ID: 1083838979

View in Genome Browser
Species Human (GRCh38)
Location 11:65292287-65292309
Sequence GCAAACAGGACGAGAACCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083838979_1083838985 -8 Left 1083838979 11:65292287-65292309 CCCGCGGTTCTCGTCCTGTTTGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1083838985 11:65292302-65292324 CTGTTTGCGGGAGCAGCTGGAGG 0: 1
1: 0
2: 0
3: 16
4: 201
1083838979_1083838987 16 Left 1083838979 11:65292287-65292309 CCCGCGGTTCTCGTCCTGTTTGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1083838987 11:65292326-65292348 CCCTCCCGCTGTGACGTACGAGG 0: 1
1: 0
2: 0
3: 1
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083838979 Original CRISPR GCAAACAGGACGAGAACCGC GGG (reversed) Intronic
917543390 1:175937071-175937093 GGAAAGAGGAAGAGAGCCGCAGG + Intergenic
1064258051 10:13761782-13761804 GCAAATAGGATGATAACTGCAGG - Intronic
1064973623 10:21090799-21090821 ACAAACAGGAAGTGAACAGCAGG - Intronic
1069789515 10:71010741-71010763 GCAAAGAGGACAAGGACCCCTGG - Intergenic
1077741561 11:4851361-4851383 CCAAAGAGGACCAGAACCTCAGG - Intronic
1078903626 11:15664232-15664254 GAAAACAGGAAAAGAACAGCAGG - Intergenic
1081101035 11:39002324-39002346 GAAAACAGGAAGAGAACTGCAGG - Intergenic
1083838979 11:65292287-65292309 GCAAACAGGACGAGAACCGCGGG - Intronic
1087234442 11:95702555-95702577 GCAAACAGAAAGATAACCTCAGG + Intergenic
1104341576 12:127954785-127954807 GCAAACTGGAAGAGAACTGCTGG + Intergenic
1112725492 13:102299541-102299563 TCAAACAGGAGTAGAACCACTGG + Intronic
1121358755 14:93235905-93235927 GAAAACAGGAGGAGAAATGCTGG - Intergenic
1122464945 14:101925729-101925751 ACAAACAAAACGAGAACTGCTGG - Exonic
1136618375 16:31412043-31412065 GCAAACAGGGTGAGGACCTCGGG - Intronic
1138251664 16:55506377-55506399 GTAAACAGCAAGAGAACCTCAGG + Exonic
1140414533 16:74764826-74764848 GTAAACAGGACTAGAAACCCAGG + Intronic
1141154558 16:81588132-81588154 TCAAACAGAACGAGACCCTCCGG + Intronic
1142073305 16:88103267-88103289 ACAAACAGGACCAGAGCCGAAGG - Intronic
1143204064 17:5130977-5130999 GTAGACAGGACCAGAACCTCAGG - Intronic
1143557843 17:7673674-7673696 GCAAGCAGGACAAGAAGCGGTGG - Intronic
1144021132 17:11240967-11240989 GGGAGCAGGAGGAGAACCGCGGG - Intergenic
1148766665 17:50043684-50043706 GCAAACAGGACAAGACCCCTGGG + Intergenic
1148766884 17:50044711-50044733 GCAAACAAGACAAGACCCCCGGG + Intergenic
1149051442 17:52310012-52310034 GCAAACAGCACGAGGACCCTGGG + Intergenic
1149848897 17:60023717-60023739 GCAAAAAGGTTGGGAACCGCTGG - Intergenic
1149861271 17:60122807-60122829 GCAAAAAGGTTGGGAACCGCTGG + Intergenic
1150413433 17:64966239-64966261 GCAAGCTGGACAAGAACCGACGG + Intergenic
1150798383 17:68258978-68259000 GCAAGCTGGACAAGAACCGACGG - Intergenic
1156803368 18:41145715-41145737 GCAAACATGACAAGACCTGCTGG - Intergenic
1164794606 19:31015653-31015675 GCCAACAGGACCAGAAAGGCAGG + Intergenic
931748869 2:65313789-65313811 TCAACCACGAGGAGAACCGCCGG - Exonic
933995232 2:87663296-87663318 GCAATCAGGCTGAGAACCTCAGG + Intergenic
936298628 2:111287617-111287639 GCAATCAGGCTGAGAACCTCAGG - Intergenic
941005857 2:160246203-160246225 GGAAACAGGACCAGAGCCACAGG + Intronic
948163062 2:235840939-235840961 GCAAACAGGACCAGAGAAGCGGG + Intronic
948514393 2:238494604-238494626 GCACACAGGAGCAGAAACGCAGG - Intergenic
1183747604 22:39700575-39700597 ACAAGCAGGACGAAAACCCCTGG - Intergenic
1184457592 22:44620510-44620532 GCAAACAGGACGTGTGCAGCCGG - Intergenic
953885924 3:46714368-46714390 CCACCCAGGACCAGAACCGCTGG + Exonic
961408022 3:126696800-126696822 GCAAACAAGAAGAGAAGGGCTGG - Intergenic
968879245 4:3290763-3290785 GCCTACAGGAGGAGAACCACAGG + Intergenic
969238184 4:5881815-5881837 GCACACAGGCTGAGAACCACTGG + Intronic
969663322 4:8543152-8543174 GCACACAGGCCATGAACCGCAGG + Intergenic
976003581 4:80401371-80401393 GCACACAGCACGAGAACCCTGGG - Intronic
977263925 4:94832178-94832200 CCAAAAAGGTTGAGAACCGCTGG + Intronic
990445485 5:55890147-55890169 GCAGACAGGACGGGAATCGCAGG - Intronic
992116251 5:73540943-73540965 GCAAACATGACCAGAACCAGAGG + Intergenic
993072425 5:83182046-83182068 CCAAACAGGAAGAAAACCTCTGG + Intronic
1011431740 6:87294596-87294618 GCAAAAAAGACCAGAACCCCTGG - Intronic
1022540340 7:31129018-31129040 GCAAACAGGAAGTGAGCTGCTGG - Intergenic
1032366085 7:131301322-131301344 GCACAAAGGTCGAGAACCTCTGG - Intronic
1034065954 7:148136595-148136617 GCAAAATGGACTAGAACAGCTGG + Intronic
1054853635 9:69874605-69874627 GCCAACAGGAAGAGAATCCCAGG - Intronic
1054870269 9:70042915-70042937 GCAAAGAGGCCGAGAAGCGGCGG + Intergenic