ID: 1083835821

View in Genome Browser
Species Human (GRCh38)
Location 11:65266599-65266621
Sequence CAGTATGGACAGAATGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083835816_1083835821 13 Left 1083835816 11:65266563-65266585 CCAATTTTCCTTTCTACAGTGGT 0: 1
1: 0
2: 1
3: 30
4: 289
Right 1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 299
1083835817_1083835821 5 Left 1083835817 11:65266571-65266593 CCTTTCTACAGTGGTAGAGCTTT 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083835821 Original CRISPR CAGTATGGACAGAATGAGGA GGG Exonic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
903762271 1:25706997-25707019 CAGAAGAGACAGAATGGGGAGGG + Intronic
903818712 1:26084417-26084439 CAGAAGTGAGAGAATGAGGAAGG + Intergenic
906566213 1:46803044-46803066 CAGAATGGAGAGGATGAGGCTGG + Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
914927802 1:151904104-151904126 CATTAAGGAGAGAATGGGGAGGG + Intronic
915535554 1:156533425-156533447 GAGGAAGGACAGAATGAAGATGG - Intronic
915548313 1:156616386-156616408 CAGTGAGGACAGAATGAGAAAGG - Intergenic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919560331 1:199110234-199110256 CATTATTTAAAGAATGAGGATGG + Intergenic
920002823 1:202811232-202811254 TTGGATGGACCGAATGAGGATGG - Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920830150 1:209457222-209457244 CAGTGTGGAAAGAAAGAGAAAGG - Intergenic
921254277 1:213325406-213325428 CAGTATGGGCAGAAAGGGAAAGG - Intergenic
921878790 1:220230087-220230109 CGCTATGGCAAGAATGAGGAGGG - Intronic
921988236 1:221335700-221335722 CACTATGGCCAGAAAGGGGAGGG - Intergenic
922109745 1:222545519-222545541 GAGAGTGGACAGAATGAGCAAGG - Intronic
924611979 1:245580856-245580878 CAGCATGGGCAGAACGAGGAAGG - Intronic
1063074724 10:2703250-2703272 CAGGCTGGAAAGAATCAGGAAGG - Intergenic
1063235626 10:4112538-4112560 CATCCTTGACAGAATGAGGAAGG - Intergenic
1063504916 10:6588998-6589020 CATTATGTACATCATGAGGAGGG + Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063748066 10:8908846-8908868 AAATATGGAAAGAATGAGGAAGG - Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1067349378 10:45462240-45462262 GAGAAAGGTCAGAATGAGGAGGG + Intronic
1067627712 10:47937608-47937630 GAGTATGGAGAGTAGGAGGAGGG - Intergenic
1067723397 10:48747908-48747930 CAGAATGGCCTGAATGAGGATGG - Intronic
1068376941 10:56192513-56192535 CAGAATGGACAAAACAAGGAGGG - Intergenic
1070379586 10:75868773-75868795 CAGGATGGAGAGAGAGAGGAGGG - Intronic
1070521813 10:77260306-77260328 CAGGAAGGACAGAGAGAGGAAGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1072368251 10:94736832-94736854 CACTAGGGACAGCATGAGGGTGG - Intronic
1072422039 10:95297333-95297355 CAGCAGGGACAGAATGAACAAGG + Intergenic
1072478029 10:95782392-95782414 AGGTATGTCCAGAATGAGGAAGG + Intronic
1073398607 10:103238872-103238894 CAGAAAGGAGAGAGTGAGGATGG + Intergenic
1074225606 10:111481327-111481349 CTGTATGTACAGCATGAGCAGGG + Intergenic
1075466549 10:122655737-122655759 CAGCATGGACAACAAGAGGAAGG + Intergenic
