ID: 1083827686

View in Genome Browser
Species Human (GRCh38)
Location 11:65212461-65212483
Sequence TCCAGGGCCTGCTGGGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083827676_1083827686 12 Left 1083827676 11:65212426-65212448 CCTGTGACCCAGACACCTGCACT No data
Right 1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG No data
1083827674_1083827686 14 Left 1083827674 11:65212424-65212446 CCCCTGTGACCCAGACACCTGCA No data
Right 1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG No data
1083827672_1083827686 28 Left 1083827672 11:65212410-65212432 CCCTCTGTGGGGAGCCCCTGTGA No data
Right 1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG No data
1083827677_1083827686 5 Left 1083827677 11:65212433-65212455 CCCAGACACCTGCACTTACATAA No data
Right 1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG No data
1083827679_1083827686 -3 Left 1083827679 11:65212441-65212463 CCTGCACTTACATAAGCCGCTCC No data
Right 1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG No data
1083827673_1083827686 27 Left 1083827673 11:65212411-65212433 CCTCTGTGGGGAGCCCCTGTGAC No data
Right 1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG No data
1083827678_1083827686 4 Left 1083827678 11:65212434-65212456 CCAGACACCTGCACTTACATAAG No data
Right 1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG No data
1083827675_1083827686 13 Left 1083827675 11:65212425-65212447 CCCTGTGACCCAGACACCTGCAC No data
Right 1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083827686 Original CRISPR TCCAGGGCCTGCTGGGATCT GGG Intergenic
No off target data available for this crispr