ID: 1083843188

View in Genome Browser
Species Human (GRCh38)
Location 11:65315974-65315996
Sequence GGGGTTCAGCGGGTCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083843188_1083843198 30 Left 1083843188 11:65315974-65315996 CCTACAGTGACCCGCTGAACCCC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1083843198 11:65316027-65316049 TATTGCAGTGGGATCTCCAGTGG 0: 1
1: 0
2: 2
3: 17
4: 104
1083843188_1083843195 18 Left 1083843188 11:65315974-65315996 CCTACAGTGACCCGCTGAACCCC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1083843195 11:65316015-65316037 TCTCACCTGCAATATTGCAGTGG 0: 1
1: 0
2: 4
3: 27
4: 260
1083843188_1083843191 -8 Left 1083843188 11:65315974-65315996 CCTACAGTGACCCGCTGAACCCC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1083843191 11:65315989-65316011 TGAACCCCGCTATTGTACATTGG 0: 1
1: 0
2: 0
3: 0
4: 26
1083843188_1083843196 19 Left 1083843188 11:65315974-65315996 CCTACAGTGACCCGCTGAACCCC 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1083843196 11:65316016-65316038 CTCACCTGCAATATTGCAGTGGG 0: 1
1: 0
2: 3
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083843188 Original CRISPR GGGGTTCAGCGGGTCACTGT AGG (reversed) Intronic
900549173 1:3245476-3245498 GCCCTTCAGCGGGTCACTGCGGG - Intronic
901426755 1:9186723-9186745 GGGCTGCAGCGGGTCTCTGCAGG + Intergenic
901442365 1:9286187-9286209 GGGGCTCAGCGGGTCCCCCTGGG - Intergenic
902241866 1:15095002-15095024 TGGGGTGAGCGGGGCACTGTGGG + Intronic
905385162 1:37597913-37597935 GGGGATCAGAGGGACAGTGTGGG - Intergenic
907240813 1:53080081-53080103 TGGCTTCAGCGGCTCCCTGTGGG + Intronic
908922542 1:69212813-69212835 TGGGTTAAGAGGGGCACTGTTGG + Intergenic
912449619 1:109761038-109761060 GGGATTGAGAGGGCCACTGTTGG - Intronic
1070425814 10:76286055-76286077 GGTGTACAGCAGGTCACTCTGGG + Intronic
1072919943 10:99568429-99568451 GGGGATCAGCTGGTCACCCTAGG - Intergenic
1073470552 10:103719501-103719523 GGGTCTCAGAGGGTCTCTGTTGG - Intronic
1074715012 10:116210385-116210407 GGGGGTCAGTGGGGCACTCTAGG - Intronic
1083843188 11:65315974-65315996 GGGGTTCAGCGGGTCACTGTAGG - Intronic
1084190485 11:67496385-67496407 GGGTTTCAGCTGGGCACTCTGGG + Intronic
1091763765 12:3104977-3104999 GGCGTTCAGCTGGTCACCCTGGG + Intronic
1096413543 12:51393696-51393718 GGGGTTCATCTGCTCACTCTTGG + Intronic
1098138563 12:67428441-67428463 GGGATCCAGCAGGTCTCTGTAGG + Intergenic
1108493621 13:51004278-51004300 GGGGATCAGCTGCTGACTGTCGG + Intergenic
1110403266 13:75118886-75118908 GGGGTTCTCAGGGTCAATGTTGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1117315217 14:54566341-54566363 GGGGACCCGCGGGTCACTGGGGG + Intergenic
1118626361 14:67662931-67662953 GGGTTTCAGAGAGTCACTATTGG - Intronic
