592835-47592857 CCCACTCAGCACCTGCGCTCAGG - Intergenic
907281318 1:53349086-53349108 CCCTCCCAGCCCCACCTGCCAGG - Intergenic
910179342 1:84464070-84464092 TCCACTCAGCTCCACAGGCCAGG + Intergenic
910479419 1:87642142-87642164 TCCACCCAGGACCACTGGCCAGG + Intergenic
912470552 1:109903966-109903988 CCCACTCTGCAACATGGGCCTGG + Intergenic
915280947 1:154821780-154821802 CTCACTGAGCACCATCGGACCGG - Intronic
915345193 1:155193612-155193634 GCCACTCTCCACCACTGGCCAGG + Intergenic
916732618 1:167580193-167580215 GCCATTCAGCACCCCCTGCCTGG + Intergenic
917130973 1:171741942-171741964 CCCGCCCAGCACCGCCAGCCCGG - Exonic
918437742 1:184533788-184533810 CCCACTCCCCAGCCCCGGCCAGG - Intronic
920528602 1:206685641-206685663 CGCACTCGGCACCGCCGGCCCGG - Intronic
920931692 1:210394710-210394732 CTCACTCAGCACCATGGGTCAGG - Intronic
921225443 1:213015261-213015283 CACACTCCGCAGCACCGTCCCGG - Intronic
922342762 1:224670759-224670781 CCCACCAAGCCCCACTGGCCAGG + Intronic
922763335 1:228145523-228145545 CCCGCTCAGCACCACAGGCCTGG - Exonic
922784817 1:228277600-228277622 CCCTCCCAGAACCACTGGCCAGG - Exonic
924591634 1:245409703-245409725 CCCAGCCAGCACCCCAGGCCAGG - Intronic
1062906502 10:1183160-1183182 CCCGCTCAGCTCCAGCAGCCAGG + Exonic
1069030918 10:63595293-63595315 CCCACTCAGCACTAGCTTCCTGG + Intronic
1070153860 10:73821492-73821514 CCAACTCAGCAACACCAGACAGG + Intronic
1070324382 10:75378376-75378398 CCCACCAAGCACCACAGCCCTGG + Intergenic
1071225851 10:83526942-83526964 TCCCCTCAGCACCACCCGCTAGG + Intergenic
1071328900 10:84541545-84541567 ACCACTCAGCACCCCCAGGCAGG + Intergenic
1072781641 10:98255686-98255708 CCCACTCATCACCACCTCCTGGG + Exonic
1074095198 10:110305257-110305279 GCCACCCACCACCACCGCCCCGG - Intergenic
1075573198 10:123559837-123559859 CCAACTCAGCACCCACTGCCCGG - Intergenic
1076321099 10:129582042-129582064 CCCCCTCACCACCACCCACCTGG - Intronic
1076920100 10:133446651-133446673 CCCACTCCTCAGCACCGCCCAGG + Intergenic
1077113603 11:872949-872971 CCCACTCAGGAGCCCCAGCCTGG + Intronic
1077227624 11:1445250-1445272 CCCGCTCATCAGCTCCGGCCGGG - Intronic
1077443788 11:2580891-2580913 CCCTCTCAGCACCGTCTGCCTGG - Intronic
1077554697 11:3220346-3220368 CACACTCACCACCACAAGCCAGG - Intergenic
1078534193 11:12160220-12160242 CCCACTGGGCACCACCTGCCAGG - Intronic
1078652515 11:13208888-13208910 CCCACACAGCACCCCCATCCAGG + Intergenic
1079529053 11:21427038-21427060 CCCACGCACCACCAGCTGCCTGG - Intronic
1081537323 11:44005244-44005266 CCCATTCAGCACCCCCTCCCCGG + Intergenic
1083827469 11:65211625-65211647 CCCACTCAGCACCACCGGCCTGG + Exonic
1083890539 11:65593548-65593570 CTCGCTCAGCACCATTGGCCTGG - Exonic
1083938041 11:65880681-65880703 GCCACTCAGCAGGACAGGCCAGG + Intronic
1083954695 11:65976935-65976957 CCCACTGGTCACCACCTGCCAGG - Intronic
1084088897 11:66867518-66867540 TCCACTCAGTGCCACAGGCCAGG + Intronic
1084329778 11:68423631-68423653 CCCACGCAGCACCACCCCCATGG - Exonic
1084646235 11:70460238-70460260 CCCACTGAGCTCCACTGTCCAGG - Intergenic
1086033585 11:82389252-82389274 GCCGCTCACCACCACCTGCCTGG - Intergenic
