ID: 1083829640

View in Genome Browser
Species Human (GRCh38)
Location 11:65223390-65223412
Sequence CAGACGAAGGGGTTCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083829627_1083829640 20 Left 1083829627 11:65223347-65223369 CCAGCCACCTCACCAAAGACCTC No data
Right 1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG No data
1083829632_1083829640 -5 Left 1083829632 11:65223372-65223394 CCCCAGCTCTCCTCCACACAGAC No data
Right 1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG No data
1083829630_1083829640 8 Left 1083829630 11:65223359-65223381 CCAAAGACCTCAACCCCAGCTCT No data
Right 1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG No data
1083829629_1083829640 13 Left 1083829629 11:65223354-65223376 CCTCACCAAAGACCTCAACCCCA No data
Right 1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG No data
1083829631_1083829640 1 Left 1083829631 11:65223366-65223388 CCTCAACCCCAGCTCTCCTCCAC No data
Right 1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG No data
1083829628_1083829640 16 Left 1083829628 11:65223351-65223373 CCACCTCACCAAAGACCTCAACC No data
Right 1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG No data
1083829634_1083829640 -7 Left 1083829634 11:65223374-65223396 CCAGCTCTCCTCCACACAGACGA No data
Right 1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG No data
1083829633_1083829640 -6 Left 1083829633 11:65223373-65223395 CCCAGCTCTCCTCCACACAGACG No data
Right 1083829640 11:65223390-65223412 CAGACGAAGGGGTTCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083829640 Original CRISPR CAGACGAAGGGGTTCCCAGC AGG Intergenic
No off target data available for this crispr