ID: 1083836637

View in Genome Browser
Species Human (GRCh38)
Location 11:65273402-65273424
Sequence GCATCCTTGAGAACTGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083836637 Original CRISPR GCATCCTTGAGAACTGGTAC TGG Intronic
903153543 1:21429518-21429540 ACATCATTGAGAAGTGGTAGTGG + Intergenic
907783731 1:57591511-57591533 GTATCCTAGAGCAATGGTACAGG + Intronic
909137997 1:71826068-71826090 GCATCCAGGAGACCTGGCACTGG - Intronic
911521956 1:98940219-98940241 GCATACTTGAGTACTGGTGTGGG + Intronic
913404049 1:118468769-118468791 GCAGCCTCTAGAACTGGAACAGG + Intergenic
922809421 1:228407374-228407396 GCCTCCTGGAGAGCTGGTCCTGG - Intergenic
1063056025 10:2505321-2505343 GCCTCCTTGAGAAAAGGTTCAGG + Intergenic
1063478987 10:6354652-6354674 GAATGCTTGGGAACTGGGACTGG + Intergenic
1067716200 10:48692845-48692867 GCAGCCTTGAAAACTGGAAGGGG + Intronic
1070903943 10:80055213-80055235 ACATCCTTGACAACTCTTACTGG - Intergenic
1072617625 10:97060048-97060070 GCTTCCTGGGGAGCTGGTACAGG - Intronic
1072732102 10:97853135-97853157 TCAGGCTTGAGCACTGGTACAGG + Intronic
1074478930 10:113800613-113800635 GTATACTTGAAAACTGCTACGGG - Intergenic
1075200659 10:120401045-120401067 GCTTCCTTTAGAAATGGAACTGG + Intergenic
1076066023 10:127448429-127448451 GCATCCTTGAGAACCAGGAGAGG - Intronic
1076393384 10:130120516-130120538 GCACCCTGGAGAACTGGAATTGG - Intergenic
1079567713 11:21903099-21903121 GCATCCTGCTGAGCTGGTACAGG - Intergenic
1083836637 11:65273402-65273424 GCATCCTTGAGAACTGGTACTGG + Intronic
1092112045 12:5970825-5970847 GCAGCCTTGGGAGCTGGTGCTGG - Intronic
1092864527 12:12748391-12748413 GCAACCTTGAGAACAAGTAGAGG - Intronic
1093965267 12:25317606-25317628 GCATTCATGAGAACTAGTTCTGG + Intergenic
1096614155 12:52822253-52822275 GCATGCTTTAGGACAGGTACAGG + Intronic
1103222260 12:119255578-119255600 GCATCCTTGACAACATGTGCTGG + Intergenic
1106795375 13:33199876-33199898 GCATCCTGGACCATTGGTACTGG - Intronic
1107982232 13:45744732-45744754 AAATTTTTGAGAACTGGTACAGG + Intergenic
1112963733 13:105161221-105161243 GCATAAATGAGAACCGGTACTGG + Intergenic
1116867072 14:50039840-50039862 TCATCCTTGGGGACTGGTGCTGG + Intergenic
1120441159 14:84541844-84541866 TCTTCCATGAGAGCTGGTACTGG - Intergenic
1127848455 15:62891972-62891994 GCATCCTTAAGAAATTGTATTGG + Intergenic
1129395753 15:75245115-75245137 GCATGCTTGAGACCTGGCGCTGG + Intergenic
1131470319 15:92690993-92691015 GCATCCTTGAGAGCTGATCCTGG - Intronic
1132558412 16:582730-582752 GCCTCCTTGGGAACTGGGACTGG + Intronic
1132852240 16:2030001-2030023 GCATCCTGGAGAAGAGGAACAGG - Intronic
1140036809 16:71377518-71377540 CCTTCCTTGAGAACGGGTGCTGG - Intronic
1145749040 17:27342094-27342116 GCCTCCCTGAGAACTGCTCCGGG + Intergenic
