ID: 1083830960

View in Genome Browser
Species Human (GRCh38)
Location 11:65233266-65233288
Sequence CACGTAAATCATGGTGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 186}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083830960_1083830977 26 Left 1083830960 11:65233266-65233288 CCACCGCCACCATGATTTACGTG 0: 1
1: 0
2: 0
3: 5
4: 186
Right 1083830977 11:65233315-65233337 CCTCATCCTGGCCGGGCTCATGG 0: 1
1: 0
2: 0
3: 26
4: 214
1083830960_1083830966 -7 Left 1083830960 11:65233266-65233288 CCACCGCCACCATGATTTACGTG 0: 1
1: 0
2: 0
3: 5
4: 186
Right 1083830966 11:65233282-65233304 TTACGTGGGCCGCCGTGCCACGG 0: 1
1: 0
2: 0
3: 1
4: 17
1083830960_1083830974 19 Left 1083830960 11:65233266-65233288 CCACCGCCACCATGATTTACGTG 0: 1
1: 0
2: 0
3: 5
4: 186
Right 1083830974 11:65233308-65233330 CCTCCTTCCTCATCCTGGCCGGG 0: 1
1: 0
2: 1
3: 60
4: 622
1083830960_1083830971 14 Left 1083830960 11:65233266-65233288 CCACCGCCACCATGATTTACGTG 0: 1
1: 0
2: 0
3: 5
4: 186
Right 1083830971 11:65233303-65233325 GGTGGCCTCCTTCCTCATCCTGG 0: 1
1: 1
2: 3
3: 26
4: 260
1083830960_1083830967 -4 Left 1083830960 11:65233266-65233288 CCACCGCCACCATGATTTACGTG 0: 1
1: 0
2: 0
3: 5
4: 186
Right 1083830967 11:65233285-65233307 CGTGGGCCGCCGTGCCACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 94
1083830960_1083830972 18 Left 1083830960 11:65233266-65233288 CCACCGCCACCATGATTTACGTG 0: 1
1: 0
2: 0
3: 5
4: 186
Right 1083830972 11:65233307-65233329 GCCTCCTTCCTCATCCTGGCCGG 0: 1
1: 0
2: 1
3: 40
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083830960 Original CRISPR CACGTAAATCATGGTGGCGG TGG (reversed) Intergenic
901294160 1:8147681-8147703 CAGATAAGTCATAGTGGCGGGGG - Intergenic
901747287 1:11382540-11382562 CACTTGAATCCTGGAGGCGGAGG - Intergenic
904105355 1:28076822-28076844 CACTTAAACCCTGGAGGCGGAGG - Intronic
904228181 1:29042560-29042582 CACTTGAATCTTGGAGGCGGAGG - Intronic
907603347 1:55791886-55791908 CACTTGAATCTTGGAGGCGGAGG + Intergenic
909606005 1:77508781-77508803 CACTTGAACCCTGGTGGCGGAGG + Intronic
910678102 1:89835135-89835157 CACTGAAATCATGGGGGTGGAGG - Intronic
916406926 1:164506986-164507008 GAGGTAAATCATGGTGGCAGGGG - Intergenic
917103720 1:171471374-171471396 CACGTAAATCCTTGAGGTGGAGG + Intergenic
917212861 1:172647634-172647656 CACTTAAATCCAGGAGGCGGAGG - Intergenic
917310384 1:173671796-173671818 CACGTAAACCCGGGAGGCGGAGG + Intergenic
921423179 1:214972382-214972404 CACTTGAATCCTGGAGGCGGAGG + Intergenic
921517298 1:216111138-216111160 CACTTGAATCCTGGAGGCGGAGG + Intronic
1064174638 10:13064009-13064031 CACTTGAATCAGGGAGGCGGAGG - Intronic
1065097802 10:22299028-22299050 CACTTGAACCATGGAGGCGGAGG + Intergenic
1066226247 10:33386523-33386545 CACTTAAACCAGGGAGGCGGAGG - Intergenic
1067262802 10:44708910-44708932 CACGGAAACCATGGTGCCAGGGG + Intergenic
1070184268 10:74045537-74045559 CACTTGAATCCGGGTGGCGGAGG + Intronic
1072119782 10:92396142-92396164 CACGTAAACCTGGGAGGCGGAGG + Intergenic
1073131291 10:101190711-101190733 CACTTGAATCCTGGAGGCGGAGG - Intergenic