1075528274 10:123203952-123203974 AAATATTGACAGAATGAGTAAGG + Intergenic
1075573759 10:123563588-123563610 CAGGACAGACAGAATGAGTAGGG - Intergenic
1075652436 10:124137638-124137660 CAGTAAGGAAAGGATTAGGAAGG + Intergenic
1076070444 10:127484332-127484354 CAGTCTGGACACCATGGGGATGG - Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1077280515 11:1742952-1742974 GAGGATGGACAGATGGAGGATGG + Intronic
1077280591 11:1743354-1743376 GAGGATGGACAGATGGAGGATGG + Intronic
1077474814 11:2781383-2781405 CCGTATGGAGAGGCTGAGGAGGG + Intronic
1077858651 11:6155657-6155679 CAGTATGGAGTGAAACAGGACGG + Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1077928160 11:6703302-6703324 CAGCATGGTCAGAAAGAAGAAGG + Intergenic
1078280157 11:9893168-9893190 CTGGCTGGACAGTATGAGGATGG + Intronic
1079252043 11:18793521-18793543 CTGCATGGAGAAAATGAGGAGGG - Intergenic
1079509348 11:21192894-21192916 CAGTGTCGAGAGAAAGAGGAAGG + Intronic
1080215611 11:29836617-29836639 CAGTAGGTAGAGGATGAGGAGGG + Intergenic
1080342007 11:31275400-31275422 CAGTATAGTAAGGATGAGGATGG - Intronic
1081297813 11:41413116-41413138 CAGAATGTAGAGAATGAGGATGG + Intronic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1083023269 11:59528683-59528705 CAGTATGGGCAGAACATGGAGGG + Intergenic
1083659918 11:64247168-64247190 CAATGAGGACAGAATGAGGAAGG - Intergenic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1084208263 11:67608533-67608555 CAGCCTGGACAGAATAGGGAAGG - Exonic
1084582678 11:70033755-70033777 CAATATGGAATGAATGAGCATGG - Intergenic
1084591011 11:70090329-70090351 TAGTCAGGAAAGAATGAGGATGG - Intronic
1088499414 11:110468300-110468322 CAGTAAGGAATGAATGAGCATGG - Intergenic
1088744389 11:112793383-112793405 CATTACAGACAGAATGAGGATGG + Intergenic
1088793312 11:113245714-113245736 GAGTATGGGCTGAATGAGGCTGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092402486 12:8188628-8188650 AAGTATGGAAAAAATGAGGTAGG + Intergenic
1092763898 12:11835462-11835484 CTGCATGGGCAGAATGAGGGAGG - Intronic
1092959640 12:13583842-13583864 CCGAATGGTCAGACTGAGGAAGG + Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1095359512 12:41319468-41319490 CAGTTTGTGCAGAATGATGAGGG - Intronic
1096327342 12:50676164-50676186 GAGTATGGATAAAATGAGAATGG + Intronic
1096973699 12:55686351-55686373 GAGGATGGAAAGATTGAGGAAGG + Intronic
1097349734 12:58535755-58535777 CAGTCTGGAAAGAGAGAGGAAGG - Intergenic
1097653159 12:62328724-62328746 CAGTTTTGACAGAAAGAGGAAGG + Intronic
1097670802 12:62535070-62535092 GGGCAAGGACAGAATGAGGAAGG - Intronic
1102555016 12:113721023-113721045 CAGCAAGGACAGAATGATGAAGG + Intergenic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1105881785 13:24612352-24612374 CAGCCTGGAAAGATTGAGGAAGG + Intergenic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1107813476 13:44221824-44221846 CAGTCGGGAGATAATGAGGACGG + Intergenic
1108022698 13:46144899-46144921 CAGTATGGACTGAACTTGGAAGG + Intronic