1145942209 17:28748516-28748538 GCAGCCTTGGGCACTGGTACTGG - Exonic
1156031427 18:32717612-32717634 GCATCATTGAGATCTGGAAGGGG - Intronic
1156076187 18:33282255-33282277 GCCTCCTCGAGAAGTGGTAAGGG + Intronic
1156588661 18:38461070-38461092 GAATCCTTTAGGGCTGGTACTGG + Intergenic
1157389495 18:47289246-47289268 ACTTCCTTCAGAAGTGGTACAGG + Intergenic
1159373391 18:67559281-67559303 ACCTCCTTGGGAACTGGTGCTGG - Intergenic
1160320697 18:77891377-77891399 ACCTCCTTGAGAACAGGGACTGG + Intergenic
1160908079 19:1461047-1461069 GCATCCTTCGGAACTTGTCCTGG + Exonic
1164593272 19:29517747-29517769 GCATCCCTGAGAATGGGTCCTGG - Intergenic
1164743925 19:30597138-30597160 GCATGCTTGCGCACTGGTGCAGG - Intronic
1165931804 19:39363994-39364016 GCATCAGTGAGCACTGGAACTGG - Intronic
1166351221 19:42199321-42199343 GCATCTTTGAGGACTGCGACAGG - Exonic
925125398 2:1451577-1451599 GCATCATGGACAACTGGTATTGG - Intronic
927511677 2:23647922-23647944 GCATCTCTGAGTGCTGGTACCGG - Intronic
928162315 2:28939484-28939506 GTTTCCTTGATAACTGCTACGGG - Intronic
930041712 2:47130202-47130224 GCATATTTGGGAACTGGTGCAGG + Exonic
931615588 2:64153446-64153468 GAATCCTGGAGATCTGGAACAGG + Intergenic
932967505 2:76494205-76494227 ACAACCTAGAGATCTGGTACAGG - Intergenic
934924705 2:98374166-98374188 GCTCCCATGAGAACTGGAACTGG - Intronic
934952202 2:98584437-98584459 GCATCCTTGAGCCCTGGGAGAGG - Intronic
938063287 2:128268159-128268181 ACATCATTGAGAAGTGGTAGTGG - Exonic
939251124 2:139682790-139682812 GCATCCTGGAAAACGGGTAATGG - Intergenic
945667860 2:212764438-212764460 GCATTCTAGAAAACTAGTACAGG - Intergenic
946835471 2:223768148-223768170 GCATGGATGAGAACTGGCACGGG - Intronic
948029106 2:234801713-234801735 GGGTCCTTGAGAGCTGGCACAGG - Intergenic
1169705500 20:8499016-8499038 TCAACCTTGACAAGTGGTACAGG - Intronic
1170143823 20:13151523-13151545 TCATCCTTGAGAACTGGAGTTGG + Intronic
1171492722 20:25532532-25532554 GCAGCCTTGAGAAGTGGTGGGGG - Intronic
1177514374 21:22129527-22129549 GCATCCTTAAGTCCTGGTAAGGG - Intergenic
1182327498 22:29524788-29524810 GCATCATGGAGAACTGGCAGGGG + Intronic
1184289975 22:43493413-43493435 GCAGCCTTGAGCACTGGTGCTGG + Intronic
959639218 3:108612982-108613004 TGATTCTTTAGAACTGGTACAGG - Intronic
962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG + Intronic
963826082 3:149955468-149955490 GATTTCTTGGGAACTGGTACAGG + Intronic
964018913 3:151982931-151982953 GCATCCCTAAAAACTAGTACAGG + Intergenic
964662969 3:159141147-159141169 GCTTCCTTGAGAAATTGTATTGG + Intronic
965548774 3:169942540-169942562 TCAACCTTGAGAAATGGTTCTGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
982250390 4:153400277-153400299 GGATCCTGGAGAACTTGTAATGG + Intronic
985375347 4:189331406-189331428 TTTTCCTTGAGAACTGGTACAGG + Intergenic