1086931615 11:92699800-92699822 CCTACTTAGCACCACTGGACTGG - Intronic
1092296410 12:7202522-7202544 CCCACTAACCACCACCAACCTGG - Intronic
1092791212 12:12072353-12072375 GCCTCTCAGCACACCCGGCCAGG + Intronic
1094358889 12:29608731-29608753 CCCTCTCAGCACCCCCGTCTGGG - Intronic
1096771147 12:53936803-53936825 CCCACCCACCCCCACCAGCCAGG + Intergenic
1097190180 12:57216090-57216112 CCCTCTCAGCGCCGCCTGCCTGG - Intergenic
1101396775 12:104355775-104355797 CCCACTCAACTCCACCGTACTGG - Intergenic
1101914404 12:108885126-108885148 CCCACTCACCACCACCGACGTGG + Exonic
1103193220 12:119020146-119020168 CCCATGCAGCACCACCACCCTGG - Intronic
1103824054 12:123721795-123721817 CCCACCCAGCACCAAGAGCCAGG - Intronic
1104413397 12:128578151-128578173 CTCACTCAGCTCCACTGGCGTGG - Intronic
1104774972 12:131385668-131385690 CCCACTCAGCAGCTGCTGCCAGG - Intergenic
1104842142 12:131830352-131830374 CCCACTCACTGCCCCCGGCCAGG - Intronic
1104898557 12:132175908-132175930 CCAGCTCAGCACCACCGTCAGGG + Intergenic
1104967559 12:132515334-132515356 CCCACCCAGCACACCCAGCCAGG + Intronic
1105511214 13:21053259-21053281 CCAACTCAACCCCACCTGCCTGG + Intronic
1112436164 13:99392690-99392712 CCTGCTCAGCTCCACCCGCCTGG + Intergenic
1113574165 13:111382523-111382545 CCCACCCATCACCACAGCCCTGG - Intergenic
1113789823 13:113022378-113022400 CCCACCCACCCCCGCCGGCCAGG + Intronic
1113894979 13:113758892-113758914 CCCACTCAGCGGCACCGCCAAGG + Intergenic
1113956031 13:114100209-114100231 CGCCCTCAGCACCGCGGGCCGGG - Intronic
1118520236 14:66575529-66575551 CCCACTCAGAAACACTGGACAGG - Intronic
1120823331 14:88932948-88932970 CACACTCAGAACCACTGCCCTGG + Intergenic
1122348611 14:101075218-101075240 CCCACCCACCACCAACGTCCAGG - Intergenic
1122865938 14:104603988-104604010 CCCACCCGGCACCATCGCCCCGG - Intronic
1122919910 14:104875767-104875789 CCCACCCAGGACCACCCCCCCGG - Intronic
1123696005 15:22879848-22879870 CCCACCCCACCCCACCGGCCAGG - Intronic
1123716911 15:23040155-23040177 CCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123717072 15:23040707-23040729 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717097 15:23040789-23040811 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717177 15:23041051-23041073 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717299 15:23041457-23041479 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717322 15:23041539-23041561 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717369 15:23041721-23041743 CCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717540 15:23042274-23042296 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717631 15:23042572-23042594 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717642 15:23042609-23042631 CCCCCGCAGCACCTCTGGCCAGG - Intergenic
1123717738 15:23042942-23042964 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717861 15:23043346-23043368 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717878 15:23043390-23043412 CACCCCCAGCACCTCCGGCCAGG - Intergenic
1123717887 15:23043428-23043450 CCCCCCCAGCACCTCTGGCCTGG - Intergenic
