ID: 1083837160

View in Genome Browser
Species Human (GRCh38)
Location 11:65278218-65278240
Sequence TTCCCCAGTGTCTATGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083837160 Original CRISPR TTCCCCAGTGTCTATGGAGG TGG (reversed) Intronic
900779782 1:4610616-4610638 ATCCCCAGGGCCTTTGGAGGAGG - Intergenic
901881349 1:12195675-12195697 TTTTCCAGCCTCTATGGAGGAGG + Intronic
902812474 1:18896401-18896423 TTCCCCAGTGGCTAAGGTGAGGG + Intronic
902848694 1:19134714-19134736 TTCCCCACTGTCCACAGAGGAGG - Intronic
905364193 1:37439872-37439894 ATCCCCAGTGTATTTGGAGATGG - Intergenic
906906349 1:49898007-49898029 TTCCCCAGTGTTTCTGGTGGAGG - Intronic
907116508 1:51973117-51973139 CTCCCCAGTGCCTATGGTGGTGG + Intronic
907412802 1:54294457-54294479 TTTCCCATTGTCTTGGGAGGGGG - Intronic
912259008 1:108090431-108090453 TTCCCAAGTGTCTTGGGAAGAGG - Intergenic
913962571 1:143351797-143351819 CTCCCCAGTGACTAGTGAGGTGG - Intergenic
914056926 1:144177382-144177404 CTCCCCAGTGACTAGTGAGGTGG - Intergenic
914122220 1:144788984-144789006 CTCCCCAGTGACTAGTGAGGTGG + Intergenic
916156119 1:161850386-161850408 TACCCCAGTTTCTATAGAGGCGG + Intronic
916818966 1:168379597-168379619 TTCCCCAGTGCCTGTGGGTGGGG - Intergenic
919842855 1:201622202-201622224 ATGCCCAGTGACTATGGGGGTGG + Intergenic
920503921 1:206503021-206503043 TTTCCAAATGTCTGTGGAGGGGG + Intergenic
921327822 1:214005072-214005094 ACCCCCAGACTCTATGGAGGTGG + Intronic
1062821719 10:539537-539559 TTCCACAGTGCCCATGGGGGTGG - Intronic
1069684609 10:70309675-70309697 TTCCCCAGTTTCTCCAGAGGAGG + Intronic
1074997517 10:118770603-118770625 TTCCCCAGAGACAATGGAGGTGG + Intergenic
1075474683 10:122723979-122724001 TGCCCCAGAGTTTATGGAGGGGG + Intergenic
1076481509 10:130788135-130788157 ATCCCTATTGTCTCTGGAGGAGG - Intergenic
1076733964 10:132450615-132450637 TTCTCCAGGGTCCATGGTGGGGG - Intergenic
1077730297 11:4722921-4722943 ACCACCAGTGTCTATGCAGGTGG - Intronic
1078063577 11:8063167-8063189 TTTCCTCGTGTCTATGCAGGAGG - Intronic
1080763541 11:35275416-35275438 CACCCCAGTGTCTCTGAAGGAGG - Intronic
1081669353 11:44934576-44934598 TTAGTCAGTGTCTATTGAGGGGG + Exonic
1081749661 11:45500874-45500896 TACCCCAGTCTCTGTGCAGGTGG + Intergenic
1083837160 11:65278218-65278240 TTCCCCAGTGTCTATGGAGGTGG - Intronic
1084179121 11:67437788-67437810 CTCCCCAGTCTCTCTGGAGGAGG + Exonic
1084587815 11:70073279-70073301 CTCCCCAGTGACTCTGCAGGAGG - Intergenic
1084635216 11:70387642-70387664 TTCCCCATGGTCTAGGGAGCAGG - Intergenic
1084752530 11:71213747-71213769 TTCCTCTGTGTGGATGGAGGCGG - Intronic
1084768140 11:71325593-71325615 TTCCCCAGAGCCTTCGGAGGGGG + Intergenic