1108231368 13:48345881-48345903 TATTCTGGAGAGAATGAGGATGG + Intronic
1108476848 13:50828666-50828688 CCTTATAGACAGAATTAGGAAGG - Intronic
1110398581 13:75063024-75063046 AAGTAAGGAAAGAAAGAGGAAGG + Intergenic
1110654588 13:77982271-77982293 CAGAATGGATAAAATGAGAAAGG - Intergenic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1112253626 13:97807313-97807335 CAGAAATGACAGAATCAGGATGG + Intergenic
1113229283 13:108194936-108194958 CACTGTGGACAGAATGTTGATGG + Intergenic
1113370037 13:109715911-109715933 CAGTGGGGGCAGAATGAGGGAGG - Intergenic
1114403505 14:22432014-22432036 CAGCATGGGCCAAATGAGGATGG - Intergenic
1114675978 14:24440571-24440593 CAGCATGGGGAGAGTGAGGAAGG - Exonic
1114770240 14:25422478-25422500 CAATATGTAAAGAATGAGGTTGG - Intergenic
1117442698 14:55774838-55774860 CAGTGGGGAGAGGATGAGGAGGG - Intergenic
1124187680 15:27544291-27544313 GAGTCTGCACAGAATGAGGCTGG + Intergenic
1124376090 15:29129736-29129758 CAGAATGGGCAAAATGAAGATGG - Intronic
1124685340 15:31777510-31777532 CAGGATGGACAGAAAATGGAGGG + Intronic
1124810805 15:32936317-32936339 CAGTCTGTAAAGAATGAGAATGG - Intronic
1125225502 15:37390734-37390756 CAGGAAAGACAGAATGAGGAGGG + Intergenic
1125895482 15:43298322-43298344 CAGCAGGGCCAGGATGAGGAGGG + Intronic
1126313305 15:47340794-47340816 CAGAAAGGACAGAGTGAGGGTGG - Intronic
1127508841 15:59620526-59620548 CAATATAAACAAAATGAGGATGG - Exonic
1127876537 15:63116484-63116506 AAGTATGGGCAGAAAGAGAAGGG - Intergenic
1129081373 15:73044160-73044182 CAGAATGGGCAGAATGACTAGGG - Intergenic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1129638676 15:77351376-77351398 AAGTATGATCAGAATGAGGCAGG + Intronic
1129770369 15:78199882-78199904 CAGCATGCACACAATGAGGCAGG - Intronic
1131380058 15:91956039-91956061 CAGCAAGGACAAGATGAGGAGGG + Intronic
1131724317 15:95205321-95205343 CAGTATGGCCAGAATAAAGCAGG + Intergenic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1135464623 16:22674731-22674753 CAGTAGGGATAGTAAGAGGAGGG + Intergenic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140653578 16:77115900-77115922 CAGGCTGTACAGAATTAGGAAGG - Intergenic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1142621530 17:1168554-1168576 CAGTCTGGACTGAATGTGGTGGG + Intronic
1142975703 17:3642750-3642772 CAGCAAGGGCAGAATGAGGTTGG - Intronic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146812999 17:35918400-35918422 CAGTATGGCCAAGAGGAGGAAGG - Exonic
1147193362 17:38749396-38749418 CAGGAGGGAGAGAACGAGGAGGG + Exonic
1148954980 17:51346077-51346099 CTGTAAGGACTGAATGTGGAAGG + Intergenic
1150580463 17:66469116-66469138 GAATGTGGACAGAAAGAGGAAGG - Intronic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1153879550 18:9408473-9408495 AAGTAGGGAGAGAATGAAGAAGG + Intergenic
1159737344 18:72115804-72115826 AAGGAAGGAAAGAATGAGGAAGG - Intergenic
1160477944 18:79209611-79209633 CAGAATGGACAGGATGGGGCCGG - Intronic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162507113 19:11092261-11092283 CAGTTGGGACAGAGTGTGGAAGG - Intronic