1073757845 10:106599853-106599875 CACTTGAATCAGGGAGGCGGAGG - Intronic
1074778699 10:116785205-116785227 CATTTGAATGATGGTGGCGGTGG - Intergenic
1074907422 10:117877415-117877437 CACTTGAATCCTGGAGGCGGAGG - Intergenic
1075045079 10:119140275-119140297 CACTTGAACCCTGGTGGCGGAGG - Intergenic
1079607233 11:22385359-22385381 CACTTGAATCAGGGAGGCGGAGG - Intergenic
1079842330 11:25418948-25418970 CACTTAAACCTTGGAGGCGGAGG + Intergenic
1082983121 11:59142690-59142712 CCTGTAAATCATGGTTGGGGAGG - Intergenic
1083830960 11:65233266-65233288 CACGTAAATCATGGTGGCGGTGG - Intergenic
1085694857 11:78695445-78695467 CACTTAAATCCAGGAGGCGGAGG - Intronic
1086996145 11:93358665-93358687 CACTTGAACCAGGGTGGCGGAGG - Intronic
1089796411 11:120984910-120984932 CACGTAAACCTGGGAGGCGGAGG - Intronic
1089923012 11:122228658-122228680 CACTTAAATCTGGGAGGCGGAGG + Intergenic
1090246959 11:125223311-125223333 CACTTAAACCAGGGAGGCGGAGG - Intronic
1090781849 11:130013753-130013775 CACTTAAACCCAGGTGGCGGAGG + Intergenic
1091502213 12:1029266-1029288 CACGTAAACCTGGGAGGCGGAGG + Intronic
1093882215 12:24417769-24417791 CAAGAAAAACATGGTGGTGGTGG + Intergenic
1096162921 12:49395506-49395528 CACTTGAATCATGGAGGAGGAGG - Intronic
1096245526 12:49983376-49983398 CACTTAAACCCAGGTGGCGGAGG - Intronic
1099592868 12:84618103-84618125 AACTTAAATCATGGTGGAAGTGG - Intergenic
1101376574 12:104176323-104176345 CACTTGAACCAGGGTGGCGGGGG - Intergenic
1101773409 12:107772528-107772550 CACTTGAATCCTGGAGGCGGAGG - Intergenic
1104847430 12:131853558-131853580 CACTTGAATCTGGGTGGCGGAGG - Intergenic
1107898490 13:44989282-44989304 GACGTAAGTGGTGGTGGCGGTGG + Exonic
1110003087 13:70230973-70230995 CACTTAAACCTTGGAGGCGGAGG - Intergenic
1111573552 13:90119107-90119129 CACTTAAACCAGGGAGGCGGAGG - Intergenic
1112123008 13:96433849-96433871 CACTTGAATCCTGGAGGCGGAGG + Intronic
1114291916 14:21295565-21295587 CACTTGAATCCTGGAGGCGGAGG - Intronic
1115448402 14:33518279-33518301 GAGGTAACTCATGGTGGGGGTGG + Intronic
1116144824 14:41051919-41051941 CACTTCAACCATGGAGGCGGGGG - Intergenic
1116347756 14:43816880-43816902 CACCTAAATCCTGGAGGCGGAGG + Intergenic
1119063609 14:71502320-71502342 CACTTAAACCCTGGAGGCGGAGG - Intronic
1119089496 14:71767500-71767522 CACTTGAATCCAGGTGGCGGAGG + Intergenic
1119333355 14:73811974-73811996 CACGTGAATCCAGGAGGCGGAGG + Intergenic
1121146728 14:91590445-91590467 CACTTAAATCCAGGAGGCGGAGG + Intronic
1122244338 14:100391314-100391336 CACATTCATCATGGTGGCGCAGG - Intronic
1125836271 15:42754477-42754499 CACGTAAACCCAGGAGGCGGAGG - Intronic
1127570246 15:60234637-60234659 CACGTAACTGATGGTTGGGGAGG - Intergenic
1129290899 15:74566517-74566539 CACTTAAACCAGGGAGGCGGAGG + Intronic
1132371043 15:101299098-101299120 CACTTGAATCAGGGAGGCGGAGG + Intronic
1133309222 16:4832270-4832292 CCTGTAAATGATGGTGGCGATGG - Intronic
1133366777 16:5216470-5216492 CAAGGAAATCAGGGTGGCTGGGG - Intergenic
1134196447 16:12162963-12162985 CACTTAAACCCTGGAGGCGGAGG - Intronic