994351299 5:98749270-98749292 GAATCCATGACAACTGGAACTGG - Intergenic
995355780 5:111236422-111236444 TCATCCTTGTGAATTGGTGCTGG - Intronic
998756029 5:145380103-145380125 GCAGCCTAGAGAAGTGGTAGGGG - Intergenic
999004965 5:147965833-147965855 GCATCCCTGAGTTCTGGTCCTGG + Intergenic
999236410 5:150100087-150100109 GCCTCCTGGATAACTGGCACGGG - Intronic
999630026 5:153561326-153561348 ACATCCTTGAGTACGGGTCCAGG - Intronic
1002647397 5:180666860-180666882 GCAGCCTTGAGGTCTTGTACAGG - Intergenic
1003635947 6:7831778-7831800 GCATCTTGGAGAACTGTTCCTGG + Intronic
1011183745 6:84651274-84651296 GTTTCCTTGAGAACTGGGACTGG + Intergenic
1014222904 6:118816211-118816233 GGATCCTTGAGAAATGGTCCAGG - Exonic
1014668354 6:124269115-124269137 GCAGCTTAGATAACTGGTACAGG - Intronic
1016424686 6:143921855-143921877 GCAGCCTTGAACACTTGTACTGG - Intronic
1016841000 6:148525435-148525457 GTATCTTTGAGAATTGATACTGG + Intronic
1017094424 6:150792003-150792025 GCATCATTGAGAAATGGAATTGG + Intronic
1019051510 6:169187051-169187073 GCATCCTGGAGAGCAGGTCCGGG + Intergenic
1020119913 7:5497304-5497326 GCATCCTGGAGAACCAGGACGGG - Intronic
1022496016 7:30853658-30853680 GCATCCTCAAGAGCTGGTCCTGG + Intronic
1022685024 7:32589194-32589216 GCTTCCTTGAGTGCTGGTGCAGG + Intergenic
1023980448 7:45066780-45066802 GCTTCCTTGAGAACTACCACAGG + Intronic
1028801538 7:94970843-94970865 GCATCCTTGAGTAGTGGAAATGG + Intronic
1030948903 7:115764525-115764547 TTATCTTAGAGAACTGGTACTGG - Intergenic
1034078312 7:148253540-148253562 GCCACCTTGAGCACTGGGACTGG - Intronic
1036676476 8:10838140-10838162 GCAGCCTTCAGAACTAGAACCGG - Intronic
1036812521 8:11877345-11877367 GTGTCCTTCAGAACTGGAACCGG + Intergenic
1037107507 8:15127482-15127504 TCATCTTTGGGAACTGTTACAGG + Intronic
1040012205 8:42671400-42671422 GGATCCTTGAGAACAGGAATTGG - Intergenic
1041285202 8:56253221-56253243 GCATGCTTCAGAAGTGATACAGG - Intergenic
1044603632 8:94030384-94030406 GCATCCCTGAGAACTGAGAAAGG - Intergenic
1049934927 9:492494-492516 GCATCCTTTAGAGCTGTTAAGGG + Intronic
1050272068 9:3956978-3957000 CCATCCTTGAGAACTTGCCCTGG + Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1059068582 9:111110591-111110613 ACATCCTAGAGAAATGGGACAGG - Intergenic
1060370965 9:123070617-123070639 GCAATGTTGAAAACTGGTACAGG + Intronic
1061074532 9:128333051-128333073 ACTTCCTGGAGAACTGGAACGGG - Intronic
1062371903 9:136243961-136243983 GCAGCCTTGAGAACTGTCCCTGG - Intronic
1189606834 X:42687193-42687215 GCATCATTGAAGACTGGTAATGG - Intergenic
1192040603 X:67617004-67617026 GAATCCTAGAAAACTAGTACCGG + Intronic
1195119687 X:101738059-101738081 GCCTGCTTGAGAACTGAAACAGG - Intergenic
1196795689 X:119500574-119500596 ACATCCTGGAGAACTGGTTGCGG + Intergenic