ID: 1083847674

View in Genome Browser
Species Human (GRCh38)
Location 11:65345467-65345489
Sequence CCGTGGGGCTCTCTAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083847674_1083847681 -2 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847681 11:65345488-65345510 GGCCTGATGCTCCTGGCTGAGGG 0: 1
1: 0
2: 1
3: 21
4: 274
1083847674_1083847686 18 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847686 11:65345508-65345530 GGGGAAGTGGCCGTCACTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 123
1083847674_1083847680 -3 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847680 11:65345487-65345509 CGGCCTGATGCTCCTGGCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 211
1083847674_1083847682 -1 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847682 11:65345489-65345511 GCCTGATGCTCCTGGCTGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 217
1083847674_1083847684 5 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847684 11:65345495-65345517 TGCTCCTGGCTGAGGGGAAGTGG 0: 1
1: 0
2: 4
3: 47
4: 419
1083847674_1083847676 -9 Left 1083847674 11:65345467-65345489 CCAGAAGCTAGAGAGCCCCACGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1083847676 11:65345481-65345503 GCCCCACGGCCTGATGCTCCTGG 0: 1
1: 0
2: 1
3: 16
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083847674 Original CRISPR CCGTGGGGCTCTCTAGCTTC TGG (reversed) Intronic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
907300013 1:53481235-53481257 CTTTGGGGCTCTCTGGCTTCTGG - Intergenic
907310855 1:53538254-53538276 CCGTGAGGCTCTCGAGGGTCTGG + Intronic
912924996 1:113905696-113905718 CCGTGGGCCTGTCTAGCACCTGG + Exonic
922918100 1:229275334-229275356 CCTTGCCTCTCTCTAGCTTCTGG - Intronic
1063689918 10:8277116-8277138 AAGAGGGGCTCCCTAGCTTCTGG + Intergenic
1075457088 10:122591903-122591925 ACGTGGTCCTCTCTGGCTTCTGG - Intronic
1075495842 10:122917734-122917756 TCGTGGGGATCTCTAGCAGCTGG - Intergenic
1083603178 11:63961478-63961500 CCATGGGCCTCTCTTGTTTCTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1085035888 11:73299800-73299822 CCCTGAGGCTCTCAAGCTGCTGG - Intergenic
1087100298 11:94357271-94357293 CCTGGGGTCTCTCTAGCTTTTGG + Intergenic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1102371306 12:112384102-112384124 CCAAGGGGGTCTCGAGCTTCTGG - Intergenic
1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG + Exonic
1104755581 12:131267211-131267233 CCGTGGCTTTCTCCAGCTTCGGG + Intergenic
1108848236 13:54700207-54700229 CCTTGGGGCTCTGTGGTTTCTGG - Intergenic
1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG + Intergenic
1110850689 13:80241413-80241435 CTTTGGGGCTCTGTAGCTCCTGG - Intergenic
1113942094 13:114023630-114023652 TCGTGGGGCTCTCTAAATCCTGG + Intronic
1117599616 14:57361963-57361985 CCTTGCCACTCTCTAGCTTCCGG - Intergenic
1118616976 14:67580656-67580678 CCATGGGGCTGCCTAGCCTCTGG + Intronic
1119223763 14:72928871-72928893 CCTTGGGGCTCTCCAGTTTGGGG - Intronic
1119808485 14:77498170-77498192 CAGTGGGGCTCTCCAGCCGCCGG - Intronic
1120800156 14:88678980-88679002 CCTTGTTTCTCTCTAGCTTCTGG + Intronic
1121340232 14:93100627-93100649 CCTTGGGGCATTCTGGCTTCAGG - Intronic
1122441997 14:101738187-101738209 CCGTGTGGCTGTCTCGTTTCAGG - Intergenic
1124962585 15:34409797-34409819 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1124979210 15:34556019-34556041 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1125172191 15:36778212-36778234 CTGTGGGGGTCAGTAGCTTCAGG - Intronic
1128562212 15:68676393-68676415 CCGGGGGCCAATCTAGCTTCAGG + Intronic
1132622178 16:872991-873013 CAGTGGGGAACTCTAGCCTCAGG + Intronic
1141502826 16:84455479-84455501 CGGAGGTGCTCTCTAGGTTCTGG + Intronic
1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG + Intronic
1142953688 17:3505581-3505603 CCATGGGACTCTCAGGCTTCAGG - Intronic
1145065993 17:19761855-19761877 CCGTGGGCCTCTGCAGCTGCAGG + Intergenic
1146885000 17:36464669-36464691 CCGTGGGGCTCTCCACTTTTCGG - Intergenic
1152527264 17:80895462-80895484 ACGTGCGGCTCTCAAGCTCCAGG - Intronic