1162832163 19:13292136-13292158 CAGGGTGGACAAAATGAGGGTGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1164416622 19:28051038-28051060 CAGGCTGGACCCAATGAGGATGG - Intergenic
1166136033 19:40777911-40777933 CAGGATTGACAGAAAGAGGCTGG - Intronic
1168669621 19:58230704-58230726 CAGGATGGGCAAGATGAGGAGGG + Intronic
1168720640 19:58552985-58553007 CAGTAGGGAGAGCATGAAGAAGG - Intronic
925216437 2:2099989-2100011 GAGGATGGACAGGGTGAGGATGG - Intronic
926109080 2:10170682-10170704 CAGGTTGGAGAGAAGGAGGAGGG - Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
929448952 2:42023914-42023936 CAGAAAAGAAAGAATGAGGAAGG + Intergenic
929903651 2:46027389-46027411 AAATAGGGACTGAATGAGGATGG + Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930082176 2:47459880-47459902 CAAGATGAAAAGAATGAGGAAGG - Intronic
930382008 2:50641903-50641925 CAGAATGGACAGCATCAAGAAGG - Intronic
932113340 2:69021947-69021969 AAGTATGCAGAGAATGGGGAAGG - Intronic
934577995 2:95415040-95415062 GAGGATGGACAGAATGACCAAGG - Exonic
934601443 2:95661662-95661684 GAGGATGGACAGAATGACCAAGG + Intergenic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935509453 2:103953028-103953050 AGGCATGGACAGAATGAGAATGG - Intergenic
937243532 2:120477640-120477662 CAGTATGTTCAGAAGGAGGCTGG - Intergenic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938137155 2:128768999-128769021 TAGTAAGGTCAGAATGAGCAGGG + Intergenic
939385072 2:141485678-141485700 CAGGATGGACAGAATCTGTAAGG - Intronic
939825040 2:147003944-147003966 AAATATGTACAGAATGATGATGG - Intergenic
939981304 2:148784945-148784967 CAGTATGGACAGAGTGCCAAAGG + Exonic
940006364 2:149012519-149012541 CAGAAAGGACTGGATGAGGAGGG - Intronic
940276906 2:151949115-151949137 AAGTATGGAAGGAAAGAGGAAGG - Intronic
945339464 2:208634682-208634704 CAGTTTGTTCAGAATGAGGCAGG - Intronic
945763076 2:213939127-213939149 AAGTATGGAAAAAATCAGGAAGG - Intronic
946427298 2:219606164-219606186 CAGGAAGGGGAGAATGAGGAGGG - Intronic
947003251 2:225482594-225482616 GAGTAAGGAGAGAATGAGAAAGG - Intronic
947372904 2:229466547-229466569 CAGCATGGACAGTATGATCAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169211089 20:3766728-3766750 CAGGATGGATAGAATGTGGGGGG + Intronic
1169867236 20:10215266-10215288 CAGTATGGTGAGAAGGAAGAAGG - Intergenic
1172066333 20:32223291-32223313 CTGTCTGGAAAGAATGAGGGGGG - Intronic
1175251438 20:57612413-57612435 GGGTATGGCCAGAATCAGGAAGG + Intronic
1175585104 20:60132930-60132952 CAGAATGGAAAGTGTGAGGAAGG + Intergenic
1176693017 21:9940871-9940893 CAGTAAGGACTAAGTGAGGATGG + Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1177412446 21:20747719-20747741 CAGTAAAGTCAGAGTGAGGAAGG - Intergenic
1177806056 21:25875777-25875799 CAGAATGAACAGGAAGAGGAAGG + Intergenic
1178556222 21:33592693-33592715 TTGTATGAACTGAATGAGGAGGG + Intronic
1179050506 21:37885089-37885111 TAGGATGGACAGAATGAGATAGG - Intronic