1085398864 11:76223222-76223244 TTCCCCAGTGACTAATGATGTGG + Intergenic
1087119645 11:94560173-94560195 TTTCCCAGTATGAATGGAGGCGG + Intronic
1090263000 11:125335119-125335141 TTCCCTAGTGTCCATGGTAGTGG - Intronic
1090637473 11:128699743-128699765 TTCCCCAGAGGCTATGGATAGGG + Intronic
1091356052 11:134938550-134938572 ATCCCCAGGGTCTGGGGAGGGGG - Intergenic
1095670298 12:44851665-44851687 TTCACCAGTCTATCTGGAGGAGG + Intronic
1095716283 12:45350270-45350292 TTCCCCATTGTCCAAGGAGAGGG + Intronic
1095968073 12:47882824-47882846 CTCCCCAGTCTCTAAGGAAGTGG + Intronic
1096409637 12:51367872-51367894 GTCCCCAGTGTTTATAGATGGGG + Intronic
1098698896 12:73597391-73597413 TTTCCCAGTATCTAGGGAAGAGG - Intergenic
1099112049 12:78573884-78573906 TTTCCCATTCTCTGTGGAGGGGG + Intergenic
1102777113 12:115529740-115529762 TTCCCCATGGTCTGTGGATGAGG + Intergenic
1103412850 12:120725116-120725138 TTCCCCAGAGGCTGTGAAGGTGG - Intergenic
1104248096 12:127062159-127062181 ATCCCCACTGTGTAAGGAGGGGG - Intergenic
1105313875 13:19239029-19239051 GACCCTAGTGTCCATGGAGGAGG - Intergenic
1111518812 13:89371972-89371994 TTCCTCTGTTTCTATGGAGTTGG - Intergenic
1114493746 14:23118942-23118964 TTCCCCAGACTCGATGTAGGCGG + Exonic
1116128630 14:40823958-40823980 TTCTGCAGTGTCTATGTAAGAGG - Intergenic
1119926659 14:78501169-78501191 TTTCACAGTTTCCATGGAGGAGG + Intronic
1121981805 14:98460933-98460955 TTCCCCAATGGCTATAGATGTGG - Intergenic
1122158235 14:99764017-99764039 TCCCCAAGTGTTTCTGGAGGAGG + Intronic
1122306182 14:100768241-100768263 TCCCTCAGTGTCCATGGAAGTGG - Intergenic
1123798509 15:23797861-23797883 TTCCCGAGAGGCTATGGAGGCGG + Intergenic
1124626039 15:31308086-31308108 TCCCCCAGAGTCTCTGCAGGTGG - Intergenic
1124695047 15:31857477-31857499 TTCCCGAGTGTGTAAGGGGGAGG - Intronic
1126428051 15:48550636-48550658 TCACTCAGTGTCAATGGAGGGGG - Intronic
1129523182 15:76198501-76198523 TCCCCCAGTCTCTCTGTAGGAGG + Intronic
1130375402 15:83324538-83324560 TTTCCCAGCGTCTAGGTAGGAGG - Intergenic
1131888710 15:96948692-96948714 TTCTGCAGTGTATATGGAGGTGG + Intergenic
1134768844 16:16786388-16786410 GTCCACTGTGGCTATGGAGGTGG + Intergenic
1135810914 16:25585971-25585993 TTCCCCGGTGTCTCTAGAGATGG + Intergenic
1138516471 16:57538012-57538034 TTGCCCAGAGTTTTTGGAGGTGG + Intergenic
1140984749 16:80147471-80147493 TTTCCCAGCGTCCATGGATGTGG + Intergenic
1141429110 16:83961787-83961809 TGCCCCAGCCTCTAAGGAGGGGG + Intronic
1142049755 16:87950831-87950853 GTCCCCAGTGTCTATCCAGAGGG - Intronic
1143713856 17:8753320-8753342 TTCCCCAGAGGAGATGGAGGAGG - Exonic
1146503923 17:33388248-33388270 TTCCCCAGAGCCTCTGGAGGGGG + Intronic
1147349970 17:39834899-39834921 TTCTCCAGAGCCTGTGGAGGAGG - Intronic