1152818054 17:82420432-82420454 CCTTGCTTCTCTCTAGCTTCTGG - Intronic
1158467206 18:57701486-57701508 TAGTGGTTCTCTCTAGCTTCTGG + Intronic
1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG + Intronic
930247255 2:48997133-48997155 CCAGTGGTCTCTCTAGCTTCTGG + Intronic
938444610 2:131367246-131367268 CCCTGGGGCTCCCAGGCTTCGGG - Intergenic
942683200 2:178501226-178501248 CTGTGGGGCTCTGTAATTTCTGG + Intronic
945620335 2:212127848-212127870 CCTTGCCACTCTCTAGCTTCTGG - Intronic
946747606 2:222861333-222861355 CCGAGGGGCTCCCCAGCCTCGGG + Intronic
948003794 2:234590827-234590849 GGGCGGGGCTCTCTAGATTCGGG - Intergenic
948456486 2:238106838-238106860 CCGTGGGGCTCCTTCGCATCTGG - Intronic
1172005793 20:31818616-31818638 CCGAGGGGCACTCTAGCCTGAGG - Intergenic
1174111485 20:48200917-48200939 CTCTGGGGCTCTCTGGCTTGAGG + Intergenic
1175529286 20:59663042-59663064 CCCTGGGCCTCTCTAGCGTCTGG + Intronic
1178966185 21:37120696-37120718 CCGTGTGGCTCTAAAGGTTCTGG - Intronic
1179543272 21:42098211-42098233 TCGTGGGGCTCTCTGGGATCCGG - Intronic
1182604947 22:31496108-31496130 GCGTGGGCCTCTCTGGCTTTTGG - Intronic
1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG + Intergenic
1183781462 22:40001831-40001853 GGGTGGGGCTCCCTAACTTCTGG - Intronic
949940255 3:9149249-9149271 CAGATGGGCTCTCTAGCTTCAGG - Intronic
950033385 3:9866799-9866821 TCATGGTGCTCTCTACCTTCTGG - Exonic
950055024 3:10017579-10017601 TCATGGTGCTCTCTACCTTCTGG - Intergenic
953407633 3:42667298-42667320 CCTTGGGGCTCTCTGGTCTCAGG + Intergenic
962261950 3:133916024-133916046 CTGTGGGGCTTTCACGCTTCTGG + Intergenic
962918814 3:139933639-139933661 ATGTGGGGCTCTTTACCTTCAGG - Intergenic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
969197396 4:5573841-5573863 CCGTGGGCCTTGCTAGCTGCAGG - Intronic
970203045 4:13628239-13628261 CCGTGGGGGTCCCTTGTTTCTGG + Intergenic
978061401 4:104344744-104344766 CCGTGGCTCTCTCTAGATTTTGG + Intergenic
980799911 4:137734709-137734731 CTTGTGGGCTCTCTAGCTTCAGG - Intergenic
981102853 4:140849603-140849625 CCGTGCCTCTCCCTAGCTTCTGG + Intergenic
985699329 5:1361093-1361115 CCCTAGGGCTCCCCAGCTTCTGG - Intergenic
988218937 5:28316524-28316546 CTGTGGGCCTCTCTAGATTTGGG - Intergenic
989268438 5:39504244-39504266 CCATGTCTCTCTCTAGCTTCTGG + Intergenic
990418497 5:55609155-55609177 CTGAGGGGCTTTCCAGCTTCAGG - Intergenic
993567164 5:89490051-89490073 CCTTGGCTCTTTCTAGCTTCTGG - Intergenic
996442309 5:123505947-123505969 TTGTGAGGCTCTCTAGCTTCAGG - Intergenic
1002108532 5:176892492-176892514 CCCTGGGGCTCTTAAGCTACTGG - Intronic
1002417039 5:179126130-179126152 CCGTCGAGCTCTCTGCCTTCAGG - Exonic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1005327307 6:24715280-24715302 CTGTGGGGATCTCTTGGTTCAGG + Intronic
1014118448 6:117694125-117694147 CTGTGGGTCTCTTTTGCTTCTGG - Exonic
1014218941 6:118780852-118780874 CCCTTGGCCTCTCTAGCCTCGGG + Intergenic
1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG + Intergenic
1019896456 7:3987245-3987267 CCGTGGTGCTCTCTTGGGTCCGG + Exonic
1022889547 7:34682352-34682374 CCCTGGGGGTGTCTAGGTTCAGG - Intronic
1026833633 7:73624259-73624281 CCGTGGGGCCCTCCGACTTCGGG - Exonic
1034997571 7:155587720-155587742 CCGTGGCGCTCCCTGGCTTGTGG + Intergenic
1035356694 7:158280010-158280032 CCGCGGGGCTCTGTGGGTTCGGG - Intronic
1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG + Intergenic
1053403665 9:37851388-37851410 CCGTGTTGGTCTCTAACTTCTGG + Intronic
1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG + Intronic
1058774908 9:108273455-108273477 TTGTGAGGCTCTCTGGCTTCAGG - Intergenic
1061798586 9:133102419-133102441 CCTTGGGGCTCAGAAGCTTCAGG - Intronic
1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG + Exonic
1190099648 X:47512826-47512848 CTGTGGGTCTCTTTTGCTTCTGG + Intergenic
1191269479 X:58444980-58445002 CCATGGGGGTCTCTGCCTTCTGG + Intergenic
1200977278 Y:9226788-9226810 CACTGGGGCTCTCCAGTTTCTGG - Intergenic
1202133526 Y:21636103-21636125 CTCTGGGGCTCTCCAGTTTCTGG + Intergenic