1123717930 15:23043610-23043632 CCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717945 15:23043648-23043670 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717990 15:23043800-23043822 CCCCCGCAGCACCTCTGGCCAGG - Intergenic
1123718051 15:23044018-23044040 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718121 15:23044244-23044266 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718263 15:23044724-23044746 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718402 15:23045233-23045255 CACACCCAGCACCTCTGGCCGGG - Intergenic
1123718423 15:23045308-23045330 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718543 15:23045714-23045736 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123718560 15:23045758-23045780 CACCCCCAGCACCTCCGGCCAGG - Intergenic
1123718611 15:23045979-23046001 CCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718685 15:23046233-23046255 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718696 15:23046270-23046292 CCCCCGCAGCACCTCTGGCCAGG - Intergenic
1123718794 15:23046603-23046625 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718814 15:23046676-23046698 TCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123718844 15:23046783-23046805 GCCCCTCGGCACCTCCGGCCAGG - Intergenic
1123718929 15:23047083-23047105 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718970 15:23047227-23047249 GCCACACAGCACCTCTGGCCAGG - Intergenic
1123719049 15:23047489-23047511 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719072 15:23047571-23047593 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719212 15:23048050-23048072 CACACCCAGCACCTCTGGCCAGG - Intergenic
1123719340 15:23048494-23048516 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719363 15:23048576-23048598 CCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719462 15:23048913-23048935 CCCCCGCAGCACCTCTGGCCAGG - Intergenic
1123719507 15:23049057-23049079 GCCCCCCAGCACCTCCGGCCGGG - Intergenic
1123719679 15:23049650-23049672 CCCTCCCAGCACCTCTGGCCAGG - Intergenic
1123719828 15:23050188-23050210 CCCCCCCGGCACCTCCGGCCAGG - Intergenic
1124453839 15:29822487-29822509 CCCACTGAGCATGCCCGGCCCGG + Exonic
1125921800 15:43529411-43529433 ACCACGCAGCACCACAAGCCAGG + Exonic
1126544780 15:49861508-49861530 CTCTCTCAGCATCACTGGCCTGG + Intronic
1129229960 15:74191606-74191628 CACACTCACCACCACCGCCATGG - Intronic
1130162818 15:81418601-81418623 CCCAGTCAGCACCTCAAGCCTGG + Intergenic
1131078711 15:89515705-89515727 GGTACTCAGCACCACCAGCCTGG - Intergenic
1131460601 15:92614975-92614997 CACACTCAGCACCACCTGGCCGG + Intergenic
1131562475 15:93456612-93456634 GCCACTCAGCCCCACCTTCCTGG - Intergenic
1132210880 15:100021205-100021227 CCCACCCAGAACCACAGGCCTGG - Intronic
1132328831 15:100996231-100996253 CGCACACATCACCACCGCCCTGG + Intronic
1132518055 16:375066-375088 TTCACTCAGGACCACAGGCCGGG - Intronic
1132677200 16:1125741-1125763 TCCACTCAGCACCTCCTGCTCGG + Intergenic
1133288720 16:4704019-4704041 GCCACTCAGAACGACCAGCCCGG + Intronic