1147448245 17:40487986-40488008 TTGGCCAGTGGCTTTGGAGGTGG + Intronic
1147944891 17:44075335-44075357 TCCCCGAGTGCCTATGGAGCGGG + Exonic
1148627588 17:49081573-49081595 TTCCACAGTGCCCAAGGAGGAGG - Intergenic
1148759306 17:49991299-49991321 TACCCCAGTGTCTAGGCAGAGGG + Exonic
1150381280 17:64722109-64722131 TTCCTCAGGGTCTTTGTAGGAGG - Intergenic
1150775222 17:68075990-68076012 TTCCTCAGGGTCTTTGTAGGAGG + Intergenic
1152104206 17:78319268-78319290 TCCCCCAGTTTCCATGGAGAAGG + Intergenic
1152300102 17:79490655-79490677 TGCCCCAGTATCCATGCAGGAGG - Intronic
1154312921 18:13281557-13281579 TTCCCCACTGCCCATGCAGGTGG - Intronic
1154340465 18:13498399-13498421 TTCTCCAGTGTCTATGGCTGGGG - Intronic
1154340542 18:13498838-13498860 TTCTCCAGTGTCTACGGCTGGGG - Intronic
1156407304 18:36795249-36795271 TTCCCCAGTGGGTTTGGAAGAGG + Intronic
1157966565 18:52215471-52215493 CTGACCAGTGGCTATGGAGGTGG + Intergenic
1160978451 19:1805802-1805824 TTCCCCAGTCACCAAGGAGGCGG - Intronic
1161264538 19:3358376-3358398 ATCCTCAGTGTGTGTGGAGGGGG + Intergenic
1161294059 19:3510766-3510788 TTGCCCAGTGCCTGTGGGGGCGG - Intronic
1161358778 19:3834476-3834498 TTCAGCAGTGACTATGAAGGAGG - Intronic
1161466948 19:4436388-4436410 TTCCCCTGGCTCTGTGGAGGCGG + Intronic
1164624435 19:29716755-29716777 TTCCCCACTATCTCTGGGGGAGG - Intergenic
1165129059 19:33621227-33621249 TTCCCGAGTGTGTATGAAGAGGG + Intergenic
1166525704 19:43508192-43508214 TCCCATAGTGTCCATGGAGGAGG - Intronic
1167454902 19:49592891-49592913 TTCCCGTGTGTCTACGGAAGAGG + Intronic
1168647762 19:58071842-58071864 TTCCCCTGTGTCGCTGAAGGAGG - Intronic
1202696409 1_KI270712v1_random:130055-130077 CTCCCCAGTGACTAGTGAGGTGG - Intergenic
930155818 2:48106750-48106772 TTCCAGAGCCTCTATGGAGGAGG - Intergenic
931378411 2:61729214-61729236 ATCCCCAGTGTTGAAGGAGGGGG - Intergenic
934277572 2:91587080-91587102 CTCCCCAGTGACTAGTGAGGCGG - Intergenic
937311869 2:120907727-120907749 TTCCTCAGTGTAAATGGGGGTGG + Intronic
945198983 2:207262935-207262957 TTCCTCAGTGTCTTTGGTGGTGG - Intergenic
1168860907 20:1045477-1045499 ATTCCCAGAGTCTATGAAGGTGG + Intergenic
1168922242 20:1549746-1549768 TTCACCAGTTTCCATGGAGTGGG + Intronic
1169915295 20:10676729-10676751 TTCCTCATTCTCTAAGGAGGGGG - Intergenic
1171810774 20:29743202-29743224 CTCCCTAGTGTCTGTGGCGGTGG - Intergenic
1172853353 20:37982499-37982521 TTCCCCAGTGTGTTTGGATCAGG - Intergenic
1173005002 20:39133484-39133506 TTCGCCAGTGTGCATGCAGGAGG - Intergenic
1175372541 20:58501670-58501692 TTCCCCTGTGCGTGTGGAGGTGG - Intronic
1178208079 21:30493444-30493466 TTCCCCAGGGTCTTTGGCGATGG - Intergenic
