ID: 1083839176

View in Genome Browser
Species Human (GRCh38)
Location 11:65293750-65293772
Sequence GGTGTAATGAGTCCAAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083839171_1083839176 30 Left 1083839171 11:65293697-65293719 CCAAGGTGTGGCAGGGACACTGT 0: 1
1: 0
2: 2
3: 33
4: 223
Right 1083839176 11:65293750-65293772 GGTGTAATGAGTCCAAGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 97
1083839173_1083839176 1 Left 1083839173 11:65293726-65293748 CCTGCAGGCTACACCTGCTTAGA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1083839176 11:65293750-65293772 GGTGTAATGAGTCCAAGCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083839176 Original CRISPR GGTGTAATGAGTCCAAGCTG TGG Intronic
903352431 1:22725804-22725826 GGTGGAATGAGTAGAAGCTCGGG - Intronic
915854141 1:159363130-159363152 GGTTTCATGAGCCCAATCTGGGG - Intergenic
917487528 1:175468563-175468585 GGTGGAATTAATCCAATCTGAGG + Intronic
919455249 1:197813550-197813572 GGTGAAATGAGGGGAAGCTGTGG + Intergenic
920295348 1:204952865-204952887 GGAGAAATGAGGCCAAGCAGAGG + Intronic
920806162 1:209235901-209235923 TGAGTAATGAGTCAAAACTGAGG - Intergenic
1070143135 10:73753829-73753851 TATGTAAAGAGTCCAAACTGTGG - Intronic
1071219920 10:83453779-83453801 GGTGGAAGGAGTGCAAGCCGGGG - Intergenic
1076744876 10:132507799-132507821 GGTGGTAAGAGGCCAAGCTGAGG - Intergenic
1079987549 11:27214911-27214933 GTTGTTAGGAGTCCAAGCTCTGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1083839176 11:65293750-65293772 GGTGTAATGAGTCCAAGCTGTGG + Intronic
1088707529 11:112477355-112477377 GGTGGAGTGGGGCCAAGCTGGGG - Intergenic
1089584973 11:119504564-119504586 GGGGAAATGAGCCCAGGCTGGGG - Intergenic
1095397588 12:41778148-41778170 GGTGTACTGAGTAGAAGATGAGG - Intergenic
1098411834 12:70194287-70194309 GCAGTCATGAGGCCAAGCTGAGG + Intergenic
1101737400 12:107473336-107473358 GGTGAAATGAATCCATGCTGTGG - Intronic
1103025390 12:117569855-117569877 TGAGTAATGAGTCCAAGCACAGG + Intronic
1105718630 13:23092043-23092065 GATGGAATGAGTGCAAGCAGGGG - Intergenic
1108268630 13:48736802-48736824 AGTGTAATGTGTCCAAGATTGGG + Intergenic
1110560059 13:76901642-76901664 GATGGAATGAATCCAAGCTGTGG + Intergenic
1116554938 14:46291043-46291065 GGTGGTATTAGTCCAAGCTTTGG + Intergenic
1117967299 14:61219054-61219076 GAAGTAAACAGTCCAAGCTGTGG + Intronic
1123798565 15:23798144-23798166 GGTGTAATGAGGCAACGGTGGGG + Intergenic
1125065898 15:35486156-35486178 GATGGAATGAGTGCAAGCAGGGG + Intronic
1128023674 15:64415684-64415706 GGTGTAATCAGTTTAAGATGAGG - Intronic
1129242600 15:74260416-74260438 GGAGCACTGAGTACAAGCTGGGG - Intronic
1141587983 16:85047793-85047815 GTTGTATTTAGTCCAGGCTGGGG + Intronic