1135588869 16:23691257-23691279 CCCACTCCCCTCCACCGCCCAGG + Intronic
1136049760 16:27641902-27641924 CTGACTCACCAGCACCGGCCAGG - Intronic
1137797868 16:51237445-51237467 CTCATTCAGCACCACTGTCCAGG - Intergenic
1140158426 16:72458388-72458410 CCCATTCACCACCACCGCCATGG - Intergenic
1141699842 16:85637356-85637378 CCCACCCAGCTCCCCCGACCCGG - Intronic
1142222321 16:88861591-88861613 CCCCCTCAGCACCAACAGGCAGG - Exonic
1142228382 16:88888381-88888403 CCCACTCGGCACCTCCTGTCTGG + Intronic
1142279771 16:89141730-89141752 CCCAGCCAGCACCACAGGGCCGG - Intronic
1143451034 17:7036763-7036785 TCCAGTCATCACCACGGGCCTGG - Exonic
1143620425 17:8077136-8077158 CCCACTCAGAATCACTGGGCAGG + Exonic
1147949563 17:44099431-44099453 CCCACTCAGCAACCCAGGCTGGG - Intronic
1148064648 17:44860158-44860180 CCCACTCAGCACCAGGCTCCTGG - Intronic
1150297831 17:64023323-64023345 CCTACTCAGCTCCACCTTCCTGG + Intergenic
1150747305 17:67825973-67825995 CCCCCCCAGCACCAGCGCCCCGG + Exonic
1151475590 17:74342889-74342911 CCCACTCCCCACCACCTCCCTGG + Intronic
1151481800 17:74373915-74373937 TCCTCTCAGCACCACCATCCCGG + Intergenic
1152132524 17:78485668-78485690 CCCCACCAGCATCACCGGCCAGG + Exonic
1152258313 17:79253025-79253047 CCCACACAGCACCACCCCGCAGG - Intronic
1152377929 17:79928292-79928314 CCCACACAGGACCACCTCCCAGG - Intergenic
1152538789 17:80964553-80964575 CCCACTGAGCACCAGCATCCAGG + Exonic
1152633305 17:81420335-81420357 CCCACACAGCACCCCTGGGCCGG + Intronic
1155367530 18:25063544-25063566 GCAACTCAGGACCACCAGCCAGG + Intronic
1157193349 18:45599609-45599631 GCCACTCTGCACCTCCGGCAGGG + Intronic
1158443839 18:57501527-57501549 CCCAATGAGCACCACCCCCCTGG + Intergenic
1160397042 18:78580187-78580209 CCCACTCAGCTCCATGGTCCTGG - Intergenic
1160806427 19:994134-994156 GCCACTCACCCCCACTGGCCAGG - Intronic
1160830812 19:1104254-1104276 CCCCCTCCCCACCCCCGGCCGGG + Intronic
1161062980 19:2224275-2224297 GCCACCCAGCACCTCCGCCCAGG - Intronic
1161375260 19:3936680-3936702 CCCTCTCAGCTCCACCTCCCCGG - Intronic
1161821115 19:6531742-6531764 CCCCATCAGCACCCCAGGCCAGG + Intronic
1162198050 19:9000621-9000643 CCCATTCAGCCCCACTGGCCTGG + Intergenic
1164680655 19:30131732-30131754 CCCCATCAGCACCAGCTGCCCGG - Intergenic
1166014757 19:39971493-39971515 CTCACTAAGCACTACCGGCCAGG - Intronic
925356053 2:3242162-3242184 CCGACTCCACACCACAGGCCCGG + Intronic
925362535 2:3289495-3289517 CCCACTCTGCACCAGCCTCCTGG + Intronic
925685683 2:6470594-6470616 ACCTCTCAGCAGCACAGGCCAGG + Intergenic
926056570 2:9777330-9777352 CCCTCTCAGCACCAGCTCCCGGG - Intergenic
927874033 2:26642555-26642577 CCGACCCAGCACCACCCACCTGG + Intergenic
927921007 2:26971487-26971509 CCCGCTCCGCAACACCGGCCGGG - Intronic
928301713 2:30131036-30131058 CCCACACAGCCCCGCCCGCCCGG - Intergenic
928482672 2:31698280-31698302 TCAACTGAGCACCACAGGCCGGG - Intergenic
932045217 2:68341758-68341780 CCAACTCAGGGCCACCGGGCAGG + Intergenic
932801786 2:74747751-74747773 CCCACCCACCTCCACCAGCCTGG + Intergenic
934136276 2:88999276-88999298 CCCACTAAGCCCCACAGGGCTGG - Intergenic