1179073860 21:38099456-38099478 CTGCCCATTCTCTATGGAGGAGG + Intronic
1180052494 21:45337753-45337775 CTCCCCAGAGCCTCTGGAGGGGG + Intergenic
1180637025 22:17269572-17269594 TTCCCCAGTTACCCTGGAGGAGG - Intergenic
1181496366 22:23289424-23289446 TTCCCCAGGGTGTGTGGTGGAGG + Intronic
1184228604 22:43145363-43145385 TCACCCAGTGGCTAGGGAGGTGG - Intergenic
1184278392 22:43423480-43423502 TTCCCCCTTGTCTCTGCAGGTGG + Intronic
1185214144 22:49589015-49589037 TTCCCCAGGCTCTATGGGGCGGG - Intronic
957487952 3:80887236-80887258 TTCCCAAGTGTCCATAGATGAGG + Intergenic
959989580 3:112616127-112616149 AACCCCAGTGTCCATGGGGGAGG - Intronic
960364783 3:116757896-116757918 TTCCCAAGTTTCCATGGAAGGGG + Intronic
961512930 3:127414029-127414051 TGCCCCAGTGTATGTGGGGGTGG - Intergenic
962377567 3:134871285-134871307 TGCCCCTGTGTCTAGGCAGGTGG + Intronic
963454891 3:145533308-145533330 GTCCCCAGTGTCTATGCTTGGGG + Intergenic
969033171 4:4229268-4229290 CTCCCCAGTGACTAGTGAGGCGG + Intergenic
969685697 4:8672813-8672835 TCCCCCAGAGCCTTTGGAGGGGG - Intergenic
972149433 4:36070302-36070324 TTCCCCATTGTCTATGCACTTGG - Intronic
974447888 4:62010183-62010205 TTCCCCAGTGATTGTGCAGGAGG + Intronic
982444490 4:155474134-155474156 TTCCACAGTTTTTATGGAGAGGG + Intergenic
983280678 4:165677273-165677295 TTCCCCAGAGCCTCTGGAGAGGG + Intergenic
986424342 5:7615190-7615212 GTCCCCAGTGTTGAAGGAGGGGG - Intronic
990392974 5:55346336-55346358 TGCCTCTGTTTCTATGGAGGAGG - Intronic
993667642 5:90720937-90720959 TTCTTCGATGTCTATGGAGGTGG - Exonic
999089442 5:148922622-148922644 TTCCACAGTGTCCAGGGAGATGG + Intergenic
1001238156 5:170047132-170047154 TGCCCAAGTGTGCATGGAGGTGG + Intronic
1001711431 5:173781650-173781672 TACCCCAGTGTCTAGAGAGGAGG + Intergenic
1001964498 5:175900829-175900851 TTCCCCAGTTCCCATGGAGAGGG + Intergenic
1002437675 5:179241967-179241989 CTCCCCAGTGGCTGTGGTGGGGG + Intronic
1002446047 5:179290769-179290791 ATCCCCAGTGTCCAGGGAGCAGG + Intronic
1005526318 6:26654131-26654153 TTCCCCATTGTCAATGAAGAAGG + Intronic
1007245714 6:40460726-40460748 TATCCCAGGGGCTATGGAGGGGG - Intronic
1011015691 6:82752094-82752116 TTCTCCAGTGACTGTGGAGAAGG - Intergenic
1016224851 6:141722788-141722810 GTCCCCAGTGTTGAAGGAGGGGG + Intergenic
1017485742 6:154900595-154900617 TTCCCTAGTGGCCAGGGAGGTGG + Intronic
1017688379 6:156936733-156936755 TTGCCTAGTTTCTATGGAGAAGG + Intronic
1017956870 6:159185899-159185921 ATCCATAGTGTCTATGGTGGTGG + Intronic
1021761939 7:23910724-23910746 TTCCCCAGTGTGTCCGGAAGTGG + Intergenic
1023664966 7:42513397-42513419 TTCCCCTGTGTGTGTGGAGTGGG + Intergenic
1028838773 7:95403357-95403379 CTCCCCAGTGTTTTTTGAGGGGG + Intergenic
