ID: 1083833335

View in Genome Browser
Species Human (GRCh38)
Location 11:65247611-65247633
Sequence CTGGGGCTGTGGAGGGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083833323_1083833335 7 Left 1083833323 11:65247581-65247603 CCATCGCTGCAGGAACTTGTCAT No data
Right 1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083833335 Original CRISPR CTGGGGCTGTGGAGGGAGAA CGG Intergenic
No off target data available for this crispr