1119856959 14:77908118-77908140 GGGGTTCAGCATGTCCCTGCAGG - Intronic
1121920583 14:97877262-97877284 CAGGTTCAGATGGTCACTGTTGG - Intergenic
1122156505 14:99753368-99753390 GGGGTCAAGCGGATCCCTGTGGG + Intronic
1122864935 14:104599440-104599462 GGGGTTCATGGGGTCAGTGGAGG - Intronic
1123475742 15:20591843-20591865 GGGTCTCTGGGGGTCACTGTGGG + Intergenic
1123642269 15:22408520-22408542 GGGTCTCTGGGGGTCACTGTGGG - Intergenic
1127271640 15:57407027-57407049 GGGGTAGAGCTGGTAACTGTTGG + Intronic
1132836020 16:1953941-1953963 GGGGCTCAGTGAGTCACAGTTGG - Exonic
1151953785 17:77370528-77370550 GGGGATCACCGGCCCACTGTAGG + Intronic
1152544783 17:80994982-80995004 GGGCCACAGCGGGTCACTCTCGG + Intronic
1152868029 17:82735799-82735821 GGGGCTCTGCGGGTCTCTGCGGG + Intronic
1157560509 18:48642308-48642330 GTGGTTCAGTTGGTCTCTGTGGG + Intronic
1159548540 18:69870838-69870860 GGAGTTCAGAAGGTCATTGTTGG + Intronic
1160729707 19:635602-635624 GGGGTGCAGGGGGTGTCTGTAGG - Intergenic
1163640655 19:18460258-18460280 GGGGGTCAGCAGGACACTGTTGG - Intronic
1165383170 19:35495213-35495235 GGGATTCAGGAGGTCACTGGAGG + Intronic
1168656737 19:58134883-58134905 GGAGTTCAGTGGGTCAATCTTGG - Intronic
926980118 2:18560064-18560086 GGGGTTCAGGGTGTCACCTTGGG - Intronic
928259154 2:29751017-29751039 GGGGTGCAGTGGCTCAGTGTCGG - Intronic
932758303 2:74423676-74423698 AGGGTTCAGAGGGTCAGGGTGGG + Intronic
933841784 2:86292776-86292798 GGTGGTCAGCGGGTATCTGTGGG + Intronic
936068622 2:109350498-109350520 GGGGGTCAGAGGGTCAAAGTGGG - Intronic
937279047 2:120704923-120704945 GGGGCACAGTGAGTCACTGTGGG - Intergenic
940133677 2:150412270-150412292 GGAGTTCAGCGGCTCAATCTCGG - Intergenic
945310273 2:208304199-208304221 GGAGTTCACTGAGTCACTGTCGG - Exonic
1170588370 20:17752608-17752630 GTGGTTGAGCTGGTCACTGCTGG + Intergenic
1174193589 20:48757394-48757416 GGGGTTCAGCAGGTGACTGATGG + Intronic
1174399471 20:50268149-50268171 GGGGCTCAGTGGGACACCGTGGG + Intergenic
1174873370 20:54204091-54204113 GGTGTGGAGCTGGTCACTGTGGG - Intergenic
1175154206 20:56958465-56958487 GGGGTCCAGCGGGCAGCTGTAGG - Intergenic
1175792113 20:61746248-61746270 GGGGGCCATGGGGTCACTGTGGG + Intronic
1176178273 20:63738650-63738672 GGGGTCCAGCGGGTCTGTGGTGG - Exonic
1176179862 20:63744725-63744747 GGAGGTCAGTGGGACACTGTTGG + Exonic
1180615161 22:17121525-17121547 GGGGTGCAGTGCGTCACAGTCGG + Intergenic
1182310093 22:29398220-29398242 TGGGGTCAGTGGATCACTGTTGG - Intronic
1203324463 22_KI270738v1_random:766-788 GGGGTTCAGTGGCCCACTTTAGG + Intergenic
950566404 3:13772251-13772273 GGGTGTCAGAGGGGCACTGTTGG + Intergenic
963001088 3:140682527-140682549 GTGGTTCACCAGGTGACTGTTGG - Exonic