1029361662 7:100092633-100092655 ATCCCCAGTGTCTATACTGGGGG + Intergenic
1029601100 7:101563896-101563918 TTCCCCAGGGGCTGTGGAGAGGG - Intergenic
1034528291 7:151679713-151679735 TTCAGCATTGTCCATGGAGGAGG - Intronic
1035375033 7:158402118-158402140 TTCCCAGGTGTGTTTGGAGGGGG - Intronic
1035603928 8:916706-916728 TTCTCCAGTGTCAATGCAGAGGG + Intergenic
1043237898 8:77892007-77892029 GTACCCAGACTCTATGGAGGAGG + Intergenic
1047142788 8:122160769-122160791 TTCCACAGTCTCTATGGGGATGG + Intergenic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1047275245 8:123400775-123400797 TGTCACAGTGTCCATGGAGGAGG - Intronic
1047297009 8:123579787-123579809 ATCCCCAGTGTCTAATGATGTGG + Intergenic
1048397722 8:134030575-134030597 TTAGGCAATGTCTATGGAGGGGG - Intergenic
1048756847 8:137748784-137748806 TTCCTCTGTTTCTATGGAGATGG + Intergenic
1050016703 9:1241360-1241382 TCCCCCAGTGTCAATGGGGATGG + Intergenic
1051401050 9:16683004-16683026 TTCCCCAGTGGCTTTTGAAGTGG - Intronic
1052786516 9:32833075-32833097 TTCCCCATTGTCTCTGCAGAAGG - Intergenic
1053456632 9:38238090-38238112 TTCCTCTGTGTATATGGGGGAGG + Intergenic
1055060017 9:72058794-72058816 TTCCCAAGTGTCTTTAGATGAGG - Intronic
1056923454 9:90812464-90812486 CACCCCAGTGTCCTTGGAGGTGG - Intronic
1057013133 9:91625229-91625251 TTTCCCTGTGTCTATTGAGATGG + Intronic
1057101448 9:92364545-92364567 TTCCCCTGTGTGTATGGAACTGG + Intronic
1057225264 9:93289566-93289588 GCCCCCAGTGCCTAAGGAGGCGG + Exonic
1059199390 9:112400151-112400173 TTCCCCAGTTACTAATGAGGTGG - Intronic
1059733122 9:117076016-117076038 ATCCCCAGGGCCTATGGAGCAGG - Intronic
1059939980 9:119349252-119349274 TTCCCCTGTGTGTATCTAGGAGG - Intronic
1061327415 9:129872694-129872716 TTTCACAGTGTGCATGGAGGGGG + Intronic
1061574751 9:131499121-131499143 TTCCCCAGTGTCCCTAGAAGTGG - Exonic
1061728776 9:132597239-132597261 TGCACCAGTGTCCCTGGAGGAGG + Intronic
1185516347 X:701812-701834 TTCCCCAGAACCTATGGAGGTGG + Intergenic
1186384460 X:9094663-9094685 TGTCCCAGTTTCTCTGGAGGGGG - Intronic
1186714806 X:12240367-12240389 ATCCCCAGTGTCTATAAGGGAGG + Intronic
1187822504 X:23303106-23303128 TTCCCAAGGGGCTATGGAGTGGG - Intergenic
1191899210 X:66023351-66023373 CCCCCTAGTGTCTGTGGAGGAGG + Intronic
1200698206 Y:6379779-6379801 ATCCCCAGTGAATTTGGAGGTGG - Intergenic
1200981580 Y:9267486-9267508 ATCCTCAGTGACTTTGGAGGCGG - Intergenic
1200982173 Y:9272419-9272441 ATCCCCAGTGAATTTGGAGGTGG - Intergenic
1201035907 Y:9784920-9784942 ATCCCCAGTGAATTTGGAGGTGG + Intergenic
1201058101 Y:10015959-10015981 TTCCCCAGTGTTGATGGCTGTGG + Intergenic
1202128238 Y:21587308-21587330 ATCCCCAGTGAATTTGGAGGTGG + Intergenic