934886368 2:98028976-98028998 CCCACTGAGCACTGCTGGCCAGG + Intergenic
936009485 2:108916368-108916390 CCCACTCTAGACCACAGGCCTGG - Intronic
937870822 2:126784845-126784867 CCCACTCAGCTCCATCTGCCTGG + Intergenic
938133320 2:128735314-128735336 CGCCCTCAGCCCCACTGGCCTGG - Intergenic
939607728 2:144273520-144273542 CCCAATCAACACCACCAGGCAGG + Intronic
946167903 2:217876515-217876537 CCCACTCAGGATCAAAGGCCTGG + Intronic
946172308 2:217902705-217902727 CCCGCTCTGCTCCACCGGGCGGG + Intronic
946235633 2:218323097-218323119 CCCCCTCACCACCTCCAGCCGGG - Intronic
948604069 2:239123610-239123632 CCGACTCAGCCCCACTGGACCGG + Intronic
948692886 2:239717998-239718020 GCCACACAGCACCACCGGCAAGG + Intergenic
1171401075 20:24873325-24873347 ACCAGACAGCTCCACCGGCCGGG + Intergenic
1174961220 20:55159241-55159263 CCCACTCAGCAGCGAAGGCCAGG - Intergenic
1175373541 20:58509200-58509222 CTCACTCAGCACCAACTACCTGG - Intronic
1176215261 20:63944859-63944881 CCCACTCCTCCCCACCTGCCAGG - Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179893679 21:44350215-44350237 CCCGCGCAGCACCGCCGCCCTGG - Intronic
1180224414 21:46381571-46381593 CCCACTCTGCACCAAGAGCCGGG - Intronic
1184301955 22:43566705-43566727 CCAACTCAGCAACACTGACCAGG + Intronic
1184302165 22:43567983-43568005 CCAACTCAGCAACACTGACCAGG + Intronic
1184516218 22:44964409-44964431 CCCACTGAGCAGCTCAGGCCCGG + Intronic
1184757662 22:46526069-46526091 CCACCTCAGCACCAGCTGCCCGG - Intronic
949418328 3:3837178-3837200 CACACTCAGGGCCACCTGCCTGG - Intronic
957136312 3:76293922-76293944 CCCCCTCAGCACAAACAGCCTGG - Intronic
961430850 3:126881871-126881893 CCCACCCAGAGCCACCTGCCAGG - Intronic
964927872 3:161979109-161979131 GCCACTCAGCACAAGCAGCCGGG - Intergenic
965773823 3:172208731-172208753 ATCAGGCAGCACCACCGGCCAGG + Intronic
966886353 3:184379910-184379932 CCGACCCAGCAGCAGCGGCCCGG - Intronic
966909304 3:184549855-184549877 CCTGCTTAGCACCACCTGCCCGG - Intronic
968446510 4:654986-655008 TGCAGTCAGCAGCACCGGCCTGG + Intronic
968629516 4:1642764-1642786 CCTACCCAGCCCCACCTGCCGGG + Intronic
969874637 4:10126929-10126951 CCCACTCAGCACAAACATCCTGG + Intergenic
970407642 4:15778765-15778787 CCTACTCAGCACCACCCGGCGGG - Intronic
981300925 4:143185149-143185171 CCCACTCAGCATCAGCGCCGAGG - Exonic
981430009 4:144646845-144646867 CCCACTCAGCAGCTCCAGCTGGG - Exonic
981725801 4:147845892-147845914 CCTACAAAGCACCACCAGCCAGG - Intronic
985543222 5:496334-496356 CGCACCCATCCCCACCGGCCAGG + Intronic
985548095 5:520059-520081 CCCACCCAGCCCCACTGTCCTGG + Intronic
985893974 5:2738543-2738565 CCCACTGAGCCCCAGAGGCCAGG - Intergenic
986641702 5:9878316-9878338 CACACTTAGCACCCCCGCCCAGG + Intergenic
986688486 5:10294689-10294711 CCCTCTCACCATCACCGTCCTGG - Intronic
990308806 5:54518583-54518605 CCCCCGCAGCACCACCCGTCGGG + Exonic
993432944 5:87854256-87854278 CCCACTCAGCTCCAACTGCTAGG + Intergenic
997590606 5:135069838-135069860 ACAACTCAGCACTACCAGCCAGG - Intronic
997779351 5:136641210-136641232 TCCCCTCAGCACCACCAGCCTGG + Intergenic
998216575 5:140242155-140242177 TCCACTCAGCAGCACAGGTCTGG - Intronic