1146229506 17:31095327-31095349 GGTGGAATGGGTCCAGGCCGTGG + Exonic
1147887102 17:43691410-43691432 GGGAGAATGATTCCAAGCTGTGG + Intergenic
1149989021 17:61370059-61370081 GGTGCATTGAGTCACAGCTGTGG + Intronic
1151807714 17:76416907-76416929 GGTGCAGTGAGACAAAGCTGCGG + Intronic
1152998931 18:435377-435399 GATGGAGTGAGTCCAAGCAGGGG + Intronic
1158800523 18:60903098-60903120 GGTGTAATGAGCCCAAACATAGG + Intergenic
1160258284 18:77265812-77265834 GGTGTCCTGTGTCCCAGCTGTGG - Intronic
1160682314 19:417486-417508 GGTGTCCTGAGTCCTTGCTGTGG + Intronic
1161348936 19:3781928-3781950 GGTGTGAATAGTCAAAGCTGGGG + Intronic
1162452688 19:10764375-10764397 GCTGGAATGAGGGCAAGCTGCGG - Intronic
1164882056 19:31741043-31741065 TGCCTAATGAGTCCATGCTGAGG - Intergenic
926836855 2:17032527-17032549 GATGGAATGAGTGCCAGCTGGGG + Intergenic
932438925 2:71719580-71719602 AGGGCAGTGAGTCCAAGCTGCGG - Intergenic
933262124 2:80142400-80142422 GGTGTTATCAAACCAAGCTGGGG - Intronic
938081328 2:128371723-128371745 GGTGTAAGGAGACACAGCTGGGG + Intergenic
941381576 2:164799181-164799203 GCTGCATTGAGTCCAAGCTGGGG - Intronic
942683117 2:178499914-178499936 GGTAAAATGAGCCCTAGCTGTGG - Intronic
944337709 2:198556779-198556801 ACTGTAATGAGTCCAAGCAATGG + Intronic
945936307 2:215906000-215906022 AGTGTAATGACGCCCAGCTGCGG - Intergenic
1169194478 20:3675819-3675841 GAGGTAATGAGGCCAAGGTGAGG - Intronic
1170997818 20:21381291-21381313 GGTGAAGTGACTGCAAGCTGTGG + Intronic
1174528094 20:51189656-51189678 TGTGGACTGGGTCCAAGCTGTGG - Intergenic
1175263119 20:57687169-57687191 GGAGGAATGAGTTCAAGATGTGG + Intronic
1175678143 20:60964950-60964972 CGTGTCATGATACCAAGCTGAGG - Intergenic
1176423721 21:6535051-6535073 GATGTAATGAGGCTAAGATGAGG - Intergenic
1179699214 21:43143366-43143388 GATGTAATGAGGCTAAGATGAGG - Intergenic
1181392159 22:22591172-22591194 TGTGTAATTAGTCAAAGCTTAGG + Intergenic
1181443263 22:22949510-22949532 GGGGTGAGGAGTCCATGCTGGGG + Intergenic
1182453143 22:30432997-30433019 GGTGGAATGAAACCAAGATGGGG - Intergenic
950912587 3:16610122-16610144 GGTGTACTCAGTGCCAGCTGAGG + Intronic
951839393 3:27017478-27017500 GGTGTCATGGGTCTTAGCTGTGG - Intergenic
953873286 3:46646464-46646486 GGTGTGATGAGGCCGAGATGAGG + Intergenic
954438349 3:50507959-50507981 CGTGGAATGAATCCCAGCTGGGG - Intergenic
956410545 3:68974002-68974024 GGTGTAAGGGGTCCAGGCTTGGG - Intergenic
958023927 3:88028246-88028268 GGTTTTATGAGTACAAGATGGGG - Intergenic
962736555 3:138330170-138330192 GGTATAATGTGTGCAAGGTGGGG + Intergenic
963815918 3:149830894-149830916 GGTGTCCTGGGTCCTAGCTGTGG + Intronic
967815338 3:193793547-193793569 GGTTTAATTAGCCCAAGCTCAGG - Intergenic
969447356 4:7253004-7253026 AGTGTCAGGGGTCCAAGCTGTGG - Intronic