1179227815 21:39471089-39471111 CAGAATGGACAGAAGAAGAAAGG - Intronic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1181660793 22:24346972-24346994 CAGTATGGAAAGAATTAATACGG + Intronic
1181781650 22:25198081-25198103 CAGCTGGGACAGAAGGAGGAAGG - Intergenic
1181901725 22:26161531-26161553 GAGAAGGGACAAAATGAGGAGGG + Intergenic
1183539667 22:38422857-38422879 CAGGATGGAGAGAATGAAGAGGG - Intergenic
1183578489 22:38707468-38707490 CTGTAAGGCCATAATGAGGATGG + Intronic
1183843423 22:40519519-40519541 CAGTTTGGACACAAGGAGGTTGG - Intronic
1184018015 22:41800471-41800493 CAGGAGGGACAGGACGAGGATGG + Intergenic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
950100562 3:10354048-10354070 CAGAGGGGACAGAATGAGCAGGG - Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950331328 3:12158449-12158471 CAGTATGGCCGGAGTGAGGGAGG + Intronic
950387560 3:12672188-12672210 CGGCATGGAGAGAATGATGAAGG + Intergenic
950454794 3:13086246-13086268 CAGAATGGACAGACTGAGGAGGG + Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
951558088 3:23941485-23941507 TATTTTGGTCAGAATGAGGAAGG + Intronic
951673164 3:25207577-25207599 TAGTATAGAAAAAATGAGGAGGG - Intronic
954406164 3:50346109-50346131 CAGTCTGGACATAGGGAGGATGG - Exonic
957389538 3:79546024-79546046 CAGTATGAATATCATGAGGATGG + Intronic
958916776 3:100058931-100058953 CAGTTTGGACAGCATGGAGAAGG + Intronic
962876978 3:139542630-139542652 CAGTATGTAAAGAAGAAGGAGGG + Intergenic
963207549 3:142652016-142652038 CATTATGGACACATTAAGGAAGG + Intronic
964351547 3:155807999-155808021 AAGTATGCACAGAATGATTAAGG + Intergenic
967395116 3:188999454-188999476 CAGTATGGACAGTATGCACAGGG + Intronic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969650186 4:8461796-8461818 GAGCATGGCCAGAATGAGGGTGG + Intronic
969778150 4:9374972-9374994 AAGTATGGAAAAAATGAGGTAGG - Intergenic
970434852 4:16023471-16023493 CAGTGTGGAGAGAATGAGGGAGG - Intronic
970606166 4:17683879-17683901 CAGCCTGGACAGCATGATGAAGG + Intronic
971344583 4:25800019-25800041 CAGGATAGACAGAAAGAAGATGG - Intronic
974341481 4:60619089-60619111 CAGTATGTACAGCATGAGAAAGG + Intergenic
975640672 4:76496759-76496781 AAGAATTGACTGAATGAGGAAGG - Intronic
976480907 4:85544021-85544043 TAGCATGGAGAGAATGAGAATGG - Intronic
976966223 4:91044524-91044546 CAGTCTGCACAAAATGAGGCTGG - Intronic
978479593 4:109174323-109174345 CTGTCAGGACAGAATGGGGAGGG - Intronic
978830706 4:113080870-113080892 CAGAATGGAGAGGAAGAGGATGG + Intronic
978852185 4:113352318-113352340 CAGAATGGACAGACCAAGGAGGG - Intronic
979704345 4:123703728-123703750 CAGTTTGAAAAGAATGAGCATGG + Intergenic
980365618 4:131801088-131801110 CAGTAAGGACTAAGTGAGGATGG + Intergenic
981792107 4:148549860-148549882 CAGCACGTACAGAATGAAGAAGG - Intergenic
982032599 4:151315549-151315571 TATTTTGGACAGAATTAGGATGG + Intronic
983795019 4:171851420-171851442 CAATATGGAGAGACTGATGAGGG - Intronic
984577914 4:181472802-181472824 TAGGATGGACATAATTAGGAGGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