1002854659 6:1026374-1026396 CCCTCCCAGCACCACCCGACTGG + Intergenic
1004603560 6:17173657-17173679 CCCATTCAGCACCACTTCCCAGG + Intergenic
1005873310 6:29993718-29993740 CCAACACAGCATCAACGGCCAGG - Intergenic
1006517819 6:34554584-34554606 TCCACACAGCCCCACCTGCCTGG + Intronic
1007162612 6:39804043-39804065 CCCACACAGCCCCACTGACCAGG - Intronic
1009366967 6:62863604-62863626 CCCACTCCCCCCCACCCGCCCGG + Intergenic
1013311866 6:108902006-108902028 CCCTCTCAGCACCTCCTGCCAGG + Intronic
1015443708 6:133278298-133278320 CCCAATCAGCCCTACCGGTCAGG + Intronic
1018176727 6:161183900-161183922 CCCACTGAGCTCCACCCTCCTGG - Intronic
1018400659 6:163415709-163415731 CCCACGCCGCGCCGCCGGCCTGG + Intronic
1018824463 6:167398681-167398703 TGCACACAGCACCACCTGCCAGG - Intergenic
1021653711 7:22854530-22854552 CCCACTCAGCAGAAGCCGCCAGG + Intergenic
1022218433 7:28288635-28288657 CCCACTCTTCATCACCAGCCTGG - Intergenic
1022505218 7:30905477-30905499 CCCACCCCGCACCTCCAGCCAGG - Intergenic
1027045953 7:74991559-74991581 CCCACTCAGCAGCCCAGGCCAGG + Intronic
1029386870 7:100249012-100249034 CCCACTCAGCAGCCCAGGCCAGG - Intronic
1032190379 7:129762067-129762089 CCTACTCAGCTCCTCCTGCCCGG + Intergenic
1034494063 7:151409809-151409831 CCCACTCGGGACCTCCGCCCTGG + Intronic
1035583088 8:752496-752518 CCCGGTCAGCACCAGCCGCCTGG + Intergenic
1036107560 8:5857077-5857099 CACACAGAGCACCACCTGCCAGG + Intergenic
1036978720 8:13444293-13444315 CCCAACCCGCACCACCGGTCAGG - Intronic
1039932161 8:42003083-42003105 CCCATTCATCTCCACCAGCCGGG + Intronic
1042396056 8:68292896-68292918 CCCACTCAGGTCCACGGGACTGG - Intergenic
1042530706 8:69811866-69811888 CCCAGTTTGCACCACTGGCCAGG + Intronic
1043069476 8:75620594-75620616 CCCACTCAGGACCACCTGTCTGG - Intergenic
1047758136 8:127934351-127934373 CCCAGTCACCACCACCAGACTGG - Intergenic
1048744476 8:137599013-137599035 CCCAGTGAGGACCACAGGCCAGG - Intergenic
1049009705 8:139879253-139879275 CCCACTCCTCACCCCCAGCCAGG - Intronic
1049575188 8:143386581-143386603 CCCACTCGGCACCCCCGTCCTGG - Intergenic
1050173008 9:2842438-2842460 CCCACTCATCACCACCACACAGG + Intronic
1051071664 9:13175824-13175846 CACACTCAGCATTACAGGCCAGG + Exonic
1051198698 9:14593504-14593526 CCCACTCACCACCACCGAGTAGG - Intergenic
1052982330 9:34458344-34458366 CCTAGTCTGCACCACCCGCCGGG - Exonic
1057443788 9:95099715-95099737 CCCAGAAAGCACCACCGGCAAGG + Exonic
1057814526 9:98284923-98284945 CCCACTCAGGACCACGGACAGGG + Intergenic
1060024110 9:120156656-120156678 CAGACTCAGAACCACAGGCCAGG - Intergenic
1060723317 9:125992322-125992344 CCCACCCCGCAGCACCAGCCTGG + Intergenic
1060934200 9:127506284-127506306 TCCACCCAGCACCCCCAGCCTGG + Exonic
1061499156 9:130992301-130992323 CCCAGTCCGCACCAGGGGCCTGG - Intergenic
1062378420 9:136275305-136275327 CCCTCCCAGCACCCCCAGCCGGG - Intergenic
1188001798 X:24989351-24989373 CCCCCTGAGCACCACTGACCTGG + Intronic
1189056062 X:37700605-37700627 CCCAGTCAGCTCCTCCCGCCAGG - Intronic
1198283886 X:135171175-135171197 CCCAGTTGTCACCACCGGCCTGG + Exonic
1200147611 X:153934773-153934795 CACACTCAGGGCCACCGGGCCGG + Intronic