973573587 4:52264183-52264205 GGTCTGAAAAGTCCAAGCTGAGG + Intergenic
975040310 4:69738442-69738464 GATGGAGTGAGTCCAAGCAGGGG + Intronic
975715928 4:77205839-77205861 GATGTACTGAGTCCAAACTAGGG + Intronic
976645524 4:87383628-87383650 GGGGTTATGAGTCCAATTTGGGG + Intronic
977979449 4:103305820-103305842 TGTGTTGTGAGCCCAAGCTGTGG + Intergenic
978561871 4:110042381-110042403 GGTCTAATGAGTTCAACCTGAGG + Intergenic
978945780 4:114494403-114494425 GATGGAATGAGTGCAAGCAGGGG + Intergenic
982972993 4:162014615-162014637 GGTAGACTGAGTCCATGCTGTGG + Intronic
983048182 4:163011471-163011493 GGTGCCCTGTGTCCAAGCTGTGG - Intergenic
988018772 5:25596577-25596599 GATGGAGTGAGTCCAAGCAGGGG + Intergenic
996125260 5:119718754-119718776 GGAGTCATCAGTACAAGCTGTGG + Intergenic
997787724 5:136728816-136728838 TGTGAAATGAGGCCAAGCAGGGG + Intergenic
999012068 5:148054174-148054196 TGTGTCATGAGTGCAAGGTGTGG + Intronic
1006098712 6:31672247-31672269 GGTGTCAAGAGTCCAGCCTGGGG - Exonic
1007959096 6:45942422-45942444 GGGCTAATGAGTCCAAGCCCTGG - Intronic
1011359982 6:86512797-86512819 GGTGTTCTCAGACCAAGCTGAGG - Intergenic
1012251979 6:96990735-96990757 TGTGTTATGGGCCCAAGCTGGGG + Intronic
1014562464 6:122907794-122907816 GATGTAGTGAGTGCAAGCAGGGG - Intergenic
1015502057 6:133944932-133944954 GGGGTAATGAGTCCAGTCAGGGG + Intergenic
1016298954 6:142608173-142608195 GGTGTATTCAGTCCAAGCTAAGG + Intergenic
1021770186 7:23992151-23992173 GGTTTAATCAGTCTAAGATGGGG - Intergenic
1024556658 7:50609311-50609333 TGTGTAATGAAGCAAAGCTGAGG + Intronic
1026502390 7:70953743-70953765 GATGGAATGAGTGCAAGCAGGGG + Intergenic
1028577543 7:92369150-92369172 GGGCTAATAAGGCCAAGCTGTGG - Intronic
1029547521 7:101218069-101218091 CACGTAATGAGTCAAAGCTGTGG + Exonic
1037204587 8:16300109-16300131 GGTGTAATTAAACCAAGGTGCGG + Intronic
1038475279 8:27862006-27862028 GGTGTAATTGGTCCAAGCTTTGG - Intergenic
1038668463 8:29562230-29562252 GATTTAATCAGTCAAAGCTGTGG + Intergenic
1041127805 8:54662702-54662724 GGTGCATTGAATCCAGGCTGGGG + Intergenic
1049452718 8:142670591-142670613 GCTGTAATGAGTTGAGGCTGTGG + Intronic
1050938222 9:11425155-11425177 GGTGTCCTGTGTCCTAGCTGTGG - Intergenic
1051038010 9:12772709-12772731 GCAGTAATGAGTCCAGGATGGGG - Intergenic
1053305978 9:36985225-36985247 GGTGTAATAAGTGCTTGCTGAGG - Intronic
1056963076 9:91143696-91143718 GTTGTGATGAGTACAAGCTGTGG + Intergenic
1057627427 9:96690013-96690035 TGTGTAATGAGTTCAAGATTAGG + Intergenic
1058554839 9:106155991-106156013 GGAGAAGTGAGTCCAAGCTCAGG - Intergenic
1187311750 X:18151217-18151239 GGTGTATTGAGTCAAAACTTCGG + Intergenic
1192593698 X:72384302-72384324 GGTGTTTGGAGGCCAAGCTGTGG - Intronic