990124827 5:52501371-52501393 CTGTCTGGAAAGAATCAGGATGG + Intergenic
990390871 5:55319028-55319050 CATTATGGGAAGAAAGAGGAAGG - Intronic
990832450 5:59974817-59974839 TAATATGGAAAGAATGAGAATGG - Intronic
991932657 5:71769150-71769172 CAGTATCTACAGAATTTGGAGGG + Intergenic
993711294 5:91228268-91228290 CAGTATGGGAAGAATGATCAAGG - Intergenic
994005663 5:94834699-94834721 CAATCTGGACAGAGTGTGGAGGG + Intronic
994981840 5:106885163-106885185 CAGTATGGAAATGGTGAGGAGGG + Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
995756807 5:115514135-115514157 CAGTAACAACAAAATGAGGATGG + Intergenic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
999132550 5:149295600-149295622 GAGAATGGAGAGAAAGAGGAAGG + Intronic
1000494764 5:161967975-161967997 CAGTGTGGCAAGAACGAGGATGG - Intergenic
1000664953 5:163983614-163983636 CAGTACGTGCAGAATGAGAAGGG + Intergenic
1001224536 5:169932402-169932424 AAGTAGGGAGAGAATGGGGAAGG + Intronic
1002467616 5:179415516-179415538 CAGTTTTCACTGAATGAGGAAGG + Intergenic
1002547932 5:179963943-179963965 CAGAAATGACAGAATGAAGAAGG - Intronic
1004295222 6:14403981-14404003 GAGTGAGCACAGAATGAGGAAGG - Intergenic
1005427994 6:25723951-25723973 CAGAAATGACAGAATAAGGAAGG + Intergenic
1006518096 6:34555734-34555756 CAGTCTGGGGAGCATGAGGAGGG + Intronic
1007381697 6:41494288-41494310 CAGTAGGGGCAGACTCAGGAAGG + Intergenic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1009748558 6:67852919-67852941 AAACATGGACACAATGAGGAGGG + Intergenic
1010342808 6:74776238-74776260 CAGTAGGGACAGATGGAGGCAGG - Intergenic
1011034700 6:82960390-82960412 GATTATGGAGAGCATGAGGAAGG - Intronic
1011144037 6:84191975-84191997 CAGTAAGGAAAGAAAGAGAATGG - Intronic
1011254390 6:85405892-85405914 GAGTAGGGGGAGAATGAGGATGG - Intergenic
1012512201 6:100014831-100014853 CAGGCTGGAGAGAAAGAGGAGGG + Intergenic
1013839788 6:114377746-114377768 AAGTCTGGTCAGAGTGAGGAAGG + Intergenic
1013867364 6:114714892-114714914 CACTCTGGTCAGAATGAGTAAGG - Intergenic
1013977649 6:116095354-116095376 AAGTATTTACAGAATCAGGAAGG + Intergenic
1016878911 6:148890661-148890683 AATATTGGACAGAATGAGGACGG - Intronic
1017017238 6:150111429-150111451 CAGGATGCACAGAATGTTGATGG - Intergenic
1017325743 6:153139767-153139789 GGGGATGGACAGAATGCGGAAGG + Intergenic
1017402526 6:154080625-154080647 CAGAATGGAAAGAATGCTGAAGG - Intronic
1017894560 6:158668114-158668136 CAGTAAGAACAGAGTGAAGATGG + Intronic
1020644566 7:10799045-10799067 CAGGATGGCCAGAATGACAAGGG + Intergenic
1021356119 7:19654968-19654990 AAGTATGTACAGAATCAGGAAGG - Intergenic
1021807703 7:24373540-24373562 CAGACAGGACACAATGAGGACGG - Intergenic
1022421061 7:30223849-30223871 CAGTATGTGTAGAATGAGAAAGG + Intergenic
1022811068 7:33869529-33869551 CATTATGGACCGAATGTAGATGG + Intergenic
1024513995 7:50228079-50228101 CAGAAAGGACAAAATGAGGAAGG - Intergenic
1026019161 7:66694683-66694705 CAGTAGGGAGAGAATGAAGTCGG + Intronic
1026199895 7:68205638-68205660 ACTTATGAACAGAATGAGGACGG - Intergenic