966068611 3:175846988-175847010 GGGGTTAAGCTGGAGACTGTGGG + Intergenic
968866961 4:3219211-3219233 GGTGCACAGCGAGTCACTGTGGG + Intronic
970888408 4:21013427-21013449 GGGGGTCAGTGGGTCACTGAGGG - Intronic
980154968 4:129093384-129093406 GGCGTCCCGCGGGTCACTCTGGG + Exonic
983358223 4:166692574-166692596 AGGGTTCAGCTGGTCATAGTTGG - Intergenic
989170915 5:38469712-38469734 GGGGTTCAGAGAGCAACTGTGGG + Intergenic
999697276 5:154198297-154198319 AGGGTTCAGTGAGTCACTGTGGG + Intronic
1006256635 6:32837885-32837907 GGGGCTCAGCTGGTCACTGTGGG - Exonic
1006297516 6:33176517-33176539 GGGCCTCAGAGTGTCACTGTGGG + Intronic
1007964475 6:45991052-45991074 GGGGATCTGGGGGTCACTTTAGG - Intronic
1010432212 6:75790982-75791004 GGAGTGCAGTGGGTCAATGTCGG + Intronic
1012914283 6:105151857-105151879 GTGGTTCAGAGCTTCACTGTAGG - Intergenic
1013029369 6:106316872-106316894 GGTGTTCAGGGGGCCACTTTTGG - Intronic
1013068023 6:106702491-106702513 GGTGGTCAGCTGATCACTGTGGG + Intergenic
1019669635 7:2270565-2270587 GGGGTGCAGTGGGTCACAGGTGG - Intronic
1021505745 7:21382956-21382978 ATGCTTCAGTGGGTCACTGTTGG - Intergenic
1023041370 7:36175909-36175931 GGGGCTGAGCAGGTCACTGCCGG + Intronic
1023767899 7:43529084-43529106 GAGGTTGAGAGGGCCACTGTGGG - Intronic
1023865791 7:44237795-44237817 GGGGTTCTGCAGGCCTCTGTGGG + Intronic
1023933602 7:44723125-44723147 GGGGTGCAGCGGCACACTCTTGG + Intergenic
1024036198 7:45509442-45509464 GCAGGTCAGGGGGTCACTGTGGG + Intergenic
1025003438 7:55337235-55337257 GGAGTTCAGCTGGTGACGGTTGG - Intergenic
1037988331 8:23303349-23303371 GAGGTTCAGCAGGTCATAGTGGG + Exonic
1038295831 8:26290736-26290758 GGGGTTCAGAGGGACACGATTGG - Intergenic
1039946764 8:42136361-42136383 GGAGTTCAGTGGCTCACTGCAGG - Intergenic
1048076766 8:131079932-131079954 GGGATACAGGGAGTCACTGTAGG - Intergenic
1049029800 8:140025966-140025988 TGGGTTCAGAGGGTCAGTTTGGG - Intronic
1049234771 8:141507035-141507057 GGGGGTCAGGGGGTCCCTGCTGG + Intergenic
1049670768 8:143868843-143868865 GGGGTGTAGCGTGTCACTCTGGG - Exonic
1049694043 8:143975049-143975071 GGGGATCTGCGGGTCACGGAGGG - Intronic
1051604588 9:18907352-18907374 GGGGGTCAGCTGGTCCTTGTTGG - Intronic
1055051706 9:71988001-71988023 GGGGTTCAGTTAGTCACGGTTGG + Intergenic
1055467391 9:76579027-76579049 GGGGCTCTGGGGGTCAGTGTAGG - Intergenic
1056581534 9:87890393-87890415 GGGTCTCTGGGGGTCACTGTGGG - Intergenic
1057426033 9:94950519-94950541 GGGGCTCAGATGGGCACTGTTGG + Intronic
1062145189 9:134985178-134985200 GGGGCTCAGCAGGTCTATGTAGG - Intergenic
1191743600 X:64463057-64463079 GGGGTGCAGGGGGTCCCCGTTGG + Intergenic
1200103240 X:153698752-153698774 GGGGTCCTGAGGGTGACTGTGGG - Intergenic
1200115945 X:153769774-153769796 GGGGTCCATCAGGTCACCGTGGG - Intronic