1136356861 16:29749832-29749854 CACTTAAACCCTGGAGGCGGAGG + Intergenic
1139706855 16:68746863-68746885 CACTTGAATCTGGGTGGCGGAGG + Intronic
1140600356 16:76468388-76468410 CACTTGAATCAGGGAGGCGGAGG + Intronic
1140691741 16:77491357-77491379 CACTTGAACCCTGGTGGCGGAGG - Intergenic
1142307806 16:89295312-89295334 CAAGTCAAGCATGTTGGCGGTGG + Intronic
1143061968 17:4209382-4209404 CACGTAAACCCGGGAGGCGGAGG - Intronic
1146729268 17:35180425-35180447 CACATAAACCATGCTGGCTGAGG + Intronic
1149079572 17:52637765-52637787 CACTTAAATGCGGGTGGCGGAGG + Intergenic
1150415122 17:64981184-64981206 CACTTGAACCAGGGTGGCGGAGG + Intergenic
1150556015 17:66254630-66254652 CACTTGAACCAGGGTGGCGGAGG + Intronic
1151619302 17:75235919-75235941 CACGTGAACCCTGGAGGCGGAGG - Intergenic
1152815830 17:82407179-82407201 CACTTGAATCAGGGAGGCGGAGG + Intronic
1156205569 18:34882450-34882472 CACTTAAATCAGGGAGACGGAGG - Intronic
1156869994 18:41934218-41934240 CATGTAAATCATGGTTTTGGTGG - Intergenic
1162220131 19:9169149-9169171 CACGTGAACCAGGGAGGCGGAGG + Intergenic
1162582985 19:11541670-11541692 CACTTAAACCCTGGAGGCGGAGG - Intronic
1163460521 19:17434778-17434800 CACTTAAAACAGGGAGGCGGAGG + Intergenic
1163550573 19:17964462-17964484 AACGTCAAGCATGGTGGAGGCGG - Intronic
1163869889 19:19811716-19811738 CACTTGAATCAGGGTGGCAGAGG + Intronic
1164584075 19:29454756-29454778 CACATGAATCATGGTGGATGAGG + Intergenic
1165010643 19:32843852-32843874 CACATAAAAGATGATGGCGGGGG + Exonic
1165864519 19:38928292-38928314 CACTTGAATCAAGGAGGCGGAGG + Intronic
1166143320 19:40817619-40817641 CACGTGAACCAGGGAGGCGGAGG + Intronic
1167348179 19:48959740-48959762 CACTTAAATCTGGGAGGCGGAGG + Intronic
1168222489 19:54970570-54970592 CACTTAAATCTAGGAGGCGGGGG + Intronic
928579762 2:32695633-32695655 CACTTAAACCCTGGAGGCGGAGG + Intronic
928999945 2:37337420-37337442 CACTTGAATCCTGGAGGCGGAGG + Intergenic
929423023 2:41814570-41814592 CGCTTAAACCATGGAGGCGGAGG + Intergenic
929478496 2:42278488-42278510 CACTTAAACCCGGGTGGCGGAGG + Intronic
931242650 2:60467053-60467075 CAAGTAAATGGTGGTGGCAGTGG + Intronic
933745661 2:85569244-85569266 CACTTAAACCCTGGAGGCGGAGG + Intronic
935396097 2:102610927-102610949 CACGTAAACCTGGGAGGCGGAGG - Intergenic
936671766 2:114664543-114664565 CACTTAAACCAGGGAGGCGGAGG + Intronic
938982025 2:136536194-136536216 AACATTAATCATGGTGGTGGTGG - Intergenic
940999685 2:160188685-160188707 CACTTAAACCAGGGAGGCGGAGG - Intronic
941934304 2:170971243-170971265 CACTTGAATTATGGTGGCTGGGG + Intergenic
942892194 2:181004547-181004569 CACTTGAAACATGGAGGCGGAGG + Intronic
944099464 2:196007504-196007526 CAGGTAAATCTTGGTGGCTTTGG + Intronic
947421306 2:229943526-229943548 TTCATAAATCATGGTGGCTGTGG + Intronic
948851577 2:240710613-240710635 CACTTAAACCCTGGAGGCGGAGG + Intergenic
1169364094 20:4976890-4976912 CACTTGAATCAGGGGGGCGGAGG + Intronic
1169777546 20:9272535-9272557 CATGTAATTCAGGGTGGAGGAGG - Intronic
1170475458 20:16709785-16709807 CACTTAAATCCAGGAGGCGGAGG - Intergenic
1173628701 20:44493198-44493220 CACTTAAACCCAGGTGGCGGAGG + Exonic
1174167160 20:48593133-48593155 CACTTGAATCCTGGAGGCGGAGG + Intergenic
1174611800 20:51803142-51803164 GAGGTAAGTCATGGTGGTGGTGG - Intergenic
1181998472 22:26901795-26901817 CACGTGAATCAGGGAGGCAGAGG + Intergenic
1182594151 22:31405249-31405271 CACTTAAATCCTGGAGGCAGAGG - Intronic
1183864518 22:40693686-40693708 CACTTAAATCCAGGAGGCGGAGG - Intergenic
1184590949 22:45482880-45482902 CACTTAAATCCTGGAGGTGGAGG - Intergenic
1185315463 22:50177101-50177123 CACGTACATGATGGCGGCGAAGG - Exonic
1185386894 22:50537129-50537151 CACTTAAATCCGGGAGGCGGAGG + Intergenic
952706326 3:36380966-36380988 CACGCAATTCATGGTGGCTCCGG + Intronic
956599859 3:71009138-71009160 CAATGAAATCATGGGGGCGGGGG + Intronic
958606480 3:96364574-96364596 CACGTGCATCTTGGTGGCAGTGG - Intergenic
958780723 3:98538997-98539019 CACTTGAATCCTGGAGGCGGAGG - Intronic
959230728 3:103647729-103647751 CACTTAAATCCCGGAGGCGGAGG - Intergenic
959293533 3:104504996-104505018 CACTTGAACCAAGGTGGCGGAGG + Intergenic
959602063 3:108198523-108198545 CACTTAAACCCTGGAGGCGGAGG - Intronic
960311360 3:116120247-116120269 CAGGGAAATGATGGTGGTGGTGG + Intronic
960858159 3:122123905-122123927 AACTTAAATCATGGTGGAAGGGG - Intergenic
961837901 3:129679387-129679409 CACTTAAACCCTGGAGGCGGAGG - Intronic
962332276 3:134488523-134488545 CACGTGAATCCGGGAGGCGGAGG + Intronic
962525084 3:136230664-136230686 CACTTAAATCCAGGAGGCGGAGG + Intergenic
964134414 3:153328496-153328518 CACTTGAACCCTGGTGGCGGAGG - Intergenic
966192402 3:177283437-177283459 CACTTAAATCCGGGAGGCGGAGG - Intergenic
966483975 3:180447105-180447127 CATGTAAAGCATGGTGGTGGAGG - Intergenic
968016515 3:195339145-195339167 CACTTAAACCCTGGAGGCGGAGG + Intronic
969956799 4:10898755-10898777 CACTTGAATCCTGGTGGCGGAGG + Intergenic
971768025 4:30859521-30859543 CACTTAAATCTTGGAGGTGGAGG - Intronic
975451376 4:74530721-74530743 CACTTGAATCAAGGAGGCGGAGG + Intergenic
977466896 4:97393772-97393794 CACGTGAATCCAGGAGGCGGAGG - Intronic
980070504 4:128238578-128238600 CACTTAAATCAGGGAGGCAGAGG - Intergenic
980508622 4:133756853-133756875 CACTTAAATCCAGGAGGCGGAGG - Intergenic
984526218 4:180861822-180861844 AACTGAAATAATGGTGGCGGCGG + Intergenic
985239721 4:187917233-187917255 CAGGTAATTCTTGGTGGTGGAGG - Intergenic
987934415 5:24445725-24445747 CACGTGAACCCTGGAGGCGGAGG - Intergenic
990454096 5:55967878-55967900 CACTTAAATCCAGGAGGCGGAGG - Intronic
992175032 5:74141500-74141522 CACTTGAATCAGGGAGGCGGAGG + Intergenic
994503148 5:100605587-100605609 CACTTAAACCAGGGAGGCGGAGG + Intergenic
999169294 5:149580142-149580164 CACTTGAATCCTGGAGGCGGAGG - Intronic
1002375919 5:178789125-178789147 CACTTAAACCCTGGAGGCGGAGG - Intergenic
1003158935 6:3619026-3619048 CAAGCCAATCATGGTGGTGGTGG - Intergenic
1003159315 6:3621707-3621729 CAAGCCAATCATGGTGGTGGTGG - Intergenic
1005895480 6:30173614-30173636 CACTTAAACCAGGGAGGCGGAGG + Intergenic
1006561143 6:34913715-34913737 CACTTAAACCAGGGAGGCGGAGG - Intronic
1007106121 6:39284201-39284223 CACTTAAATCCGGGAGGCGGAGG + Intergenic
1007901006 6:45412826-45412848 CACTTGAATCTTGGAGGCGGAGG - Intronic
1009609835 6:65927219-65927241 AACTTAAATCATGGTGGAAGGGG + Intergenic
1011656409 6:89555891-89555913 CACATAAATCAAGGCGGGGGAGG + Intronic
1011824710 6:91292334-91292356 CAAGTAAATATTGGTGGTGGTGG - Intergenic
1012022877 6:93947399-93947421 CACTTTAATCAAGGTGGTGGTGG - Intergenic
1013269216 6:108530164-108530186 CACTTAAATCCAGGAGGCGGAGG + Intergenic
1013484537 6:110584098-110584120 CACTTAAATCCTGAAGGCGGAGG + Intergenic
1015959237 6:138630467-138630489 CACATGAATCAGGGAGGCGGAGG - Intronic
1016027367 6:139300809-139300831 CACTTGAATCAGGGAGGCGGAGG + Intergenic
1018858520 6:167693182-167693204 CACTTAAACCAGGGAGGCGGAGG + Intergenic
1019946261 7:4331547-4331569 CACTTGAATCTTGGAGGCGGAGG + Intergenic
1020222548 7:6251189-6251211 CGCGTGAATCCAGGTGGCGGAGG + Intronic
1022532225 7:31074168-31074190 AACGTGAATCATGGTGGAGGGGG + Intronic
1023432491 7:40109247-40109269 CACTTGAATCTTGGAGGCGGAGG - Intergenic
1025196940 7:56940986-56941008 CACCTACATCTTGGTGGCGCTGG - Intergenic
1025675007 7:63635951-63635973 CACCTACATCTTGGTGGCGCTGG + Intergenic
1026188106 7:68099500-68099522 CACTTGAATCCTGGAGGCGGAGG + Intergenic
1031065809 7:117104354-117104376 CACTTAAATCCAGGAGGCGGAGG + Intronic
1032714942 7:134500036-134500058 CACTTGAATCAAGGAGGCGGAGG + Intergenic
1036514686 8:9432916-9432938 CACTTGAATCCTGGAGGCGGAGG + Intergenic
1037186500 8:16069936-16069958 CACTTAAACCAAGGAGGCGGAGG + Intergenic
1039842614 8:41304624-41304646 CACGGAAGCCATGGTGGAGGAGG - Intronic
1042865070 8:73349697-73349719 CACCTGAATGGTGGTGGCGGAGG + Intergenic
1044039275 8:87346123-87346145 CACTTAAATCAGGGAGGCAGAGG - Intronic
1046956370 8:120066649-120066671 CACTTAAATCCTGGAGGCAGAGG + Intronic
1047632085 8:126718849-126718871 CACTTAAACCCTGGAGGCGGAGG + Intergenic
1051006156 9:12347442-12347464 CACGCAAAGGATGGTGGTGGGGG + Intergenic
1052846557 9:33341361-33341383 TAACTAAATCATGGTGGGGGAGG - Intronic
1053183793 9:35997155-35997177 CACTTGAACCATGGAGGCGGAGG - Intergenic
1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG + Intronic
1058997316 9:110312987-110313009 CACTTGAATCCGGGTGGCGGAGG - Intronic
1059088724 9:111333821-111333843 CAAGTATATCATTGTGGGGGAGG - Intergenic
1059439271 9:114295739-114295761 CACTTGAATCCTGGAGGCGGAGG - Intronic
1060529294 9:124339110-124339132 CACTTAAACCAGGGAGGCGGAGG - Intronic
1060569797 9:124628109-124628131 CACTTAAATCCAGGAGGCGGAGG - Intronic
1060582289 9:124760226-124760248 CACTTAAACCAGGGAGGCGGAGG + Intronic
1060593226 9:124832483-124832505 CACTTAAACCCTGGAGGCGGAGG + Intergenic
1185653213 X:1664055-1664077 CACTTAAATCTGGGAGGCGGAGG + Intergenic
1186305639 X:8254240-8254262 CACATAAATCTTCGTGGAGGTGG - Intergenic
1187629121 X:21148535-21148557 AACTTAGATCATGGTGGAGGGGG - Intergenic
1189996559 X:46644551-46644573 CACTTGAATCCTGGAGGCGGAGG + Intronic
1192740384 X:73886565-73886587 CACTTGAATCCTGGAGGCGGAGG + Intergenic
1196907006 X:120447322-120447344 CACTTAAACCCTGGAGGCGGAGG + Intronic