1030114848 7:106055357-106055379 AGATATGGAAAGAATGAGGAGGG - Intergenic
1034276718 7:149827069-149827091 CAGTGTGGACAGACAGGGGAGGG - Intergenic
1036275607 8:7348968-7348990 AAGTATGGAAAAAATGAGGTAGG - Intergenic
1036345739 8:7961389-7961411 AAGTATGGAAAAAATGAGGTAGG + Intergenic
1036841074 8:12122143-12122165 AAGTATGGAAAAAATGAGGTAGG + Intergenic
1036862874 8:12368395-12368417 AAGTATGGAAAAAATGAGGTAGG + Intergenic
1037572607 8:20171421-20171443 CAGGAAGGCCAGGATGAGGAAGG + Exonic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039824059 8:41158012-41158034 GAGTTTGGAAAGAGTGAGGAAGG - Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1044173116 8:89081657-89081679 AAGTAAGGAAAGAAAGAGGAAGG - Intergenic
1045559205 8:103244675-103244697 CTGTAAGCACAGAATGATGAAGG + Intergenic
1045827388 8:106414829-106414851 GAGTATGGACTTAATTAGGAAGG + Intronic
1046109918 8:109710280-109710302 CAGTCTTGACAGGATGAGCAGGG - Intergenic
1049328588 8:142037867-142037889 CAGTAAGGACAGAGGGAGGTGGG - Intergenic
1049529502 8:143147331-143147353 GAGTTTGGAGAGAAGGAGGATGG + Intergenic
1050085485 9:1960483-1960505 CAGTCTGGCCTGAATGAGAAGGG + Intergenic
1052484317 9:29076499-29076521 CAGAAGGAACAGAATGAGTATGG + Intergenic
1052763944 9:32621209-32621231 AAGTATGGAAAGAAAGAGGTGGG + Intergenic
1053416403 9:37949584-37949606 CAGCATGGACAGAAGCAGCAAGG + Intronic
1053629972 9:39926958-39926980 CAGTAGGGACTAAGTGAGGATGG + Intergenic
1053775800 9:41536574-41536596 CAGTAGGGACTAAGTGAGGATGG - Intergenic
1054213915 9:62323744-62323766 CAGTAGGGACTAAGTGAGGATGG - Intergenic
1054673562 9:67831632-67831654 CAGTAAGGACTAAGTGAGGATGG + Intergenic
1059037356 9:110769431-110769453 CAGCATTGACAGAATAAGAAGGG + Intronic
1060481933 9:124021550-124021572 GAGTGTGGAGACAATGAGGATGG - Intronic
1061112534 9:128584952-128584974 CAGTTAGGAAAGAATGGGGATGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1185728467 X:2442242-2442264 CAGCATGGAGACGATGAGGATGG - Intronic
1188009165 X:25039465-25039487 CAGTATGGAGAGAAGGACGGTGG + Intergenic
1188153306 X:26707175-26707197 CAGTATAAAAAGTATGAGGAAGG + Intergenic
1188810749 X:34651503-34651525 CAGATAGGACATAATGAGGATGG - Intronic
1189647553 X:43150316-43150338 CAGTATTGTCAGTATGAGGCAGG - Intergenic
1192266155 X:69539227-69539249 CAAAATGGTCAGAATGTGGAAGG - Intergenic
1195109911 X:101637689-101637711 GAGTCTAGAGAGAATGAGGAAGG - Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1197919272 X:131573645-131573667 GAGAATGGACATAATGAAGATGG + Intergenic
1197947988 X:131861497-131861519 CAGTATCCACAGAGTGATGAAGG + Intergenic
1199013549 X:142785237-142785259 GAATATGGAAAGAATGTGGATGG - Intergenic
1199872060 X:151907501-151907523 AAGAATGGACATAATGAGAAAGG - Intergenic
1200142017 X:153907121-153907143 TATTAGGGAGAGAATGAGGAGGG - Exonic
1201254278 Y:12091682-12091704 CAGGAATGAGAGAATGAGGAGGG - Intergenic
1201303837 Y:12533976-12533998 CAATGTGGACAGAATGACCAAGG + Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic